Accession ID: MIRT001992 [miRNA, hsa-miR-182-5p :: ADCY6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-182LinkOut: [miRBase ]
Description Homo sapiens miR-182 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-182-5p
Mature Sequence 23| UUUGGCAAUGGUAGAACUCACACU |46
Evidence Experimental
Experiments Cloned
Putative hsa-miR-182-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ADCY6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AC6
Description adenylate cyclase 6
Transcript NM_015270    LinkOut: [ RefSeq ]
Other Transcripts NM_020983   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ADCY6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ADCY6
(miRNA target sites are highlighted)
>ADCY6|NM_015270|3'UTR
   1 CAGGGCCCAGCCACAAATTCAGCTGAAGGGACCAAGGTGGGCATTGAGTGGACTCTGTGCTCACTGGGTGGAGCTGTGGC
  81 AGGGGGCACTGAGCCTCCAGACCCTGCTAACCACAAAAGGGAACATCCCAGCAGGCTGTGCTTGGATCATGCTCGTCTGC
 161 CCTCAAGCTGGAAAACAAGGGGCTACCTACCGAGAGGATTATGCAAGTGACTTTCTTTCTTACTTGGGGTAGGGCTGTTC
 241 CCTCTCCAATCTTCCAGCCTTTGGGAGCAGGGGAGGGGTCAGTAGCAGAAGCAGAGGGAGGCCTCTTGCCTGAGGGATTA
 321 AAATGGCAGCTTGCCATGCCTACCCTTCCCTGTCTGTCTGGGCAGCAGGTTCAGGGCTGAGCCCTTCTTTTCCCTCTTTT
 401 TTCCTGGGAATATTTTGTACAATATTTTGTACAAAGACAGGCATGAGGAGTGCCTATTCCATGCTTGCCTTTGCAATACC
 481 TGCATCCCCAGCACTGGTCCTGGGCACTTCCCCACCCCAGCCAGGTGTCCCTCCTATGCACAGAGCAGAGGAGGGAGAAG
 561 CTCTGGGGAGCCAGCTTTGGCCATATTTCAGGAGAATGTTTCCATGTGCCAAATCTTAGTCCCATGATCTGTCCCCAAAG
 641 GGGAACAAAGGGACCTCTGACAGCTTAGATTTAGCCCCAGTTCCTGCACGCTCCAGGGAACGGGGTGTCTGGCCTCACTG
 721 GTACTGTGAAAAATGCTCAGAGAGCAAGCCTGTGTGTGGGGATGTCAGGTCAGGAGCTGGAAGTTCACCTGCAGGTGCCA
 801 AAGAGCAGGCCGGCCAGGGCTGGGGCAGTGCCAGACTCTGATCTGAGGACCCCGTCGGGGTCCAGATCAGGTCACTCTGC
 881 CCCAGTGCTCTCTTGCTGTCTGCTGACAAGGGGGCATGGAGCATCTCTTCCTCTTCTGTTGCCAAATAGAAAAGGGTCAG
 961 GGCATGGAGAAAGGTGACCCTGATCCCAAACCTGCCCTCCCAAGTCTCTGGTGTTGGGGAGGGCCCGTGTGTTTGTGTAA
1041 CTGTGTGTGCATGTTGGTCTTTGTGTGCATATCTGTTTTCCAGGTCTATGTGAGTCCTTGTGCTCCTGCTCCTCAGCTCT
1121 CCACCCCAGGTTGCCTCTCTCCTGTGGGCCTCTGTCTTCTGGGAATAAAGCAGGGTTTCCTACTTCAGGGGATGTAGAGA
1201 GATGCCCAGGTTGCACAGGAGTGGGATGGGGTGTGGTAGCAAAAGGAGGGAGAGGAGTCCTTTTTGTGCCAAATCCCTAA
1281 GTGCCGTTCGGGGGCCATGTGTGCAGCATGACTCTCCCTGTCTGTGGCAGGGACCCAAGCGCTTGCTTAAGCCCCAGTGC
1361 TCCATGCCAGCACTTGAACTGTCTGGGGTTTGATGGACAGAGGCTGAGGAATTTCCTGGCTTCCCCAGATAGTGTCCTGG
1441 GACATGGTATGCTTTGGGGCTGGGGTAGCATGGAATCCCTCTGAGGACCTGGATACTGGTACTACGGGGTGGGGAAGAGG
1521 AACCTTAAACTTGGCTTTCCCCAGCCTTCAGCCTGAGTCTAGCATGTTTCTAGCTCCCCAGTCCCTTGTGAAGCCTTGAG
1601 GGCTGGCAGAAGGGTTAGGAGGTTGAACTCTAGATTCCCTTCCTGTCTTTGCCTTCCTTTTACCCCTTTCCCTGCAACCT
1681 CCTTGACTCTGGCCTGAATTTGTTGGTGCCTCAGTTTCTCTGTCTGTACCTATTTAAGCCAAAGGCACTAGCCTGAATTT
1761 TGCTTGAAGATCACTTTGTCTTGGAAATGACTAGAGAGGCAGAGGAGAAGGGTTTCCAGAGTTGCTAGGTTTGGGAGTGG
1841 AAGGGGCAGGCAGTGCACTTGCCCCTCCTCATGCCCCTTCTGACACCAGCTCCCTGTGGAGGCCTGGTTTCTGGGTAATG
1921 CCTCCCTTGGGCATCTTCATGCATCAACCAAATGGGCCATCAGGTACTTCATTAGTCATGGCAGAAGGAGGGGAAAAGAC
2001 TTGTTTTCCAGACAGAAAATCTACTCCCCTGTCCCCAGCCATATCCCTGGATAGGAAGGGATAGGAAGAGACTACTTGGT
2081 GCCATGGGGTAGGGGTGAGGGTATAAGTAGATCAGAGTGGGAAGACCTCAGCCTTGGGTGGCTTGTCTCTGCTTCTTGCC
2161 AGGTGGGAGGGCCTGTCCACACCCTGGATCCCCGTACCACAGTGCCAGCCATGCCCTTCCCCTGGGCTACCATTGTCCCT
2241 TTCCTCACCCAGTTGGTAGAGGAGTCAGGAGGTGGGAGGCCGTGGGCTTTGGTTTTATAATGTAACCACTGTGGGGGTGG
2321 GGGAGGATGGTGAACCATGTATTTCAGTGAAATATTTAATATATTTAAATATCAATAAAATCAAACTCTTTGTAAAATT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucacacucaAGAUGGUAACGGUUu 5'
                   ||| |::||||||| 
Target 5' atctcttccTCTTCTGTTGCCAAa 3'
923 - 946 159.00 -13.10
2
miRNA  3' ucaCACU---CA-AGAUG-GUAACGGUUu 5'
             |||:   || |||:| : ||||||: 
Target 5' tggGTGGCTTGTCTCTGCTTCTTGCCAGg 3'
2135 - 2163 141.00 -17.60
3
miRNA  3' ucaCACUCAAGAUGGUA-ACGGUUu 5'
             | || | :| |||| |||||| 
Target 5' cagGAGAATGTTTCCATGTGCCAAa 3'
589 - 613 137.00 -14.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-182-5p :: ADCY6    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research DIANA-microT , miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... miR-96 or miR-182 down-regulated luciferase activity by 75% ( 2%) and 61% ( 7%), respectively (Fig. 7C). Co-transfection with miR-96 plus miR-182 had the same effect as miR-96 alone (74 4% inhibition). These results strongly support the prediction of Adcy6 as a direct target of miR-96 and miR-182. ...

- Xu, S. Witmer, P. D. Lumayag, S. Kovacs, B. et al., 2007, J Biol Chem.

Article - Xu, S. Witmer, P. D. Lumayag, S. Kovacs, B. et al.
- J Biol Chem, 2007
Although microRNAs (miRNAs) provide a newly recognized level of regulation of gene expression, the miRNA transcriptome of the retina and the contributions of miRNAs to retinal development and function are largely unknown. To begin to understand the functions of miRNAs in retina, we compared miRNA expression profiles in adult mouse retina, brain, and heart by microarray analysis. Our results show that at least 78 miRNAs are expressed in adult mouse retina, 21 of which are potentially retina-specific. Among these, we identified a polycistronic, sensory organ-specific paralogous miRNA cluster that includes miR-96, miR-182, and miR-183 on mouse chromosome 6qA3 with conservation of synteny to human chromosome 7q32.2. In situ hybridization showed that members of this cluster are expressed in photoreceptors, retinal bipolar and amacrine cells. Consistent with their genomic organization, these miRNAs have a similar expression pattern during development with abundance increasing postnatally and peaking in adult retina. Target prediction and in vitro functional studies showed that MITF, a transcription factor required for the establishment and maintenance of retinal pigmented epithelium, is a direct target of miR-96 and miR-182. Additionally, to identify miRNAs potentially involved in circadian rhythm regulation of the retina, we performed miRNA expression profiling with retinal RNA harvested at noon (Zeitgeber time 5) and midnight (Zeitgeber time 17) and identified a subgroup of 12 miRNAs, including members of the miR-183/96/182 cluster with diurnal variation in expression pattern. Our results suggest that miR-96 and miR-182 are involved in circadian rhythm regulation, perhaps by modulating the expression of adenylyl cyclase VI (ADCY6).
LinkOut: [PMID: 17597072]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-182-5p :: ADCY6    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... a signi´Čücant reduction in luciferase activity of plasmids with 3' UTR of ADCY6, CLOCK and DSIP genes was shown when transfecting cells with the mutated form of pre-miR-182 compared with cells that did not express miR-182.// ...

- Saus, E. Soria, V. Escaramis, G. Vivarelli, et al., 2010, Hum Mol Genet.

Article - Saus, E. Soria, V. Escaramis, G. Vivarelli, et al.
- Hum Mol Genet, 2010
Previous studies in mice have reported five different microRNAs (miRNAs; miR-219-1/132/183/96/182) to be modulators of the endogenous circadian clock and have presented experimental evidence for some of the genes involved in the molecular clock machinery as target sites. Moreover, disruption of circadian rhythms has long been implicated in the pathophysiology of major depression (MD). We investigated these miRNAs and some of their target sites at the sequence and functional levels as possible predisposing factors for susceptibility to MD and related chronobiological subphenotypes. Mutational screening was performed in a sample of 359 MD patients and 341 control individuals. We found a significant association between the T allele of the rs76481776 polymorphism in the pre-miR-182 and late insomnia in MD patients. Previous studies have reported an association between insomnia and CLOCK gene, a predicted miR-182 target site. A significant overexpression of miR-182 was detected by quantitative real-time polymerase chain reaction in cells transfected with the mutated form of the pre-miR-182 when compared with wild-type form. Moreover, a significant reduction in luciferase activity of plasmids with 3' UTR of ADCY6, CLOCK and DSIP genes was shown when transfecting cells with the mutated form of pre-miR-182 compared with cells that did not express miR-182. These data indicate that abnormal processing of pre-miR-182 in patients carrying the T allele of the rs76481776 polymorphism may contribute to the dysregulation of circadian rhythms in MD patients with insomnia, which could influence expression levels of the mature form of miR-182 and might increase downregulation in some of its target genes.
LinkOut: [PMID: 20656788]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
157 hsa-miR-182-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000576 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT000671 FOXO3 forkhead box O3 3 3
MIRT001086 FOXO1 forkhead box O1 6 3
MIRT001222 RARG retinoic acid receptor, gamma 3 1
MIRT001990 MITF microphthalmia-associated transcription factor 4 4
MIRT001992 ADCY6 adenylate cyclase 6 3 2
MIRT003145 Mitf microphthalmia-associated transcription factor 3 1
MIRT003601 EP300 E1A binding protein p300 2 1
MIRT005358 CLOCK clock homolog (mouse) 3 1
MIRT005359 TSC22D3 TSC22 domain family, member 3 3 1
MIRT006273 CREB1 cAMP responsive element binding protein 1 1 1
MIRT006300 MTSS1 metastasis suppressor 1 1 4
MIRT006823 FGF9 fibroblast growth factor 9 (glia-activating factor) 2 1
MIRT006824 NTM neurotrimin 2 1
MIRT006978 CYLD cylindromatosis (turban tumor syndrome) 3 1
MIRT007063 BCL2 B-cell CLL/lymphoma 2 3 2
MIRT007064 CCND2 cyclin D2 3 1
MIRT007155 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 3 2
MIRT007199 PFN1 profilin 1 2 5
MIRT007226 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT007293 RECK reversion-inducing-cysteine-rich protein with kazal motifs 4 4
MIRT007306 SMAD4 SMAD family member 4 1 1
MIRT007330 FOXF2 forkhead box F2 1 1
MIRT025033 IGF1R insulin-like growth factor 1 receptor 2 2
MIRT047175 CISD2 CDGSH iron sulfur domain 2 1 1
MIRT047176 BRIP1 BRCA1 interacting protein C-terminal helicase 1 1 1
MIRT047177 RBM12 RNA binding motif protein 12 1 1
MIRT047178 CBX6 chromobox homolog 6 1 1
MIRT047179 FMNL3 formin-like 3 1 1
MIRT047180 RPL5 ribosomal protein L5 1 1
MIRT047181 RCC2 regulator of chromosome condensation 2 1 1
MIRT047182 GNL1 guanine nucleotide binding protein-like 1 1 1
MIRT047183 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 1 1
MIRT047184 C1orf174 chromosome 1 open reading frame 174 1 1
MIRT047185 RLF rearranged L-myc fusion 1 1
MIRT047186 CASC3 cancer susceptibility candidate 3 1 1
MIRT047187 FLOT1 flotillin 1 4 2
MIRT047188 BAG1 BCL2-associated athanogene 1 1
MIRT047189 RBM15B RNA binding motif protein 15B 1 1
MIRT047190 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT047191 RPS4X ribosomal protein S4, X-linked 1 1
MIRT047192 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT047193 RPS3 ribosomal protein S3 1 1
MIRT047194 APITD1 apoptosis-inducing, TAF9-like domain 1 1 1
MIRT047195 TMEM184C transmembrane protein 184C 1 1
MIRT047196 ETV3 ets variant 3 1 1
MIRT047197 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT047198 UBP1 upstream binding protein 1 (LBP-1a) 1 1
MIRT047199 USP16 ubiquitin specific peptidase 16 1 1
MIRT047200 ACVR1B activin A receptor, type IB 1 1
MIRT047201 STAG2 stromal antigen 2 1 1
MIRT047202 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT047203 ATP5O ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit 1 1
MIRT047204 SLC25A14 solute carrier family 25 (mitochondrial carrier, brain), member 14 1 1
MIRT047205 TTC28 tetratricopeptide repeat domain 28 1 1
MIRT047206 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT047207 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 1 1
MIRT047208 ACTN4 actinin, alpha 4 1 1
MIRT047209 TUBA1B tubulin, alpha 1b 1 1
MIRT047210 EVI5 ecotropic viral integration site 5 1 2
MIRT047211 VPS51 vacuolar protein sorting 51 homolog (S. cerevisiae) 1 1
MIRT047212 ANO6 anoctamin 6 1 1
MIRT047213 PCOLCE2 procollagen C-endopeptidase enhancer 2 1 1
MIRT047214 LBR lamin B receptor 1 1
MIRT047215 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha 1 1
MIRT047216 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT047217 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT047218 ATP13A3 ATPase type 13A3 1 1
MIRT052907 PTEN phosphatase and tensin homolog 4 1
MIRT053784 GSK3B glycogen synthase kinase 3 beta 4 1
MIRT054261 ANUBL1 zinc finger, AN1-type domain 4 4 1
MIRT054501 BDNF brain-derived neurotrophic factor 2 1
MIRT054760 SATB2 SATB homeobox 2 3 1
MIRT054831 CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) 3 1
MIRT054846 CADM1 cell adhesion molecule 1 3 1
MIRT054847 TP53INP1 tumor protein p53 inducible nuclear protein 1 3 1
MIRT180171 NOTCH2 notch 2 1 1
MIRT203593 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT265950 QSER1 glutamine and serine rich 1 1 1
MIRT353008 NUP50 nucleoporin 50kDa 1 1
MIRT437453 ATF1 activating transcription factor 1 1 1
MIRT437454 BARD1 BRCA1 associated RING domain 1 1 1
MIRT437455 CREB5 cAMP responsive element binding protein 5 1 1
MIRT437456 RAD17 RAD17 homolog (S. pombe) 1 1
MIRT437457 TP53BP1 tumor protein p53 binding protein 1 1 1
MIRT437458 CHEK2 checkpoint kinase 2 1 1
MIRT437459 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT437460 SMARCD3 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 1 1
MIRT437477 TCEAL7 transcription elongation factor A (SII)-like 7 3 1
MIRT437908 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 2 1
MIRT437991 LRRC4 leucine rich repeat containing 4 2 1
MIRT438101 NDRG1 N-myc downstream regulated 1 1 1
MIRT438374 THBS1 thrombospondin 1 1 1
MIRT438756 ULBP2 UL16 binding protein 2 3 1
MIRT442967 CTNNA3 catenin (cadherin-associated protein), alpha 3 1 1
MIRT447362 RASA2 RAS p21 protein activator 2 1 1
MIRT452673 GPR156 G protein-coupled receptor 156 1 1
MIRT453463 PITPNM3 PITPNM family member 3 1 1
MIRT454767 STOML3 stomatin (EPB72)-like 3 1 1
MIRT468017 SIN3B SIN3 transcription regulator homolog B (yeast) 1 1
MIRT468529 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT470488 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT474426 KLHL28 kelch-like 28 (Drosophila) 1 3
MIRT481285 ATXN1L ataxin 1-like 1 1
MIRT491596 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT501916 MBD4 methyl-CpG binding domain protein 4 1 2
MIRT502391 GATSL2 GATS protein-like 2 1 1
MIRT503220 ACER2 alkaline ceramidase 2 1 1
MIRT503542 RPL7L1 ribosomal protein L7-like 1 1 3
MIRT505720 SESN2 sestrin 2 1 1
MIRT509890 RPS23 ribosomal protein S23 1 2
MIRT525375 SYNM synemin, intermediate filament protein 1 1
MIRT529422 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT533379 UBE2D4 ubiquitin-conjugating enzyme E2D 4 (putative) 1 2
MIRT533467 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT533594 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT535084 PODXL podocalyxin-like 1 1
MIRT541181 MORF4L1 mortality factor 4 like 1 1 1
MIRT549835 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550346 INCENP inner centromere protein antigens 135/155kDa 1 2
MIRT553851 SYDE2 synapse defective 1, Rho GTPase, homolog 2 (C. elegans) 1 1
MIRT555374 PPP1R12A protein phosphatase 1, regulatory subunit 12A 1 1
MIRT555508 PNISR PNN-interacting serine/arginine-rich protein 1 1
MIRT555928 NUP43 nucleoporin 43kDa 1 1
MIRT556301 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT557099 HOXA9 homeobox A9 1 1
MIRT557242 CRAMP1L Crm, cramped-like (Drosophila) 1 1
MIRT557937 FAM73A family with sequence similarity 73, member A 1 1
MIRT558452 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT558720 CITED2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 1 1
MIRT561179 TNFRSF10A tumor necrosis factor receptor superfamily, member 10a 1 1
MIRT565334 TMEM170B transmembrane protein 170B 1 1
MIRT571607 SYNGR2 synaptogyrin 2 1 1
MIRT573342 TUBD1 tubulin, delta 1 1 1
MIRT574601 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT576272 Cd59a CD59a antigen 1 1
MIRT609631 PLEKHA8 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 1 1
MIRT612970 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT614906 NPTX1 neuronal pentraxin I 1 1
MIRT614997 GABRB1 gamma-aminobutyric acid (GABA) A receptor, beta 1 1 1
MIRT621334 SLC11A1 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 1 1
MIRT622018 STK17B serine/threonine kinase 17b 1 1
MIRT640564 CPE carboxypeptidase E 1 1
MIRT644327 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT646586 ANKRD36 ankyrin repeat domain 36 1 1
MIRT650974 ZNF831 zinc finger protein 831 1 1
MIRT652228 TRAPPC3L BET3 like (S. cerevisiae) 1 1
MIRT654840 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT656984 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT658776 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT668093 GK5 glycerol kinase 5 (putative) 1 1
MIRT668472 EXOSC2 exosome component 2 1 1
MIRT687430 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT689956 ZNF185 zinc finger protein 185 (LIM domain) 1 1
MIRT690114 ZFAND1 zinc finger, AN1-type domain 1 1 1
MIRT697753 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT720750 FAM193A family with sequence similarity 193, member A 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*