Accession ID: MIRT002025 [miRNA, hsa-miR-124-3p :: CEBPA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-124-1LinkOut: [miRBase ]
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-124-3p
Mature Sequence 53| UAAGGCACGCGGUGAAUGCC |72
Evidence Experimental
Experiments Cloned
Putative hsa-miR-124-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CEBPA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C/EBP-alpha, CEBP
Description CCAAT/enhancer binding protein (C/EBP), alpha
Transcript NM_0043    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CEBPA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
(miRNA target sites are highlighted)
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
               | ||| :||||||| 
Target 5' taggaTAACCTTGTGCCTTg 3'
275 - 294 155.00 -18.50
            ::| | || || ||||||| 
971 - 992 150.00 -15.40
miRNA  3' ccguaaGUGGCGCACGGAAu 5'
                ||   |||||||| 
Target 5' ggggagCAAATCGTGCCTTg 3'
332 - 351 146.00 -16.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-124-3p :: CEBPA    [ Functional MTI ]
Validation Method Microarray , Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... Filtering the expression profiles for genes characterized by the LocusLink database12 that were significantly downregulated (P < 0.001) at both 12 and 24 h, gave sets of 96 and 174 annotated genes downregulated by miR-1 and miR-124, respectively (Supplementary Tables 1 and 2).//{These MTI shown in Supplementary Table 1,2,4} ...

- Lim, L. P. Lau, N. C. Garrett-Engele, P. et al., 2005, Nature.

Article - Lim, L. P. Lau, N. C. Garrett-Engele, P. et al.
- Nature, 2005
MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression in plants and animals. To investigate the influence of miRNAs on transcript levels, we transfected miRNAs into human cells and used microarrays to examine changes in the messenger RNA profile. Here we show that delivering miR-124 causes the expression profile to shift towards that of brain, the organ in which miR-124 is preferentially expressed, whereas delivering miR-1 shifts the profile towards that of muscle, where miR-1 is preferentially expressed. In each case, about 100 messages were downregulated after 12 h. The 3' untranslated regions of these messages had a significant propensity to pair to the 5' region of the miRNA, as expected if many of these messages are the direct targets of the miRNAs. Our results suggest that metazoan miRNAs can reduce the levels of many of their target transcripts, not just the amount of protein deriving from these transcripts. Moreover, miR-1 and miR-124, and presumably other tissue-specific miRNAs, seem to downregulate a far greater number of targets than previously appreciated, thereby helping to define tissue-specific gene expression in humans.
LinkOut: [PMID: 15685193]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-124-3p :: CEBPA    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Reporter assay , Other
Conditions K562
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Using a computational microRNA (miRNA) prediction approach and functional studies, we show that C/EBPa mRNA is a target for miRNA-124a. This miRNA is frequently silenced by epigenetic mechanisms in leukemia cell lines, becomes up-regulated after epigenetic treatment, and targets the C/EBPa 3ΒΆ untranslated region. ...

- Hackanson, B. Bennett, K. L. Brena, R. M. et al., 2008, Cancer Res.

Article - Hackanson, B. Bennett, K. L. Brena, R. M. et al.
- Cancer Res, 2008
Functional loss of CCAAT/enhancer binding protein alpha (C/EBP alpha), a master regulatory transcription factor in the hematopoietic system, can result in a differentiation block in granulopoiesis and thus contribute to leukemic transformation. Here, we show the effect of epigenetic aberrations in regulating C/EBP alpha expression in acute myeloid leukemia (AML). Comprehensive DNA methylation analyses of the CpG island of C/EBP alpha identified a densely methylated upstream promoter region in 51% of AML patients. Aberrant DNA methylation was strongly associated with two generally prognostically favorable cytogenetic subgroups: inv(16) and t(15;17). Surprisingly, while epigenetic treatment increased C/EBP alpha mRNA levels in vitro, C/EBP alpha protein levels decreased. Using a computational microRNA (miRNA) prediction approach and functional studies, we show that C/EBP alpha mRNA is a target for miRNA-124a. This miRNA is frequently silenced by epigenetic mechanisms in leukemia cell lines, becomes up-regulated after epigenetic treatment, and targets the C/EBP alpha 3' untranslated region. In this way, C/EBP alpha protein expression is reduced in a posttranscriptional manner. Our results indicate that epigenetic alterations of C/EBP alpha are a frequent event in AML and that epigenetic treatment can result in down-regulation of a key hematopoietic transcription factor.
LinkOut: [PMID: 18451139]
MiRNA-Target Expression Profile:

MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1324 hsa-miR-124-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000360 SOX9 SRY (sex determining region Y)-box 9 1 1
MIRT000362 BDNF brain-derived neurotrophic factor 1 1
MIRT000478 EFNB1 ephrin-B1 4 1
MIRT001168 NR3C2 nuclear receptor subfamily 3, group C, member 2 3 1
MIRT001825 BACE1 beta-site APP-cleaving enzyme 1 2 1
MIRT001827 RAVER2 ribonucleoprotein, PTB-binding 2 3 1
MIRT001828 MAGT1 magnesium transporter 1 3 1
MIRT001830 SUCLG2 succinate-CoA ligase, GDP-forming, beta subunit 3 1
MIRT001831 SURF4 surfeit 4 3 1
MIRT001832 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 3 1
MIRT001833 ADIPOR2 adiponectin receptor 2 1 1
MIRT001834 MTPN myotrophin 1 1
MIRT002025 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 4 3
MIRT002560 DFFB DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) 2 2
MIRT002561 TRIM29 tripartite motif-containing 29 2 1
MIRT002563 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 2 2
MIRT002564 RARG retinoic acid receptor, gamma 2 1
MIRT002565 PARP16 poly (ADP-ribose) polymerase family, member 16 2 2
MIRT002566 ARPC1B actin related protein 2/3 complex, subunit 1B, 41kDa 2 2
MIRT002567 PTPN12 protein tyrosine phosphatase, non-receptor type 12 2 2
MIRT002568 EYA4 eyes absent homolog 4 (Drosophila) 2 1
MIRT002569 TARBP1 TAR (HIV-1) RNA binding protein 1 2 2
MIRT002570 MAD2L2 MAD2 mitotic arrest deficient-like 2 (yeast) 2 2
MIRT002571 LMNB1 lamin B1 2 2
MIRT002572 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 2 2
MIRT002574 UHRF1 ubiquitin-like with PHD and ring finger domains 1 2 1
MIRT002575 CPNE3 copine III 2 1
MIRT002576 SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 2 2
MIRT002577 DHCR24 24-dehydrocholesterol reductase 2 1
MIRT002578 ACTR8 ARP8 actin-related protein 8 homolog (yeast) 2 1
MIRT002579 MYH9 myosin, heavy chain 9, non-muscle 2 2
MIRT002580 ELF4 E74-like factor 4 (ets domain transcription factor) 2 2
MIRT002581 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like 2 2
MIRT002583 CDCA7 cell division cycle associated 7 2 2
MIRT002585 SLC15A4 solute carrier family 15, member 4 2 2
MIRT002586 STOM stomatin 2 2
MIRT002587 MTMR6 myotubularin related protein 6 2 2
MIRT002588 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 2 1
MIRT002589 ANXA8 annexin A8 2 1
MIRT002590 OSBPL8 oxysterol binding protein-like 8 2 2
MIRT002592 BTG3 BTG family, member 3 2 2
MIRT002594 VAMP3 vesicle-associated membrane protein 3 (cellubrevin) 3 5
MIRT002595 USP48 ubiquitin specific peptidase 48 2 1
MIRT002596 PTTG1IP pituitary tumor-transforming 1 interacting protein 2 2
MIRT002597 PGM1 phosphoglucomutase 1 2 2
MIRT002598 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 2 2
MIRT002599 TOM1L1 target of myb1 (chicken)-like 1 2 1
MIRT002600 SMAD5 SMAD family member 5 2 1
MIRT002601 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 2 2
MIRT002602 RYK RYK receptor-like tyrosine kinase 2 1
MIRT002604 CTGF connective tissue growth factor 3 3
MIRT002605 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT002606 GNG10 guanine nucleotide binding protein (G protein), gamma 10 2 2
MIRT002607 GMCL1P1 germ cell-less homolog 1 (Drosophila)-like 1 1
MIRT002610 MAPK14 mitogen-activated protein kinase 14 2 3
MIRT002611 NEK6 NIMA (never in mitosis gene a)-related kinase 6 2 1
MIRT002612 MAN2A1 mannosidase, alpha, class 2A, member 1 2 2
MIRT002613 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 2 2
MIRT002614 BLOC1S6 pallidin homolog (mouse) 2 2
MIRT002615 DEPDC1 DEP domain containing 1 2 2
MIRT002616 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 3 1
MIRT002617 KATNA1 katanin p60 (ATPase-containing) subunit A 1 2 2
MIRT002618 SLC22A5 solute carrier family 22 (organic cation/carnitine transporter), member 5 2 2
MIRT002619 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 2 2
MIRT002620 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 2 2
MIRT002623 DCTD dCMP deaminase 2 2
MIRT002624 CD59 CD59 molecule, complement regulatory protein 2 2
MIRT002625 CDK4 cyclin-dependent kinase 4 4 3
MIRT002630 HTATIP2 HIV-1 Tat interactive protein 2, 30kDa 2 2
MIRT002631 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 2 2
MIRT002633 SSFA2 sperm specific antigen 2 2 2
MIRT002635 NEK9 NIMA (never in mitosis gene a)- related kinase 9 2 2
MIRT002636 PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 2 2
MIRT002637 ANKRD27 ankyrin repeat domain 27 (VPS9 domain) 2 2
MIRT002638 APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 2 2
MIRT002639 GSN gelsolin 2 2
MIRT002641 SLC30A7 solute carrier family 30 (zinc transporter), member 7 2 1
MIRT002642 CDK6 cyclin-dependent kinase 6 6 9
MIRT002643 HEBP2 heme binding protein 2 2 1
MIRT002644 AHRR aryl-hydrocarbon receptor repressor 2 2
MIRT002645 GINM1 chromosome 6 open reading frame 72 2 2
MIRT002646 SERPINB6 serpin peptidase inhibitor, clade B (ovalbumin), member 6 2 2
MIRT002647 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT002649 IFRD2 interferon-related developmental regulator 2 2 2
MIRT002652 DVL2 dishevelled, dsh homolog 2 (Drosophila) 2 2
MIRT002653 AHR aryl hydrocarbon receptor 4 3
MIRT002655 PLP2 proteolipid protein 2 (colonic epithelium-enriched) 2 2
MIRT002657 PODXL podocalyxin-like 2 2
MIRT002658 CTNND1 catenin (cadherin-associated protein), delta 1 2 2
MIRT002659 RHOV ras homolog gene family, member V 1 2
MIRT002660 SP1 Sp1 transcription factor 2 2
MIRT002662 ACAA2 acetyl-CoA acyltransferase 2 3 3
MIRT002663 NME4 non-metastatic cells 4, protein expressed in 2 1
MIRT002665 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 5 4
MIRT002667 MDFIC MyoD family inhibitor domain containing 2 1
MIRT002668 ARFIP1 ADP-ribosylation factor interacting protein 1 2 2
MIRT002670 DNM2 dynamin 2 2 2
MIRT002672 PGRMC2 progesterone receptor membrane component 2 2 2
MIRT002673 FAM35A family with sequence similarity 35, member A 2 1
MIRT002674 ZBED3 zinc finger, BED-type containing 3 2 2
MIRT002675 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 2 2
MIRT002676 MPHOSPH9 M-phase phosphoprotein 9 2 1
MIRT002677 GTPBP8 GTP-binding protein 8 (putative) 2 1
MIRT002678 F11R F11 receptor 2 2
MIRT002679 GNAI3 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 2 1
MIRT002682 SLC25A30 solute carrier family 25, member 30 2 2
MIRT002684 SERP1 stress-associated endoplasmic reticulum protein 1 3 3
MIRT002687 PHF19 PHD finger protein 19 2 2
MIRT002689 INO80C INO80 complex subunit C 2 2
MIRT002690 STX2 syntaxin 2 2 1
MIRT002692 TRIP11 thyroid hormone receptor interactor 11 2 1
MIRT002693 TLN1 talin 1 2 2
MIRT002694 SWAP70 SWAP switching B-cell complex 70kDa subunit 2 1
MIRT002695 ARHGEF1 Rho guanine nucleotide exchange factor (GEF) 1 2 2
MIRT002696 ELOVL1 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 2 2
MIRT002697 IQGAP1 IQ motif containing GTPase activating protein 1 5 4
MIRT002698 ABHD5 abhydrolase domain containing 5 2 2
MIRT002699 RNPEPL1 arginyl aminopeptidase (aminopeptidase B)-like 1 2 2
MIRT002700 STX10 syntaxin 10 2 3
MIRT002701 TEAD1 TEA domain family member 1 (SV40 transcriptional enhancer factor) 2 2
MIRT002702 FAM177A1 family with sequence similarity 177, member A1 2 2
MIRT002703 FCHO2 FCH domain only 2 2 2
MIRT002706 CREB3L2 cAMP responsive element binding protein 3-like 2 2 1
MIRT002707 AK2 adenylate kinase 2 2 1
MIRT002709 TTC7A tetratricopeptide repeat domain 7A 2 2
MIRT002711 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT002712 LRRC1 leucine rich repeat containing 1 2 2
MIRT002714 TWIST2 twist homolog 2 (Drosophila) 2 1
MIRT002715 AP1M2 adaptor-related protein complex 1, mu 2 subunit 2 2
MIRT002716 SNAI2 snail homolog 2 (Drosophila) 4 5
MIRT002717 SYNGR2 synaptogyrin 2 2 2
MIRT002718 TJP2 tight junction protein 2 (zona occludens 2) 2 2
MIRT002719 CAV1 caveolin 1, caveolae protein, 22kDa 2 2
MIRT002720 LAMC1 laminin, gamma 1 (formerly LAMB2) 4 4
MIRT002721 DNAJC1 DnaJ (Hsp40) homolog, subfamily C, member 1 2 2
MIRT002722 CDCA7L cell division cycle associated 7-like 2 2
MIRT002723 PLOD3 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 2 2
MIRT002724 SHC3 SHC (Src homology 2 domain containing) transforming protein 3 1 1
MIRT002726 CERS2 LAG1 homolog, ceramide synthase 2 2 2
MIRT002728 LITAF lipopolysaccharide-induced TNF factor 2 2
MIRT002729 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 3 4
MIRT002730 CD164 CD164 molecule, sialomucin 3 3
MIRT002731 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 5 5
MIRT002901 JAKMIP1 janus kinase and microtubule interacting protein 1 1 1
MIRT002902 CHODL chondrolectin 1 1
MIRT002903 GAS2L1 growth arrest-specific 2 like 1 3 2
MIRT002904 TSPAN15 tetraspanin 15 1 1
MIRT002905 RFFL ring finger and FYVE-like domain containing 1 2 2
MIRT002906 ERH enhancer of rudimentary homolog (Drosophila) 1 1
MIRT002907 ZFP36L2 zinc finger protein 36, C3H type-like 2 2 2
MIRT002908 FAM104A family with sequence similarity 104, member A 1 1
MIRT002909 PLSCR3 phospholipid scramblase 3 2 2
MIRT002910 CAPRIN2 caprin family member 2 2 2
MIRT002911 FA2H fatty acid 2-hydroxylase 1 1
MIRT002912 SENP8 SUMO/sentrin specific peptidase family member 8 2 2
MIRT002913 PGF placental growth factor 1 1
MIRT002914 PDLIM7 PDZ and LIM domain 7 (enigma) 2 2
MIRT002915 MYO10 myosin X 1 1
MIRT002917 E2F5 E2F transcription factor 5, p130-binding 2 2
MIRT002918 NFATC1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 2 2
MIRT002919 ARRDC1 arrestin domain containing 1 1 1
MIRT002920 MMADHC methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria 1 1
MIRT002921 NID1 nidogen 1 2 2
MIRT002922 RHOG ras homolog gene family, member G (rho G) 3 3
MIRT002923 PRKD1 protein kinase D1 1 1
MIRT003051 RDH10 retinol dehydrogenase 10 (all-trans) 3 2
MIRT003523 ELK3 ELK3, ETS-domain protein (SRF accessory protein 2) 3 2
MIRT003839 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 3 2
MIRT004039 TMBIM1 transmembrane BAX inhibitor motif containing 1 2 2
MIRT004042 PPP1R13L protein phosphatase 1, regulatory (inhibitor) subunit 13 like 2 2
MIRT004075 ARHGAP29 Rho GTPase activating protein 29 2 1
MIRT004100 TSC22D4 TSC22 domain family, member 4 2 2
MIRT004101 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 2 2
MIRT004119 SYPL1 synaptophysin-like 1 2 2
MIRT004120 SEC11A SEC11 homolog A (S. cerevisiae) 2 2
MIRT004283 CDK2 cyclin-dependent kinase 2 4 2
MIRT004284 CCL2 chemokine (C-C motif) ligand 2 2 1
MIRT004503 PEA15 phosphoprotein enriched in astrocytes 15 2 1
MIRT004546 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 4 2
MIRT004548 TSC22D3 TSC22 domain family, member 3 2 1
MIRT004724 VIM vimentin 5 2
MIRT004725 SMYD3 SET and MYND domain containing 3 4 2
MIRT004726 E2F6 E2F transcription factor 6 4 1
MIRT004880 OAF OAF homolog (Drosophila) 2 2
MIRT004883 TMEM109 transmembrane protein 109 2 2
MIRT004884 TUBB6 tubulin, beta 6 2 1
MIRT004885 C12orf23 chromosome 12 open reading frame 23 2 2
MIRT004886 SLC50A1 recombination activating gene 1 activating protein 1 2 2
MIRT004890 UHMK1 U2AF homology motif (UHM) kinase 1 2 2
MIRT004891 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT004892 ENDOD1 endonuclease domain containing 1 2 2
MIRT004893 HADH hydroxyacyl-CoA dehydrogenase 2 2
MIRT004894 GCA grancalcin, EF-hand calcium binding protein 2 1
MIRT004895 C11orf75 chromosome 11 open reading frame 75 2 2
MIRT004896 FAM83H family with sequence similarity 83, member H 2 2
MIRT004897 ASPRV1 aspartic peptidase, retroviral-like 1 2 1
MIRT004898 VPS37C vacuolar protein sorting 37 homolog C (S. cerevisiae) 2 2
MIRT004899 SPDL1 coiled-coil domain containing 99 2 2
MIRT004903 RBM47 RNA binding motif protein 47 2 2
MIRT004906 DRAM1 DNA-damage regulated autophagy modulator 1 2 1
MIRT004907 NECAP2 NECAP endocytosis associated 2 2 2
MIRT004908 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 2 2
MIRT004912 CHST14 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 2 1
MIRT004913 FAM57A family with sequence similarity 57, member A 2 2
MIRT004925 FAM129B family with sequence similarity 129, member B 2 1
MIRT004926 CLDND1 claudin domain containing 1 2 2
MIRT004927 ZCCHC24 zinc finger, CCHC domain containing 24 2 2
MIRT004928 LDLRAP1 low density lipoprotein receptor adaptor protein 1 2 2
MIRT004929 ARAF v-raf murine sarcoma 3611 viral oncogene homolog 2 2
MIRT004930 KANK1 KN motif and ankyrin repeat domains 1 2 2
MIRT005083 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 4 1
MIRT005655 ECI2 peroxisomal D3,D2-enoyl-CoA isomerase 2 2
MIRT006451 AR androgen receptor 3 2
MIRT006478 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 3 1
MIRT006479 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 2
MIRT006541 IL6R interleukin 6 receptor 4 1
MIRT006562 HMGA1 high mobility group AT-hook 1 4 1
MIRT006776 ROCK1 Rho-associated, coiled-coil containing protein kinase 1 1 1
MIRT006837 PIK3CA phosphoinositide-3-kinase, catalytic, alpha polypeptide 3 1
MIRT007235 FXN frataxin 1 1
MIRT007282 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT022113 SPTA1 spectrin, alpha, erythrocytic 1 (elliptocytosis 2) 1 1
MIRT022115 FOXF2 forkhead box F2 1 1
MIRT022116 LRRC4 leucine rich repeat containing 4 1 1
MIRT022117 SGK1 serum/glucocorticoid regulated kinase 1 1 1
MIRT022118 DEFB118 defensin, beta 118 1 1
MIRT022119 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT022120 USH2A Usher syndrome 2A (autosomal recessive, mild) 1 1
MIRT022121 ARMCX2 armadillo repeat containing, X-linked 2 1 1
MIRT022122 BAG5 BCL2-associated athanogene 5 1 1
MIRT022123 ARHGAP22 Rho GTPase activating protein 22 1 1
MIRT022124 VNN2 vanin 2 1 1
MIRT022125 YBX3 cold shock domain protein A 1 1
MIRT022126 TRIM38 tripartite motif-containing 38 1 1
MIRT022127 C9orf85 chromosome 9 open reading frame 85 1 1
MIRT022128 PLA2G4C phospholipase A2, group IVC (cytosolic, calcium-independent) 1 1
MIRT022129 MVP major vault protein 1 1
MIRT022130 SEC24D SEC24 family, member D (S. cerevisiae) 1 1
MIRT022131 XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 1
MIRT022132 HLA-A major histocompatibility complex, class I, A 1 1
MIRT022133 GMPR2 guanosine monophosphate reductase 2 1 1
MIRT022134 SNX18 sorting nexin 18 1 1
MIRT022135 TBXA2R thromboxane A2 receptor 1 1
MIRT022136 SH2D3A SH2 domain containing 3A 1 1
MIRT022137 MFAP4 microfibrillar-associated protein 4 1 1
MIRT022138 MICAL2 microtubule associated monoxygenase, calponin and LIM domain containing 2 1 1
MIRT022139 EREG epiregulin 1 1
MIRT022140 LRRC2 leucine rich repeat containing 2 1 1
MIRT022141 BIRC2 baculoviral IAP repeat-containing 2 1 1
MIRT022142 ADPRH ADP-ribosylarginine hydrolase 1 1
MIRT022143 XKRX XK, Kell blood group complex subunit-related, X-linked 1 1
MIRT022144 LAMA4 laminin, alpha 4 1 1
MIRT022145 EFNA1 ephrin-A1 1 1
MIRT022146 LSM10 LSM10, U7 small nuclear RNA associated 1 1
MIRT022147 ADCY6 adenylate cyclase 6 1 1
MIRT022148 WISP2 WNT1 inducible signaling pathway protein 2 1 1
MIRT022149 ADAM15 ADAM metallopeptidase domain 15 1 1
MIRT022150 DSEL dermatan sulfate epimerase-like 1 1
MIRT022151 EPB41L5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT022152 ZHX3 zinc fingers and homeoboxes 3 1 1
MIRT022153 SMPD4 sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) 1 1
MIRT022154 MAML1 mastermind-like 1 (Drosophila) 1 1
MIRT022155 SLC46A3 solute carrier family 46, member 3 1 1
MIRT022156 RRAS related RAS viral (r-ras) oncogene homolog 1 1
MIRT022157 NUDT19 nudix (nucleoside diphosphate linked moiety X)-type motif 19 1 1
MIRT022158 FAM134B family with sequence similarity 134, member B 1 1
MIRT022159 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT022160 MTHFSD methenyltetrahydrofolate synthetase domain containing 1 1
MIRT022161 JAG2 jagged 2 1 1
MIRT022162 STK36 serine/threonine kinase 36, fused homolog (Drosophila) 1 1
MIRT022163 METAP2 methionyl aminopeptidase 2 1 1
MIRT022164 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT022165 ECE1 endothelin converting enzyme 1 1 1
MIRT022166 SBNO2 strawberry notch homolog 2 (Drosophila) 1 1
MIRT022167 PRRX1 paired related homeobox 1 1 1
MIRT022168 TOR3A torsin family 3, member A 1 1
MIRT022169 LHX2 LIM homeobox 2 1 1
MIRT022170 RAB34 RAB34, member RAS oncogene family 1 1
MIRT022171 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT022172 COL4A1 collagen, type IV, alpha 1 1 1
MIRT022173 USP10 ubiquitin specific peptidase 10 2 1
MIRT022174 GPATCH4 G patch domain containing 4 2 1
MIRT022175 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 2 1
MIRT022176 LIN7C lin-7 homolog C (C. elegans) 2 1
MIRT022177 DDX51 DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 2 1
MIRT022178 ZNF740 zinc finger protein 740 2 1
MIRT022179 GRSF1 G-rich RNA sequence binding factor 1 2 1
MIRT022180 COLGALT1 glycosyltransferase 25 domain containing 1 2 1
MIRT022181 FAM35BP family with sequence similarity 35, member B 2 2
MIRT022182 FAM171B family with sequence similarity 171, member B 1 1
MIRT022183 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT022184 CAPN11 calpain 11 1 1
MIRT022185 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 1 1
MIRT022186 CABP1 calcium binding protein 1 1 1
MIRT022187 METTL7A methyltransferase like 7A 1 1
MIRT022188 FGF1 fibroblast growth factor 1 (acidic) 1 1
MIRT022189 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT022190 RBMS1 RNA binding motif, single stranded interacting protein 1 2 1
MIRT022191 SLC43A3 solute carrier family 43, member 3 1 1
MIRT022192 PUS1 pseudouridylate synthase 1 1 1
MIRT022193 CALCRL calcitonin receptor-like 1 1
MIRT022194 SAMD11 sterile alpha motif domain containing 11 1 1
MIRT022195 SOGA2 KIAA0802 1 1
MIRT022196 AVEN apoptosis, caspase activation inhibitor 1 1
MIRT022197 ZNHIT6 zinc finger, HIT type 6 1 1
MIRT022198 CDRT4 CMT1A duplicated region transcript 4 1 1
MIRT022199 GPR161 G protein-coupled receptor 161 1 1
MIRT022200 EPGN epithelial mitogen homolog (mouse) 1 1
MIRT022201 FAM65B family with sequence similarity 65, member B 1 1
MIRT022202 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT022203 ERCC5 excision repair cross-complementing rodent repair deficiency, complementation group 5 1 1
MIRT022204 TAX1BP3 Tax1 (human T-cell leukemia virus type I) binding protein 3 1 1
MIRT022205 CHRDL1 chordin-like 1 1 1
MIRT022206 CCDC3 coiled-coil domain containing 3 1 1
MIRT022207 MVK mevalonate kinase 1 1
MIRT022208 INF2 inverted formin, FH2 and WH2 domain containing 1 1
MIRT022209 ZNF410 zinc finger protein 410 1 1
MIRT022210 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT022211 CYBRD1 cytochrome b reductase 1 1 1
MIRT022212 LNX2 ligand of numb-protein X 2 1 1
MIRT022213 TMEM79 transmembrane protein 79 1 1
MIRT022214 MRPL49 mitochondrial ribosomal protein L49 1 1
MIRT022215 DNMBP dynamin binding protein 1 1
MIRT022216 OGFOD2 2-oxoglutarate and iron-dependent oxygenase domain containing 2 1 1
MIRT022217 CPNE8 copine VIII 1 1
MIRT022218 TRAIP TRAF interacting protein 1 1
MIRT022219 RAD51AP1 RAD51 associated protein 1 1 1
MIRT022220 CTSH cathepsin H 1 1
MIRT022221 GRB2 growth factor receptor-bound protein 2 1 1
MIRT022222 ADCY9 adenylate cyclase 9 1 1
MIRT022223 SNX17 sorting nexin 17 1 1
MIRT022224 MSRB3 methionine sulfoxide reductase B3 1 1
MIRT022225 FAM129A family with sequence similarity 129, member A 1 1
MIRT022226 RNF141 ring finger protein 141 1 1
MIRT022227 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT022228 UNC5D unc-5 homolog D (C. elegans) 1 1
MIRT022229 KLF6 Kruppel-like factor 6 1 1
MIRT022230 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT022231 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT022232 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 1
MIRT022233 GATA6 GATA binding protein 6 1 1
MIRT022234 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT022235 SERTAD2 SERTA domain containing 2 1 1
MIRT022236 RAB27A RAB27A, member RAS oncogene family 1 1
MIRT022237 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 2 1
MIRT022238 ATAD3A ATPase family, AAA domain containing 3A 2 1
MIRT022239 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 2 1
MIRT022240 RFC3 replication factor C (activator 1) 3, 38kDa 2 1
MIRT022241 PPAN peter pan homolog (Drosophila) 2 1
MIRT022242 KRT17P2 keratin 17 pseudogene 2 2 1
MIRT022243 HELLS helicase, lymphoid-specific 2 1
MIRT022244 LAS1L LAS1-like (S. cerevisiae) 2 1
MIRT022245 NGDN neuroguidin, EIF4E binding protein 2 1
MIRT022246 PIAS1 protein inhibitor of activated STAT, 1 2 1
MIRT022247 JUP junction plakoglobin 2 1
MIRT022248 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 2 1
MIRT022249 TRIM25 tripartite motif-containing 25 2 1
MIRT022250 RCC2 regulator of chromosome condensation 2 2 1
MIRT022251 SEPT9 septin 9 2 1
MIRT022252 ENAH enabled homolog (Drosophila) 2 1
MIRT022253 DIS3 DIS3 mitotic control homolog (S. cerevisiae) 2 1
MIRT022254 LDLR low density lipoprotein receptor 2 2
MIRT022255 PDAP1 PDGFA associated protein 1 1 1
MIRT022256 CCDC102B coiled-coil domain containing 102B 1 1
MIRT022257 TSEN54 tRNA splicing endonuclease 54 homolog (S. cerevisiae) 1 1
MIRT022258 ZNF483 zinc finger protein 483 1 1
MIRT022259 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 1 1
MIRT022260 DHRS3 dehydrogenase/reductase (SDR family) member 3 1 1
MIRT022261 SLC1A3 solute carrier family 1 (glial high affinity glutamate transporter), member 3 1 1
MIRT022262 TMEM156 transmembrane protein 156 1 1
MIRT022263 GTF3C6 general transcription factor IIIC, polypeptide 6, alpha 35kDa 1 1
MIRT022264 CKS2 CDC28 protein kinase regulatory subunit 2 1 1
MIRT022265 AFAP1L1 actin filament associated protein 1-like 1 1 1
MIRT022266 ID3 inhibitor of DNA binding 3, dominant negative helix-loop-helix protein 1 1
MIRT022267 EDN1 endothelin 1 1 1
MIRT022268 IGFBP1 insulin-like growth factor binding protein 1 1 1
MIRT022269 CLIC3 chloride intracellular channel 3 1 1
MIRT022270 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT022271 SPHK1 sphingosine kinase 1 1 1
MIRT022272 OCA2 oculocutaneous albinism II 1 1
MIRT022273 SDCCAG8 serologically defined colon cancer antigen 8 1 1
MIRT022274 TMEM5 transmembrane protein 5 1 1
MIRT022275 PRKCB protein kinase C, beta 1 1
MIRT022276 COL17A1 collagen, type XVII, alpha 1 1 1
MIRT022277 HOXC4 homeobox C4 1 1
MIRT022278 ATOH8 atonal homolog 8 (Drosophila) 1 1
MIRT022279 SULT1E1 sulfotransferase family 1E, estrogen-preferring, member 1 1 1
MIRT022280 RILPL2 Rab interacting lysosomal protein-like 2 1 1
MIRT022281 TMEM44 transmembrane protein 44 1 1
MIRT022282 RPS15 ribosomal protein S15 1 1
MIRT022283 RPS6KA4 ribosomal protein S6 kinase, 90kDa, polypeptide 4 1 1
MIRT022284 NSMAF neutral sphingomyelinase (N-SMase) activation associated factor 1 1
MIRT022285 PTH2R parathyroid hormone 2 receptor 1 1
MIRT022286 NUB1 negative regulator of ubiquitin-like proteins 1 1 1
MIRT022287 ROM1 retinal outer segment membrane protein 1 1 1
MIRT022288 ACADL acyl-CoA dehydrogenase, long chain 1 1
MIRT022289 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT022290 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT022291 FAM63B family with sequence similarity 63, member B 1 1
MIRT022292 HMGN4 high mobility group nucleosomal binding domain 4 1 1
MIRT022293 TSN translin 1 1
MIRT022294 SNX12 sorting nexin 12 1 1
MIRT022295 POLA1 polymerase (DNA directed), alpha 1, catalytic subunit 1 1
MIRT022296 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT022297 MALL mal, T-cell differentiation protein-like 1 1
MIRT022298 MOBP myelin-associated oligodendrocyte basic protein 1 1
MIRT022299 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT022300 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT022301 TMEM128 transmembrane protein 128 1 1
MIRT022302 RIPK4 receptor-interacting serine-threonine kinase 4 1 1
MIRT022303 BVES blood vessel epicardial substance 1 1
MIRT022304 HEATR5A HEAT repeat containing 5A 1 1
MIRT022305 C11orf82 chromosome 11 open reading frame 82 1 1
MIRT022306 CMTM7 CKLF-like MARVEL transmembrane domain containing 7 1 1
MIRT022307 EMD emerin 1 1
MIRT022308 PTPRB protein tyrosine phosphatase, receptor type, B 1 1
MIRT022309 GPM6B glycoprotein M6B 1 1
MIRT022310 RASSF1 Ras association (RalGDS/AF-6) domain family member 1 1 1
MIRT022311 TUB tubby homolog (mouse) 1 1
MIRT022312 PALLD palladin, cytoskeletal associated protein 1 1
MIRT022313 PHF17 PHD finger protein 17 1 1
MIRT022314 SIX4 SIX homeobox 4 1 1
MIRT022315 INA internexin neuronal intermediate filament protein, alpha 2 1
MIRT022316 DNM3 dynamin 3 2 1
MIRT022317 NOL8 nucleolar protein 8 2 1
MIRT022318 EHD2 EH-domain containing 2 2 1
MIRT022319 AURKB aurora kinase B 2 1
MIRT022320 SRSF3 splicing factor, arginine/serine-rich 3 2 1
MIRT022321 NOSIP nitric oxide synthase interacting protein 2 1
MIRT022322 SPIN1 spindlin 1 2 1
MIRT022323 PPIF peptidylprolyl isomerase F 2 1
MIRT022324 FRAS1 Fraser syndrome 1 2 1
MIRT022325 FLOT2 flotillin 2 2 1
MIRT022326 MVD mevalonate (diphospho) decarboxylase 1 1
MIRT022327 LIN28A lin-28 homolog A (C. elegans) 1 1
MIRT022328 TUBA3D tubulin, alpha 3d 1 1
MIRT022329 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT022330 LIN7A lin-7 homolog A (C. elegans) 1 1
MIRT022331 AKAP4 A kinase (PRKA) anchor protein 4 1 1
MIRT022332 AGTR2 angiotensin II receptor, type 2 1 1
MIRT022333 NCAPH2 non-SMC condensin II complex, subunit H2 1 1
MIRT022334 DRG2 developmentally regulated GTP binding protein 2 1 1
MIRT022335 SLC13A2 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 1 1
MIRT022336 MFAP5 microfibrillar associated protein 5 1 1
MIRT022337 CALR calreticulin 1 1
MIRT022338 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT022339 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT022340 GPR123 G protein-coupled receptor 123 1 1
MIRT022341 FAM109B family with sequence similarity 109, member B 1 1
MIRT022342 TNFRSF12A tumor necrosis factor receptor superfamily, member 12A 1 1
MIRT022343 FBXO18 F-box protein, helicase, 18 1 1
MIRT022344 IKBKE inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon 1 1
MIRT022345 CSPG4 chondroitin sulfate proteoglycan 4 1 1
MIRT022346 KIAA0930 chromosome 22 open reading frame 9 1 1
MIRT022347 ANXA6 annexin A6 1 1
MIRT022348 VKORC1 vitamin K epoxide reductase complex, subunit 1 1 1
MIRT022349 DISP1 dispatched homolog 1 (Drosophila) 1 1
MIRT022350 SYNC syncoilin, intermediate filament protein 1 1
MIRT022351 KIAA1804 mixed lineage kinase 4 1 1
MIRT022352 CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 1 1
MIRT022353 SEC22C SEC22 vesicle trafficking protein homolog C (S. cerevisiae) 1 1
MIRT022354 ANXA8L2 annexin A8-like 2 2 1
MIRT022355 C14orf178 chromosome 14 open reading frame 178 1 1
MIRT022356 SDC4 syndecan 4 1 1
MIRT022357 ZNF440 zinc finger protein 440 1 1
MIRT022358 MYPN myopalladin 1 1
MIRT022359 TPP1 tripeptidyl peptidase I 1 1
MIRT022360 ATP8B2 ATPase, class I, type 8B, member 2 1 1
MIRT022361 SLC31A2 solute carrier family 31 (copper transporters), member 2 1 1
MIRT022362 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT022363 IGFBP3 insulin-like growth factor binding protein 3 1 1
MIRT022364 TMEM45A transmembrane protein 45A 1 1
MIRT022365 CDCP1 CUB domain containing protein 1 1 1
MIRT022366 PUS3 pseudouridylate synthase 3 1 1
MIRT022367 MAP3K8 mitogen-activated protein kinase kinase kinase 8 1 1
MIRT022368 TPST2 tyrosylprotein sulfotransferase 2 1 1
MIRT022369 C8orf22 chromosome 8 open reading frame 22 1 1
MIRT022370 NFIA nuclear factor I/A 1 1
MIRT022371 GMCL1 germ cell-less homolog 1 (Drosophila) 2 2
MIRT022372 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT022373 PPP1R3B protein phosphatase 1, regulatory (inhibitor) subunit 3B 1 1
MIRT022374 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT022375 ANXA11 annexin A11 1 1
MIRT022376 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 2 1
MIRT022377 SEPT2 septin 2 2 1
MIRT022378 BEND3 BEN domain containing 3 2 1
MIRT022379 MBNL1 muscleblind-like (Drosophila) 2 1
MIRT022380 CUX2 cut-like homeobox 2 2 1
MIRT022381 MCAM melanoma cell adhesion molecule 2 1
MIRT022382 EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa 2 1
MIRT022383 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 2 1
MIRT022384 CDC27 cell division cycle 27 homolog (S. cerevisiae) 2 1
MIRT022385 PGM5 phosphoglucomutase 5 2 1
MIRT022386 NOL10 nucleolar protein 10 2 1
MIRT022387 NOC3L nucleolar complex associated 3 homolog (S. cerevisiae) 2 1
MIRT022388 WTAP Wilms tumor 1 associated protein 2 1
MIRT022389 EIF3M eukaryotic translation initiation factor 3, subunit M 2 1
MIRT022390 MED20 mediator complex subunit 20 2 1
MIRT022391 AURKA aurora kinase A 2 1
MIRT022392 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 2 1
MIRT022393 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 1
MIRT022394 LMNA lamin A/C 2 1
MIRT022395 ACAT2 acetyl-CoA acetyltransferase 2 1 1
MIRT022396 RBPMS RNA binding protein with multiple splicing 1 1
MIRT022397 GBP1 guanylate binding protein 1, interferon-inducible, 67kDa 1 1
MIRT022398 TAF1A TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa 1 1
MIRT022399 PYCARD PYD and CARD domain containing 1 1
MIRT022400 SQRDL sulfide quinone reductase-like (yeast) 1 1
MIRT022401 PSG3 pregnancy specific beta-1-glycoprotein 3 1 1
MIRT022402 TMEFF2 transmembrane protein with EGF-like and two follistatin-like domains 2 1 1
MIRT022403 DENND2D DENN/MADD domain containing 2D 1 1
MIRT022404 PTGES prostaglandin E synthase 1 1
MIRT022405 SAMD10 sterile alpha motif domain containing 10 1 1
MIRT022406 ANO1 anoctamin 1, calcium activated chloride channel 1 1
MIRT022407 PDGFC platelet derived growth factor C 1 1
MIRT022408 TMEM121 transmembrane protein 121 1 1
MIRT022409 FNDC4 fibronectin type III domain containing 4 1 1
MIRT022410 ANKRD36B ankyrin repeat domain 36B 1 1
MIRT022411 PLEKHB1 pleckstrin homology domain containing, family B (evectins) member 1 1 1
MIRT022412 Hes1 hairy and enhancer of split 1 (Drosophila) 1 1
MIRT022413 LOXL1 lysyl oxidase-like 1 1 1
MIRT022414 TPRA1 transmembrane protein, adipocyte asscociated 1 1 1
MIRT022415 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT022416 CLN5 ceroid-lipofuscinosis, neuronal 5 1 1
MIRT022417 AMIGO2 adhesion molecule with Ig-like domain 2 1 1
MIRT022418 CTAGE5 CTAGE family, member 5 1 1
MIRT022419 ICAM5 intercellular adhesion molecule 5, telencephalin 1 1
MIRT022420 ATP8B3 ATPase, aminophospholipid transporter, class I, type 8B, member 3 1 1
MIRT022421 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT022422 PLA2G7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) 1 1
MIRT022423 DDX19A DEAD (Asp-Glu-Ala-As) box polypeptide 19A 1 1
MIRT022424 CPOX coproporphyrinogen oxidase 1 1
MIRT022425 DPH5 DPH5 homolog (S. cerevisiae) 1 1
MIRT022426 NEDD4 neural precursor cell expressed, developmentally down-regulated 4 1 1
MIRT022427 LAMP2 lysosomal-associated membrane protein 2 1 1
MIRT022428 MEPE matrix extracellular phosphoglycoprotein 1 1
MIRT022429 RAB3IL1 RAB3A interacting protein (rabin3)-like 1 1 1
MIRT022430 CAST calpastatin 1 1
MIRT022431 ZNF451 zinc finger protein 451 1 1
MIRT022432 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 1
MIRT022433 ANGPTL7 angiopoietin-like 7 1 1
MIRT022434 UNC5B unc-5 homolog B (C. elegans) 1 1
MIRT022435 FAXDC2 chromosome 5 open reading frame 4 1 1
MIRT022436 KIF26A kinesin family member 26A 1 1
MIRT022437 GK5 glycerol kinase 5 (putative) 1 1
MIRT022438 BMPR1A bone morphogenetic protein receptor, type IA 1 1
MIRT022439 ARMC1 armadillo repeat containing 1 1 1
MIRT022440 MDK midkine (neurite growth-promoting factor 2) 1 1
MIRT022441 PLSCR4 phospholipid scramblase 4 1 1
MIRT022442 SLC44A1 solute carrier family 44, member 1 1 1
MIRT022443 CNN3 calponin 3, acidic 1 1
MIRT022444 PTPRZ1 protein tyrosine phosphatase, receptor-type, Z polypeptide 1 1 1
MIRT022445 TWSG1 twisted gastrulation homolog 1 (Drosophila) 1 1
MIRT022446 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT022447 SHE Src homology 2 domain containing E 1 1
MIRT022448 IL11 interleukin 11 1 1
MIRT022449 TCTA T-cell leukemia translocation altered gene 1 1
MIRT022450 YBX1 Y box binding protein 1 2 1
MIRT022451 ANAPC5 anaphase promoting complex subunit 5 2 1
MIRT022452 ILF2 interleukin enhancer binding factor 2, 45kDa 2 1
MIRT022453 BRE brain and reproductive organ-expressed (TNFRSF1A modulator) 2 1
MIRT022454 TFB2M transcription factor B2, mitochondrial 2 1
MIRT022455 BCCIP BRCA2 and CDKN1A interacting protein 2 1
MIRT022456 SCAF11 splicing factor, arginine/serine-rich 2, interacting protein 2 1
MIRT022457 CKAP4 cytoskeleton-associated protein 4 2 1
MIRT022458 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 2 1
MIRT022459 NFIB nuclear factor I/B 2 1
MIRT022460 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT022461 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT022462 DNAJC25 DnaJ (Hsp40) homolog, subfamily C , member 25 1 1
MIRT022463 TNFRSF25 tumor necrosis factor receptor superfamily, member 25 1 1
MIRT022464 FLG filaggrin 1 1
MIRT022465 STC2 stanniocalcin 2 1 1
MIRT022466 PSG9 pregnancy specific beta-1-glycoprotein 9 1 1
MIRT022467 MESDC2 mesoderm development candidate 2 1 1
MIRT022468 KRT33A keratin 33A 1 1
MIRT022469 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1 1
MIRT022470 FHDC1 FH2 domain containing 1 1 1
MIRT022471 SS18L2 synovial sarcoma translocation gene on chromosome 18-like 2 1 1
MIRT022472 GAS6 growth arrest-specific 6 1 1
MIRT022473 NUP50 nucleoporin 50kDa 1 1
MIRT022474 DRD4 dopamine receptor D4 1 1
MIRT022475 AIF1L allograft inflammatory factor 1-like 1 1
MIRT022476 USP49 ubiquitin specific peptidase 49 1 1
MIRT022477 TMEM54 transmembrane protein 54 1 1
MIRT022478 KCNC4 potassium voltage-gated channel, Shaw-related subfamily, member 4 1 1
MIRT022479 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT022480 KCNK1 potassium channel, subfamily K, member 1 1 1
MIRT022481 TRIM4 tripartite motif-containing 4 1 1
MIRT022482 MALSU1 chromosome 7 open reading frame 30 1 1
MIRT022483 FAM171A1 family with sequence similarity 171, member A1 1 1
MIRT022484 NEU4 sialidase 4 1 1
MIRT022485 FGF5 fibroblast growth factor 5 1 1
MIRT022486 SLC16A6 solute carrier family 16, member 6 (monocarboxylic acid transporter 7) 1 1
MIRT022487 HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1 1
MIRT022488 HKDC1 hexokinase domain containing 1 1 1
MIRT022489 CCDC71 coiled-coil domain containing 71 1 1
MIRT022490 C6orf89 chromosome 6 open reading frame 89 1 1
MIRT022491 SLC2A4RG SLC2A4 regulator 1 1
MIRT022492 PHF21B PHD finger protein 21B 1 1
MIRT022493 EOGT chromosome 3 open reading frame 64 1 1
MIRT022494 FRMD3 FERM domain containing 3 1 1
MIRT022495 ROR1 receptor tyrosine kinase-like orphan receptor 1 1 1
MIRT022496 STX18 syntaxin 18 1 1
MIRT022497 FAM76A family with sequence similarity 76, member A 1 1
MIRT022498 DZIP1 DAZ interacting protein 1 1 1
MIRT022499 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT022500 ABCC3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 1 1
MIRT022501 KIAA1704 KIAA1704 1 1
MIRT022502 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT022503 NKAP NFKB activating protein 1 1
MIRT022504 BTC betacellulin 1 1
MIRT022505 FMOD fibromodulin 1 1
MIRT022506 NRG1 neuregulin 1 1 1
MIRT022507 BCL6 B-cell CLL/lymphoma 6 1 1
MIRT022508 PQLC3 PQ loop repeat containing 3 1 1
MIRT022509 SHPK sedoheptulokinase 1 1
MIRT022510 C3orf58 chromosome 3 open reading frame 58 1 1
MIRT022511 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT022512 IQCE IQ motif containing E 1 1
MIRT022513 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT022514 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT022515 THAP2 THAP domain containing, apoptosis associated protein 2 1 1
MIRT022516 SERTAD4 SERTA domain containing 4 1 1
MIRT022517 RYR3 ryanodine receptor 3 1 1
MIRT022518 PIK3C2A phosphoinositide-3-kinase, class 2, alpha polypeptide 1 1
MIRT022519 TCOF1 Treacher Collins-Franceschetti syndrome 1 2 1
MIRT022520 CHRAC1 chromatin accessibility complex 1 2 1
MIRT022521 NPM3 nucleophosmin/nucleoplasmin 3 2 1
MIRT022522 CD2BP2 CD2 (cytoplasmic tail) binding protein 2 2 1
MIRT022523 TOPBP1 topoisomerase (DNA) II binding protein 1 2 1
MIRT022524 TTLL3 tubulin tyrosine ligase-like family, member 3 2 1
MIRT022525 SYNE1 spectrin repeat containing, nuclear envelope 1 2 1
MIRT022526 DSG2 desmoglein 2 2 1
MIRT022527 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 1
MIRT022528 TLR3 toll-like receptor 3 1 1
MIRT022529 AARS alanyl-tRNA synthetase 1 1
MIRT022530 RAET1E retinoic acid early transcript 1E 1 1
MIRT022531 HMOX1 heme oxygenase (decycling) 1 1 1
MIRT022532 KAT2A K(lysine) acetyltransferase 2A 1 1
MIRT022533 SECTM1 secreted and transmembrane 1 1 1
MIRT022534 KIAA1199 KIAA1199 1 1
MIRT022535 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT022536 MAPK11 mitogen-activated protein kinase 11 1 1
MIRT022537 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT022538 RIBC2 RIB43A domain with coiled-coils 2 1 1
MIRT022539 PRB2 proline-rich protein BstNI subfamily 2 1 1
MIRT022540 HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 1 1
MIRT022541 TUBE1 tubulin, epsilon 1 1 1
MIRT022542 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT022543 LOXL4 lysyl oxidase-like 4 1 1
MIRT022544 POP5 processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT022545 SSNA1 Sjogren syndrome nuclear autoantigen 1 1 1
MIRT022546 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 1 1
MIRT022547 MYH7B myosin, heavy chain 7B, cardiac muscle, beta 1 1
MIRT022548 RHBDL2 rhomboid, veinlet-like 2 (Drosophila) 1 1
MIRT022550 YKT6 YKT6 v-SNARE homolog (S. cerevisiae) 1 1
MIRT022551 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT022552 FBXL18 F-box and leucine-rich repeat protein 18 1 1
MIRT022553 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT022554 TBX2 T-box 2 1 1
MIRT022555 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT022556 SLC38A2 solute carrier family 38, member 2 1 1
MIRT022557 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 1 1
MIRT022558 CD86 CD86 molecule 1 1
MIRT022559 HAUS6 HAUS augmin-like complex, subunit 6 1 1
MIRT022560 LDLRAD4 chromosome 18 open reading frame 1 1 1
MIRT022561 TSPAN6 tetraspanin 6 1 1
MIRT022562 COL4A4 collagen, type IV, alpha 4 1 1
MIRT022563 CNKSR3 CNKSR family member 3 1 1
MIRT022564 SLC25A36 solute carrier family 25, member 36 1 1
MIRT022565 TGOLN2 trans-golgi network protein 2 1 1
MIRT022566 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT022567 RAB11FIP5 RAB11 family interacting protein 5 (class I) 1 1
MIRT022568 LRRC8C leucine rich repeat containing 8 family, member C 1 1
MIRT022569 ACADVL acyl-CoA dehydrogenase, very long chain 1 1
MIRT022570 BCAP29 B-cell receptor-associated protein 29 1 1
MIRT022571 FRMD6 FERM domain containing 6 1 1
MIRT022572 NXN nucleoredoxin 1 1
MIRT022573 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT022574 FBXO17 F-box protein 17 1 1
MIRT022575 SNTA1 syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component) 1 1
MIRT022576 ZMPSTE24 zinc metallopeptidase (STE24 homolog, S. cerevisiae) 1 1
MIRT022577 SLC9A9 solute carrier family 9 (sodium/hydrogen exchanger), member 9 1 1
MIRT022578 NRP1 neuropilin 1 1 1
MIRT022579 SNX16 sorting nexin 16 1 1
MIRT022580 AK3 adenylate kinase 3 1 1
MIRT022581 ANKS6 ankyrin repeat and sterile alpha motif domain containing 6 1 1
MIRT022582 RRP15 ribosomal RNA processing 15 homolog (S. cerevisiae) 1 1
MIRT022583 WASF2 WAS protein family, member 2 1 1
MIRT022584 DENND6A family with sequence similarity 116, member A 1 1
MIRT022585 RBM24 RNA binding motif protein 24 1 1
MIRT022586 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT022587 COL1A1 collagen, type I, alpha 1 2 1
MIRT022588 MOGS mannosyl-oligosaccharide glucosidase 2 1
MIRT022589 KANK2 KN motif and ankyrin repeat domains 2 2 1
MIRT022590 SNRPF small nuclear ribonucleoprotein polypeptide F 2 1
MIRT022591 PARN poly(A)-specific ribonuclease (deadenylation nuclease) 2 1
MIRT022592 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 2 1
MIRT022593 MUC1 mucin 1, cell surface associated 2 1
MIRT022594 PRPH peripherin 2 1
MIRT022595 CDKN2AIP CDKN2A interacting protein 2 1
MIRT022596 PHC2 polyhomeotic homolog 2 (Drosophila) 2 1
MIRT022597 DCUN1D5 DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) 2 1
MIRT022598 ANAPC7 anaphase promoting complex subunit 7 2 1
MIRT022599 FAM175B family with sequence similarity 175, member B 1 1
MIRT022600 SGSM3 small G protein signaling modulator 3 1 1
MIRT022601 SPATA9 spermatogenesis associated 9 1 1
MIRT022602 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT022603 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT022604 IFI44L interferon-induced protein 44-like 1 1
MIRT022605 COL6A2 collagen, type VI, alpha 2 1 1
MIRT022606 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT022607 PRKAG1 protein kinase, AMP-activated, gamma 1 non-catalytic subunit 1 1
MIRT022608 Mapk14 mitogen-activated protein kinase 14 1 1
MIRT022609 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT022610 MTCH1 mitochondrial carrier homolog 1 (C. elegans) 1 1
MIRT022611 HOXA3 homeobox A3 1 1
MIRT022612 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT022613 RAB32 RAB32, member RAS oncogene family 1 1
MIRT022614 ZNF549 zinc finger protein 549 1 1
MIRT022615 ANKRD42 ankyrin repeat domain 42 1 1
MIRT022616 DOK7 docking protein 7 1 1
MIRT022617 TGM1 transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT022618 MMP26 matrix metallopeptidase 26 1 1
MIRT022619 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT022620 FAM83D family with sequence similarity 83, member D 1 1
MIRT022621 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT022622 ETNPPL alanine-glyoxylate aminotransferase 2-like 1 1 1
MIRT022623 MAPKAPK3 mitogen-activated protein kinase-activated protein kinase 3 1 1
MIRT022624 CPM carboxypeptidase M 1 1
MIRT022625 PEMT phosphatidylethanolamine N-methyltransferase 1 1
MIRT022626 SKIL SKI-like oncogene 1 1
MIRT022627 DAPK1 death-associated protein kinase 1 1 1
MIRT022628 MXD4 MAX dimerization protein 4 1 1
MIRT022629 DBNL drebrin-like 1 1
MIRT022630 ABHD4 abhydrolase domain containing 4 1 1
MIRT022631 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT022632 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 1 1
MIRT022633 ANKS1B ankyrin repeat and sterile alpha motif domain containing 1B 1 1
MIRT022634 NARG2 NMDA receptor regulated 2 1 1
MIRT022635 HSPB7 heat shock 27kDa protein family, member 7 (cardiovascular) 1 1
MIRT022636 SLC25A39 solute carrier family 25, member 39 1 1
MIRT022637 SNX7 sorting nexin 7 1 1
MIRT022638 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 1
MIRT022639 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT022640 ATRIP ATR interacting protein 1 1
MIRT022641 MVB12A family with sequence similarity 125, member A 1 1
MIRT022642 IMPACT Impact homolog (mouse) 1 1
MIRT022643 FAM133A family with sequence similarity 133, member A 1 1
MIRT022644 NR4A3 nuclear receptor subfamily 4, group A, member 3 1 1
MIRT022645 CYP2U1 cytochrome P450, family 2, subfamily U, polypeptide 1 1 1
MIRT022646 DHRS1 dehydrogenase/reductase (SDR family) member 1 1 1
MIRT022647 MSRA methionine sulfoxide reductase A 1 1
MIRT022648 POC1B POC1 centriolar protein homolog B (Chlamydomonas) 1 1
MIRT022649 UMPS uridine monophosphate synthetase 1 1
MIRT022650 GRM1 glutamate receptor, metabotropic 1 1 1
MIRT022651 GIT2 G protein-coupled receptor kinase interacting ArfGAP 2 1 1
MIRT022652 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT022653 EGR2 early growth response 2 1 1
MIRT022654 KRI1 KRI1 homolog (S. cerevisiae) 2 1
MIRT022655 MISP chromosome 19 open reading frame 21 2 1
MIRT022656 ALDOB aldolase B, fructose-bisphosphate 2 1
MIRT022657 IFI16 interferon, gamma-inducible protein 16 2 1
MIRT022658 RAVER1 ribonucleoprotein, PTB-binding 1 2 1
MIRT022659 DCTN3 dynactin 3 (p22) 2 1
MIRT022660 QKI quaking homolog, KH domain RNA binding (mouse) 2 1
MIRT022661 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT022662 TGFB1I1 transforming growth factor beta 1 induced transcript 1 1 1
MIRT022663 FAM206A chromosome 9 open reading frame 6 1 1
MIRT022664 ZNF655 zinc finger protein 655 1 1
MIRT022665 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT022666 NTF4 neurotrophin 4 1 1
MIRT022667 CCDC142 coiled-coil domain containing 142 1 1
MIRT022668 DCC deleted in colorectal carcinoma 1 1
MIRT022669 ZNF395 zinc finger protein 395 1 1
MIRT022670 EVI2A ecotropic viral integration site 2A 1 1
MIRT022671 QSER1 glutamine and serine rich 1 1 1
MIRT022672 PDSS1 prenyl (decaprenyl) diphosphate synthase, subunit 1 1 1
MIRT022673 NSUN7 NOP2/Sun domain family, member 7 1 1
MIRT022674 FAM105A family with sequence similarity 105, member A 1 1
MIRT022675 PGGT1B protein geranylgeranyltransferase type I, beta subunit 1 1
MIRT022676 RSAD1 radical S-adenosyl methionine domain containing 1 1 1
MIRT022677 BABAM1 chromosome 19 open reading frame 62 1 1
MIRT022678 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT022679 COL8A2 collagen, type VIII, alpha 2 1 1
MIRT022680 TSR2 TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT022681 TRIM65 tripartite motif-containing 65 1 1
MIRT022682 CTHRC1 collagen triple helix repeat containing 1 1 1
MIRT022683 C1orf85 chromosome 1 open reading frame 85 1 1
MIRT022684 OASL 2'-5'-oligoadenylate synthetase-like 1 1
MIRT022685 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT022686 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT022687 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT022688 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein 1 1
MIRT022689 VIT vitrin 1 1
MIRT022690 TUBB2B tubulin, beta 2B 1 1
MIRT022691 IGFBP4 insulin-like growth factor binding protein 4 1 1
MIRT022692 C1orf198 chromosome 1 open reading frame 198 1 1
MIRT022693 CDV3 CDV3 homolog (mouse) 1 1
MIRT022694 FAM19A2 family with sequence similarity 19 (chemokine (C-C motif)-like), member A2 1 1
MIRT022695 FECH ferrochelatase 1 1
MIRT022696 VAMP8 vesicle-associated membrane protein 8 (endobrevin) 1 1
MIRT022697 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT022698 KCNS3 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 1 1
MIRT022699 MAP3K7CL chromosome 21 open reading frame 7 1 1
MIRT022700 FMNL2 formin-like 2 1 1
MIRT022701 FAM89A family with sequence similarity 89, member A 1 1
MIRT022702 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT022703 GPC1 glypican 1 1 1
MIRT022704 PRDM13 PR domain containing 13 1 1
MIRT022705 PNP purine nucleoside phosphorylase 1 1
MIRT022706 ACOT11 acyl-CoA thioesterase 11 1 1
MIRT022707 SLC35F3 solute carrier family 35, member F3 1 1
MIRT022708 RPP25L chromosome 9 open reading frame 23 1 1
MIRT022709 RHBDF1 rhomboid 5 homolog 1 (Drosophila) 1 1
MIRT022710 TXLNA taxilin alpha 1 1
MIRT022711 MST4 serine/threonine protein kinase MST4 1 1
MIRT022712 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT022713 TMED1 transmembrane emp24 protein transport domain containing 1 1 1
MIRT022714 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT022715 PPARA peroxisome proliferator-activated receptor alpha 1 1
MIRT022716 TPD52L2 tumor protein D52-like 2 1 1
MIRT022717 LRRC58 leucine rich repeat containing 58 2 2
MIRT022718 ANAPC4 anaphase promoting complex subunit 4 2 1
MIRT022719 IGFBP7 insulin-like growth factor binding protein 7 2 1
MIRT022720 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 2 1
MIRT022721 NONO non-POU domain containing, octamer-binding 2 1
MIRT022722 THOC6 THO complex 6 homolog (Drosophila) 2 1
MIRT022723 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 2 1
MIRT022724 CLTA clathrin, light chain A 2 1
MIRT022725 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 2 1
MIRT022726 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 2 1
MIRT022727 CHMP2B chromatin modifying protein 2B 1 1
MIRT022728 EIF4E eukaryotic translation initiation factor 4E 2 1
MIRT022729 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 2 1
MIRT022730 RPL23 ribosomal protein L23 1 1
MIRT022731 BCL6B B-cell CLL/lymphoma 6, member B 1 1
MIRT022732 S100A2 S100 calcium binding protein A2 1 1
MIRT022733 LINC00174 non-protein coding RNA 174 1 1
MIRT022734 DNAH5 dynein, axonemal, heavy chain 5 1 1
MIRT022735 CARD14 caspase recruitment domain family, member 14 1 1
MIRT022736 ANO6 anoctamin 6 1 1
MIRT022737 GREM1 gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) 1 1
MIRT022738 TRPV3 transient receptor potential cation channel, subfamily V, member 3 1 1
MIRT022739 NPR1 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) 1 1
MIRT022740 ANGPTL4 angiopoietin-like 4 1 1
MIRT022741 HTRA3 HtrA serine peptidase 3 1 1
MIRT022742 WRAP53 WD repeat containing, antisense to TP53 1 1
MIRT022743 NTHL1 nth endonuclease III-like 1 (E. coli) 1 1
MIRT022744 DPYD dihydropyrimidine dehydrogenase 1 1
MIRT022745 GABBR2 gamma-aminobutyric acid (GABA) B receptor, 2 1 1
MIRT022746 DNAJC25-GNG10 DNAJC25-GNG10 readthrough 1 1
MIRT022747 IL27RA interleukin 27 receptor, alpha 1 1
MIRT022748 GNRHR gonadotropin-releasing hormone receptor 1 1
MIRT022749 TTC8 tetratricopeptide repeat domain 8 1 1
MIRT022750 STK38L serine/threonine kinase 38 like 1 1
MIRT022751 TUBB4A tubulin, beta 4 1 1
MIRT022752 IFIT2 interferon-induced protein with tetratricopeptide repeats 2 1 1
MIRT022754 NRF1 nuclear respiratory factor 1 1 1
MIRT022755 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 1 1
MIRT022756 NID2 nidogen 2 (osteonidogen) 1 1
MIRT022757 MARCH11 membrane-associated ring finger (C3HC4) 11 1 1
MIRT022758 ADAMTSL5 ADAMTS-like 5 1 1
MIRT022759 SCN3A sodium channel, voltage-gated, type III, alpha subunit 1 1
MIRT022760 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT022761 BEX1 brain expressed, X-linked 1 1 1
MIRT022762 GDA guanine deaminase 1 1
MIRT022763 PDE3B phosphodiesterase 3B, cGMP-inhibited 1 1
MIRT022764 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT022765 CTNS cystinosis, nephropathic 1 1
MIRT022766 MKX mohawk homeobox 1 1
MIRT022767 SGMS1 sphingomyelin synthase 1 1 1
MIRT022768 AKT2 v-akt murine thymoma viral oncogene homolog 2 1 1
MIRT022769 LAPTM4A lysosomal protein transmembrane 4 alpha 1 1
MIRT022770 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT022771 ZNF548 zinc finger protein 548 1 1
MIRT022772 NLRX1 NLR family member X1 1 1
MIRT022773 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT022774 SDF2L1 stromal cell-derived factor 2-like 1 1 1
MIRT022775 DACT1 dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) 1 1
MIRT022776 POGLUT1 KTEL (Lys-Tyr-Glu-Leu) containing 1 1 1
MIRT022777 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT022778 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT022779 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT022780 TMEM184B transmembrane protein 184B 1 1
MIRT022781 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT022782 KIF16B kinesin family member 16B 1 1
MIRT022783 ITSN2 intersectin 2 1 1
MIRT022784 FAM122B family with sequence similarity 122B 1 1
MIRT022785 CCDC68 coiled-coil domain containing 68 1 1
MIRT022786 AKT1S1 AKT1 substrate 1 (proline-rich) 1 1
MIRT022787 PHF6 PHD finger protein 6 1 1
MIRT022788 MBD3 methyl-CpG binding domain protein 3 2 1
MIRT022789 FLII flightless I homolog (Drosophila) 2 1
MIRT022790 CSRP1 cysteine and glycine-rich protein 1 2 1
MIRT022791 GOLGA7 golgin A7 2 1
MIRT022792 DPF2 D4, zinc and double PHD fingers family 2 2 1
MIRT022793 MLLT4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 2 1
MIRT022794 RHOC ras homolog gene family, member C 2 1
MIRT022795 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 2 1
MIRT022796 DKC1 dyskeratosis congenita 1, dyskerin 2 1
MIRT022797 CCDC86 coiled-coil domain containing 86 2 1
MIRT022798 LARP1 La ribonucleoprotein domain family, member 1 2 1
MIRT022799 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 2 1
MIRT022800 EFHD2 EF-hand domain family, member D2 2 1
MIRT022801 ANXA5 annexin A5 2 1
MIRT022802 SPOCD1 SPOC domain containing 1 1 1
MIRT022803 GPX7 glutathione peroxidase 7 1 1
MIRT022804 EPDR1 ependymin related protein 1 (zebrafish) 1 1
MIRT022805 KIAA1217 KIAA1217 1 1
MIRT022806 CNNM2 cyclin M2 1 1
MIRT022807 ACTR5 ARP5 actin-related protein 5 homolog (yeast) 1 1
MIRT022808 GCSAML chromosome 1 open reading frame 150 1 1
MIRT022809 SLC38A5 solute carrier family 38, member 5 1 1
MIRT022810 DSCAML1 Down syndrome cell adhesion molecule like 1 1 1
MIRT022811 CCM2L chromosome 20 open reading frame 160 1 1
MIRT022812 BARX1 BARX homeobox 1 1 1
MIRT022813 THPO thrombopoietin 1 1
MIRT022814 ATG4A ATG4 autophagy related 4 homolog A (S. cerevisiae) 1 1
MIRT022815 SLC35A2 solute carrier family 35 (UDP-galactose transporter), member A2 1 1
MIRT022816 VASN vasorin 1 1
MIRT022817 F3 coagulation factor III (thromboplastin, tissue factor) 1 1
MIRT022818 AAMDC chromosome 11 open reading frame 67 1 1
MIRT022819 NUPR1 nuclear protein, transcriptional regulator, 1 1 1
MIRT022820 LRRC42 leucine rich repeat containing 42 1 1
MIRT022821 MTUS2 microtubule associated tumor suppressor candidate 2 1 1
MIRT022822 ROBO3 roundabout, axon guidance receptor, homolog 3 (Drosophila) 1 1
MIRT022823 CCNA1 cyclin A1 1 1
MIRT022824 C4BPB complement component 4 binding protein, beta 1 1
MIRT022825 FAR1 fatty acyl CoA reductase 1 1 1
MIRT022826 CBR3 carbonyl reductase 3 1 1
MIRT022827 TRPC6 transient receptor potential cation channel, subfamily C, member 6 1 1
MIRT022828 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT022829 FAM65C family with sequence similarity 65, member C 1 1
MIRT022830 PREB prolactin regulatory element binding 1 1
MIRT022831 SMPDL3A sphingomyelin phosphodiesterase, acid-like 3A 1 1
MIRT022832 FGFBP1 fibroblast growth factor binding protein 1 1 1
MIRT022833 LRRC15 leucine rich repeat containing 15 1 1
MIRT022834 CCDC121 coiled-coil domain containing 121 1 1
MIRT022835 TMEM104 transmembrane protein 104 1 1
MIRT022836 HRH1 histamine receptor H1 1 1
MIRT022837 LIMD1 LIM domains containing 1 1 1
MIRT022838 LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 1 1
MIRT022839 RAB31 RAB31, member RAS oncogene family 1 1
MIRT022840 PLEKHG4 pleckstrin homology domain containing, family G (with RhoGef domain) member 4 1 1
MIRT022841 PARP9 poly (ADP-ribose) polymerase family, member 9 1 1
MIRT022842 GCH1 GTP cyclohydrolase 1 1 1
MIRT022843 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 1
MIRT022844 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT022845 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT022846 FSTL1 follistatin-like 1 1 1
MIRT022847 RPIA ribose 5-phosphate isomerase A 1 1
MIRT022848 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT022849 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 2 1
MIRT022850 TUBA1A tubulin, alpha 1a 1 1
MIRT022851 PES1 pescadillo homolog 1, containing BRCT domain (zebrafish) 2 1
MIRT022852 ALDH3B2 aldehyde dehydrogenase 3 family, member B2 2 1
MIRT022853 MCM7 minichromosome maintenance complex component 7 2 1
MIRT022854 POLR2J polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa 2 1
MIRT022855 KIAA0101 KIAA0101 2 1
MIRT022856 CAPRIN1 cell cycle associated protein 1 2 1
MIRT022857 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 2 1
MIRT022858 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 2 1
MIRT022859 ADD3 adducin 3 (gamma) 2 1
MIRT022860 FOXRED2 FAD-dependent oxidoreductase domain containing 2 2 1
MIRT022861 RRAS2 related RAS viral (r-ras) oncogene homolog 2 2 1
MIRT022862 MSN moesin 2 1
MIRT022863 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 2 1
MIRT022864 TP63 tumor protein p63 1 1
MIRT022865 CCDC41 coiled-coil domain containing 41 1 1
MIRT022866 SH2D1B SH2 domain containing 1B 1 1
MIRT022867 ELP2 elongation protein 2 homolog (S. cerevisiae) 1 1
MIRT022868 P4HA3 prolyl 4-hydroxylase, alpha polypeptide III 1 1
MIRT022869 CLMP adipocyte-specific adhesion molecule 1 1
MIRT022870 RASIP1 Ras interacting protein 1 1 1
MIRT022871 GOLT1B golgi transport 1 homolog B (S. cerevisiae) 1 1
MIRT022872 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT022873 NAT6 N-acetyltransferase 6 (GCN5-related) 1 1
MIRT022874 ANKS3 ankyrin repeat and sterile alpha motif domain containing 3 1 1
MIRT022875 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT022876 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT022877 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT022878 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT022879 CXXC1 CXXC finger 1 (PHD domain) 1 1
MIRT022880 XBP1 X-box binding protein 1 1 1
MIRT022881 NTMT1 methyltransferase like 11A 1 1
MIRT022882 SNAI1 snail homolog 1 (Drosophila) 1 1
MIRT022883 RHOA ras homolog gene family, member A 1 1
MIRT022884 NCF2 neutrophil cytosolic factor 2 1 1
MIRT022885 CDO1 cysteine dioxygenase, type I 1 1
MIRT022886 WNT5B wingless-type MMTV integration site family, member 5B 1 1
MIRT022887 TMEM179B transmembrane protein 179B 1 1
MIRT022888 USP47 ubiquitin specific peptidase 47 1 1
MIRT022889 LCA5L Leber congenital amaurosis 5-like 1 1
MIRT022890 CRB1 crumbs homolog 1 (Drosophila) 1 1
MIRT022891 CD2AP CD2-associated protein 1 1
MIRT022892 HN1L hematological and neurological expressed 1-like 1 1
MIRT022893 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT022894 GRAMD3 GRAM domain containing 3 1 1
MIRT022895 AIM1 absent in melanoma 1 1 1
MIRT022896 LRIG1 leucine-rich repeats and immunoglobulin-like domains 1 1 1
MIRT022897 CENPQ centromere protein Q 1 1
MIRT022898 RUNX2 runt-related transcription factor 2 1 1
MIRT022899 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT022900 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 1
MIRT022901 RAB38 RAB38, member RAS oncogene family 1 1
MIRT022902 CCBL2 cysteine conjugate-beta lyase 2 1 1
MIRT022903 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT022904 PARP14 poly (ADP-ribose) polymerase family, member 14 1 1
MIRT022905 RAB2A RAB2A, member RAS oncogene family 1 1
MIRT022906 KIF13A kinesin family member 13A 1 1
MIRT022907 CACUL1 chromosome 10 open reading frame 46 1 1
MIRT022908 PRPS1 phosphoribosyl pyrophosphate synthetase 1 1 1
MIRT022909 ERF Ets2 repressor factor 1 1
MIRT022910 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 1
MIRT022911 MLLT3 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 1 1
MIRT022912 PSKH1 protein serine kinase H1 1 1
MIRT022913 SLITRK4 SLIT and NTRK-like family, member 4 1 1
MIRT022914 EVI5 ecotropic viral integration site 5 1 1
MIRT022915 TBX22 T-box 22 1 1
MIRT022916 KCNK2 potassium channel, subfamily K, member 2 1 1
MIRT022917 WIPF1 WAS/WASL interacting protein family, member 1 1 1
MIRT022918 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT022919 BMP6 bone morphogenetic protein 6 1 1
MIRT022920 STT3A STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) 1 1
MIRT022921 SNX9 sorting nexin 9 2 1
MIRT022922 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 2 1
MIRT022923 GLIPR2 GLI pathogenesis-related 2 2 1
MIRT022924 GAR1 GAR1 ribonucleoprotein homolog (yeast) 2 1
MIRT022925 POLR2L polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa 2 1
MIRT022926 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 2 1
MIRT022927 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 2 1
MIRT022928 KDM2A lysine (K)-specific demethylase 2A 2 1
MIRT022929 HNRNPCL1 heterogeneous nuclear ribonucleoprotein C-like 1 2 1
MIRT022930 ALDH18A1 aldehyde dehydrogenase 18 family, member A1 2 1
MIRT022931 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 2 1
MIRT022932 EIF3B eukaryotic translation initiation factor 3, subunit B 2 1
MIRT022933 SP3 Sp3 transcription factor 2 1
MIRT022934 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 2 1
MIRT022935 GAB3 GRB2-associated binding protein 3 1 1
MIRT022936 SAMSN1 SAM domain, SH3 domain and nuclear localization signals 1 1 1
MIRT022937 CCDC11 coiled-coil domain containing 11 1 1
MIRT022938 GUK1 guanylate kinase 1 1 1
MIRT022939 TRIM7 tripartite motif-containing 7 1 1
MIRT022940 MRPS12 mitochondrial ribosomal protein S12 1 1
MIRT022941 CC2D2A coiled-coil and C2 domain containing 2A 1 1
MIRT022942 CHSY3 chondroitin sulfate synthase 3 1 1
MIRT022943 MLEC malectin 1 1
MIRT022944 TREX2 three prime repair exonuclease 2 1 1
MIRT022945 CPA6 carboxypeptidase A6 1 1
MIRT022946 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT022947 SULT1B1 sulfotransferase family, cytosolic, 1B, member 1 1 1
MIRT022948 PEX16 peroxisomal biogenesis factor 16 1 1
MIRT022949 NRTN neurturin 1 1
MIRT022950 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT022951 APPL2 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 1 1
MIRT022952 TMEM43 transmembrane protein 43 1 1
MIRT022953 UGT1A10 UDP glucuronosyltransferase 1 family, polypeptide A10 1 1
MIRT022954 LAMA1 laminin, alpha 1 1 1
MIRT022955 PRSS50 protease, serine, 50 1 1
MIRT022956 LSMEM2 chromosome 3 open reading frame 45 1 1
MIRT022957 SEC14L3 SEC14-like 3 (S. cerevisiae) 1 1
MIRT022958 CEBPE CCAAT/enhancer binding protein (C/EBP), epsilon 1 1
MIRT022959 NNMT nicotinamide N-methyltransferase 1 1
MIRT022960 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT022961 RNF144B ring finger protein 144B 1 1
MIRT022962 CABP7 calcium binding protein 7 1 1
MIRT022963 FTSJ1 FtsJ homolog 1 (E. coli) 1 1
MIRT022964 RUFY3 RUN and FYVE domain containing 3 1 1
MIRT022965 SULF1 sulfatase 1 1 1
MIRT022966 TPST1 tyrosylprotein sulfotransferase 1 1 1
MIRT022967 SLC22A3 solute carrier family 22 (extraneuronal monoamine transporter), member 3 1 1
MIRT022968 TPCN2 two pore segment channel 2 1 1
MIRT022969 SLC25A16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 1 1
MIRT022970 CA12 carbonic anhydrase XII 1 1
MIRT022971 ZFYVE26 zinc finger, FYVE domain containing 26 1 1
MIRT022972 KLF9 Kruppel-like factor 9 1 1
MIRT022973 ADCY3 adenylate cyclase 3 1 1
MIRT022974 CCT5 chaperonin containing TCP1, subunit 5 (epsilon) 1 1
MIRT022975 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 1
MIRT022976 CD151 CD151 molecule (Raph blood group) 1 1
MIRT022977 CDH11 cadherin 11, type 2, OB-cadherin (osteoblast) 1 1
MIRT022978 IL7 interleukin 7 1 1
MIRT022979 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 1
MIRT022980 FBLIM1 filamin binding LIM protein 1 1 1
MIRT022981 ARPP21 cyclic AMP-regulated phosphoprotein, 21 kD 1 1
MIRT022982 CCDC28A coiled-coil domain containing 28A 1 1
MIRT022983 DCAF5 DDB1 and CUL4 associated factor 5 1 1
MIRT022984 TRPS1 trichorhinophalangeal syndrome I 1 1
MIRT022985 PGM2 phosphoglucomutase 2 1 1
MIRT022986 PLEKHF2 pleckstrin homology domain containing, family F (with FYVE domain) member 2 1 1
MIRT022987 ZWINT ZW10 interactor 1 1
MIRT022988 RANBP10 RAN binding protein 10 1 1
MIRT022989 TMEM41A transmembrane protein 41A 1 1
MIRT022990 ANPEP alanyl (membrane) aminopeptidase 2 1
MIRT022991 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 2 1
MIRT022992 PBX1 pre-B-cell leukemia homeobox 1 2 1
MIRT022993 AHNAK2 AHNAK nucleoprotein 2 2 1
MIRT022994 AATF apoptosis antagonizing transcription factor 2 1
MIRT022995 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 2 1
MIRT022996 NT5E 5'-nucleotidase, ecto (CD73) 2 1
MIRT022997 NSUN2 NOP2/Sun domain family, member 2 2 1
MIRT022998 RFX1 regulatory factor X, 1 (influences HLA class II expression) 2 1
MIRT022999 TRIM37 tripartite motif-containing 37 1 1
MIRT023000 F13B coagulation factor XIII, B polypeptide 1 1
MIRT023001 NPLOC4 nuclear protein localization 4 homolog (S. cerevisiae) 1 1
MIRT023002 KIF20A kinesin family member 20A 1 1
MIRT023003 MYO19 myosin XIX 1 1
MIRT023004 GNPDA1 glucosamine-6-phosphate deaminase 1 1 1
MIRT023005 RBBP9 retinoblastoma binding protein 9 1 1
MIRT023006 L3HYPDH chromosome 14 open reading frame 149 1 1
MIRT023007 ASPN asporin 1 1
MIRT023008 S1PR5 sphingosine-1-phosphate receptor 5 1 1
MIRT023009 UNC79 KIAA1409 1 1
MIRT023010 TNS4 tensin 4 1 1
MIRT023011 TMEM161A transmembrane protein 161A 1 1
MIRT023012 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT023013 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT023014 S100G S100 calcium binding protein G 1 1
MIRT023015 FLI1 Friend leukemia virus integration 1 1 1
MIRT023016 PLEKHA4 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 1 1
MIRT023017 TYK2 tyrosine kinase 2 1 1
MIRT023018 CDH12 cadherin 12, type 2 (N-cadherin 2) 1 1
MIRT023019 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT023020 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT023021 SERPINB2 serpin peptidase inhibitor, clade B (ovalbumin), member 2 1 1
MIRT023022 TMEM248 chromosome 7 open reading frame 42 2 2
MIRT023023 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT023024 KLHL14 kelch-like 14 (Drosophila) 1 1
MIRT023025 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT023026 LGR5 leucine-rich repeat-containing G protein-coupled receptor 5 1 1
MIRT023027 PIWIL4 piwi-like 4 (Drosophila) 1 1
MIRT023028 KLF2 Kruppel-like factor 2 (lung) 1 1
MIRT023029 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT023030 PXN paxillin 1 1
MIRT023031 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 1 1
MIRT023032 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT023033 PRKCDBP protein kinase C, delta binding protein 1 1
MIRT023034 PORCN porcupine homolog (Drosophila) 1 1
MIRT023035 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT023036 KANSL2 chromosome 12 open reading frame 41 1 1
MIRT023037 NLGN4Y neuroligin 4, Y-linked 1 1
MIRT023038 CA5B carbonic anhydrase VB, mitochondrial 1 1
MIRT023039 CAPNS1 calpain, small subunit 1 1 1
MIRT023040 ZDHHC14 zinc finger, DHHC-type containing 14 1 1
MIRT023041 ELF3 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) 1 1
MIRT023042 STK38 serine/threonine kinase 38 1 1
MIRT023043 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT023044 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT023045 SLC35G1 transmembrane protein 20 1 1
MIRT023046 VANGL1 vang-like 1 (van gogh, Drosophila) 1 1
MIRT023047 PECR peroxisomal trans-2-enoyl-CoA reductase 1 1
MIRT023048 TFEB transcription factor EB 1 1
MIRT023049 MORC4 MORC family CW-type zinc finger 4 1 1
MIRT023050 EEA1 early endosome antigen 1 1 1
MIRT023051 ALG2 asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT023052 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT023053 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT023054 PTRF polymerase I and transcript release factor 2 1
MIRT023055 MPHOSPH10 M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) 2 1
MIRT023056 RBM28 RNA binding motif protein 28 2 1
MIRT023057 TRPC1 transient receptor potential cation channel, subfamily C, member 1 2 1
MIRT023058 KIF2C kinesin family member 2C 2 1
MIRT023059 SLU7 SLU7 splicing factor homolog (S. cerevisiae) 2 1
MIRT023060 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 2 1
MIRT023061 MINA MYC induced nuclear antigen 2 1
MIRT023062 TIMM8B translocase of inner mitochondrial membrane 8 homolog B (yeast) 2 1
MIRT023063 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 2 1
MIRT023064 ORC1 origin recognition complex, subunit 1-like (yeast) 2 1
MIRT023065 KRT14 keratin 14 2 1
MIRT023066 NIP7 nuclear import 7 homolog (S. cerevisiae) 2 1
MIRT023067 SRSF5 splicing factor, arginine/serine-rich 5 2 1
MIRT023068 CORO2A coronin, actin binding protein, 2A 2 1
MIRT023069 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT023070 COL12A1 collagen, type XII, alpha 1 2 1
MIRT023071 RIN1 Ras and Rab interactor 1 1 1
MIRT023072 HOXC9 homeobox C9 1 1
MIRT023073 PCSK9 proprotein convertase subtilisin/kexin type 9 1 1
MIRT023074 LYVE1 lymphatic vessel endothelial hyaluronan receptor 1 1 1
MIRT023075 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT023076 L1CAM L1 cell adhesion molecule 1 1
MIRT023077 ZNF790 zinc finger protein 790 1 1
MIRT023078 CCDC39 coiled-coil domain containing 39 1 1
MIRT023079 IL8 interleukin 8 1 1
MIRT023080 IKBIP IKBKB interacting protein 1 1
MIRT023081 IGFN1 immunoglobulin-like and fibronectin type III domain containing 1 1 1
MIRT023082 STAT5A signal transducer and activator of transcription 5A 1 1
MIRT023083 CHP1 calcium binding protein P22 1 1
MIRT023084 CXCL1 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) 1 1
MIRT023085 CAMP cathelicidin antimicrobial peptide 1 1
MIRT023086 SMIM12 chromosome 1 open reading frame 212 1 1
MIRT023087 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 1 1
MIRT023088 PLEKHM2 pleckstrin homology domain containing, family M (with RUN domain) member 2 1 1
MIRT023089 TMEM102 transmembrane protein 102 1 1
MIRT023090 IL18R1 interleukin 18 receptor 1 1 1
MIRT023091 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 1 1
MIRT023092 LAMB3 laminin, beta 3 1 1
MIRT023093 DUSP2 dual specificity phosphatase 2 1 1
MIRT023094 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT023095 WASF4P WAS protein family, member 4 1 1
MIRT023096 DGKA diacylglycerol kinase, alpha 80kDa 1 1
MIRT023097 SLC26A4 solute carrier family 26, member 4 1 1
MIRT023098 DUS4L dihydrouridine synthase 4-like (S. cerevisiae) 1 1
MIRT023099 CYR61 cysteine-rich, angiogenic inducer, 61 1 1
MIRT023100 EYS eyes shut homolog (Drosophila) 1 1
MIRT023101 ECE2 endothelin converting enzyme 2 1 1
MIRT023102 C12orf40 chromosome 12 open reading frame 40 1 1
MIRT023103 KIF7 kinesin family member 7 1 1
MIRT023104 MICAL1 microtubule associated monoxygenase, calponin and LIM domain containing 1 1 1
MIRT023105 SC5D sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like 1 1
MIRT023106 KIF1B kinesin family member 1B 1 1
MIRT023107 AGTR1 angiotensin II receptor, type 1 1 1
MIRT023108 PLEKHA7 pleckstrin homology domain containing, family A member 7 1 1
MIRT023109 FCF1 FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) 1 1
MIRT023110 NR4A1 nuclear receptor subfamily 4, group A, member 1 1 1
MIRT023111 ABT1 activator of basal transcription 1 1 1
MIRT023112 THEM6 chromosome 8 open reading frame 55 1 1
MIRT023113 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT023114 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT023115 IL1R1 interleukin 1 receptor, type I 1 1
MIRT023116 RCAN1 regulator of calcineurin 1 1 1
MIRT023117 DISC1 disrupted in schizophrenia 1 1 1
MIRT023118 RFX2 regulatory factor X, 2 (influences HLA class II expression) 1 1
MIRT023119 USP38 ubiquitin specific peptidase 38 1 1
MIRT023120 LIMD2 LIM domain containing 2 1 1
MIRT023121 CBX2 chromobox homolog 2 (Pc class homolog, Drosophila) 1 1
MIRT023122 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT023123 LTA4H leukotriene A4 hydrolase 1 1
MIRT023124 FPGS folylpolyglutamate synthase 1 1
MIRT023125 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT023126 SOS2 son of sevenless homolog 2 (Drosophila) 1 1
MIRT023127 LMAN2L lectin, mannose-binding 2-like 1 1
MIRT023128 SH2B3 SH2B adaptor protein 3 1 1
MIRT023129 IRAK3 interleukin-1 receptor-associated kinase 3 1 1
MIRT023130 FRMD8 FERM domain containing 8 1 1
MIRT023131 MED10 mediator complex subunit 10 2 1
MIRT023132 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 2 1
MIRT023133 SRBD1 S1 RNA binding domain 1 <