Accession ID: MIRT002272 [miRNA, hsa-miR-221-3p :: CDKN1C, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-221LinkOut: [miRBase ]
Synonyms MIRN221, miRNA221, mir-221, MIR221
Description Homo sapiens miR-221 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-221-3p
Mature Sequence 65| AGCUACAUUGUCUGCUGGGUUUC |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-221-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1C LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BWCR, BWS, KIP2, WBS, p57
Description cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Transcript NM_0000    LinkOut: [ RefSeq ]
Other Transcripts NM_0011226 , NM_0011226   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1C LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1C
(miRNA target sites are highlighted)
>CDKN1C|NM_0000|3'UTR
   1 TGAGCCAATTTAGAGCCCAAAGAGCCCCGAGGGAACCTGCCGGGGCAGCGGACGTTGGAAGGGCGCTGGGCCTCGGCTGG
  81 GACCGTTCATGTAGCAGCAACCGGCGGCGGCTGCCGCAGAGCAGCGTTCGGTTTTGTTTTTAAATTTTGAAAACTGTGCA
 161 ATGTATTAATAACGTCTTTTTATATCTAAATGTATTCTGCACGAGAAGGTACACTGGTCCCAAGGTGTAAAGCTTTAAGA
 241 GTCATTTATATAAAATGTTTAATCTCTGCTGAAACTCAGTGCAAAAAAAAGAAAAAAGAAAAAAAAAAGGAAAAAATAAA
 321 AAAACCATGTATATTTGTACAAAAAGTTTTTAAAGTTATACTAACTTATATTTTCTATTTATGTCCAGGCGTGGACCGCT
 401 CTGCCACGCACTAGCTCGGTTATTGGTTATGCCAAAGGCACTCTCCATCTCCCACATCTGGTTATTGACAAGTGTAACTT
 481 TATTTTCATCGCGGACTCTGGGGAAGGGGGTCACTCACAAGCTGTAGCTGCCATACATGCCCATCTAGCTTGCAGTCTCT
 561 TCGCGCTTTCGCTGTCTCTCTTATTATGACTGTGTTTATCTGAAACTTGAAGACAAGTCTGTTAAAATGGTTCCTGAGCC
 641 GTCTGTACCACTGCCCCGGCCCCTCGTCCGCCGGGTTCTAAATAAAGAGGCCGAAAAATGCTGCAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1C    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other , Reporter assay
Conditions T98G , K562
Location of target site 3'UTR
Tools used in this research TargetCombo , TargetScan , PicTar
Original Description (Extracted from the article) ... Our results show that miR-221 and miR-222 both directly target the 3 untranslated regions of p27 and p57 mRNAs to reduce reporter gene expression, as well as diminish p27 and p57 protein levels. //miR-221 or miR-222 oligonucleotides significantly reduced p57 3`UTR-luciferase and p27 3`UTR-luciferase reporter activities by 60% and 77%, respectively (Fig. 3B) ...

- Medina, R. Zaidi, S. K. Liu, C. G. Stein, et al., 2008, Cancer Res.

Article - Medina, R. Zaidi, S. K. Liu, C. G. Stein, et al.
- Cancer Res, 2008
MicroRNAs (miRNA) have tumor suppressive and oncogenic potential in human cancer, but whether and how miRNAs control cell cycle progression is not understood. To address this question, we carried out a comprehensive analysis of miRNA expression during serum stimulation of quiescent human cells. Time course analyses revealed that four miRNAs are up-regulated and >100 miRNAs are down-regulated, as cells progress beyond the G(1)-S phase transition. We analyzed the function of two up-regulated miRNAs (miR-221 and miR-222) that are both predicted to target the cell growth suppressive cyclin-dependent kinase inhibitors p27 and p57. Our results show that miR-221 and miR-222 both directly target the 3' untranslated regions of p27 and p57 mRNAs to reduce reporter gene expression, as well as diminish p27 and p57 protein levels. Functional studies show that miR-221 and miR-222 prevent quiescence when elevated during growth factor deprivation and induce precocious S-phase entry, thereby triggering cell death. Thus, the physiologic up-regulation of miR-221 and miR-222 is tightly linked to a cell cycle checkpoint that ensures cell survival by coordinating competency for initiation of S phase with growth factor signaling pathways that stimulate cell proliferation.
LinkOut: [PMID: 18413744]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1C    [ Functional MTI ]
Validation Method Reporter assay , Luciferase reporter assay , qRT-PCR , Western blot , Northern blot ,
Conditions HEP3B , SNU449 , SN398
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar
Article - Fornari, F. Gramantieri, L. Ferracin, M. et al.
- Oncogene, 2008
The identification of target mRNAs is a key step for assessing the role of aberrantly expressed microRNAs in human cancer. MiR-221 is upregulated in human hepatocellular carcinoma (HCC) as well as in other malignancies. One proven target of miR-221 is CDKN1B/p27, whose downregulation affects HCC prognosis. Here, we proved that the cyclin-dependent kinase inhibitor (CDKI) CDKN1C/p57 is also a direct target of miR-221. Indeed, downregulation of both CDKN1B/p27 and CDKN1C/p57 occurs in response to miR-221 transfection into HCC-derived cells and a significant upregulation of both CDKN1B/p27 and CDKN1C/p57 occurs in response to antimiR-221 transfection. A direct interaction of miR-221 with a target site on the 3' UTR of CDKN1C/p57 mRNA was also demonstrated. By controlling these two CDKIs, upregulation of miR-221 can promote growth of HCC cells by increasing the number of cells in S-phase. To assess the relevance of these studies in primary tumors, matched HCC and cirrhosis samples were assayed for miR-221, for CDKN1B/p27 and CDKN1C/p57 expression. MiR-221 was upregulated in 71% of HCCs, whereas CDKN1B/p27 and CDKN1C/p57 proteins were downregulated in 77% of cases. A significant inverse correlation between miR-221 and both CDKN1B/p27 and CDKN1C/p57 was found in HCCs. In conclusion, we suggest that miR-221 has an oncogenic function in hepatocarcinogenesis by targeting CDKN1B/p27 and CDKN1C/p57, hence promoting proliferation by controlling cell-cycle inhibitors. These findings establish a basis toward the development of therapeutic strategies aimed at blocking miR-221 in HCC.
LinkOut: [PMID: 18521080]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1C    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... We show that miR-25 targets p57 through the 3 UTR. Furthermore, miR-106b and miR-93 control p21 while miR-222 and miR-221 regulate both p27 and p57. ...

- Kim, Y. K. Yu, J. Han, T. S. Park, S. Y. et al., 2009, Nucleic Acids Res.

Article - Kim, Y. K. Yu, J. Han, T. S. Park, S. Y. et al.
- Nucleic Acids Res, 2009
microRNAs (miRNAs) play integral roles in diverse processes including tumorigenesis. miRNA gene loci are often found in close conjunction, and such clustered miRNA genes are transcribed from a common promoter to generate polycistronic primary transcript. The primary transcript (pri-miRNA) is then processed by two RNase III proteins to release the mature miRNAs. Although it has been speculated that the miRNAs in the same cluster may play related biological functions, this has not been experimentally addressed. Here we report that the miRNAs in two clusters (miR-106b approximately 93 approximately 25 and miR-222 approximately 221) suppress the Cip/Kip family members of Cdk inhibitors (p57(Kip2), p21(Cip1) and p27(Kip1)). We show that miR-25 targets p57 through the 3'-UTR. Furthermore, miR-106b and miR-93 control p21 while miR-222 and miR-221 regulate both p27 and p57. Ectopic expression of these miRNAs results in activation of Cdk2 and facilitation of G1/S phase transition. Consistent with these results, both clusters are abnormally upregulated in gastric cancer tissues compared to the corresponding normal tissues. Ectopic expression of miR-222 cluster enhanced tumor growth in the mouse xenograft model. Our study demonstrates the functional associations between clustered miRNAs and further implicates that effective cancer treatment may require a combinatorial approach to target multiple oncogenic miRNA clusters.
LinkOut: [PMID: 19153141]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1C    [ Functional MTI ]
Validation Method Reporter assay;Microarray
Article - Pineau, P. Volinia, S. McJunkin, K. et al.
- Proc Natl Acad Sci U S A, 2010
MicroRNA (miRNAs) are negative regulators of gene expression and can function as tumor suppressors or oncogenes. Expression patterns of miRNAs and their role in the pathogenesis of hepatocellular carcinoma (HCC) are still poorly understood. We profiled miRNA expression in tissue samples (104 HCC, 90 adjacent cirrhotic livers, 21 normal livers) as well as in 35 HCC cell lines. A set of 12 miRNAs (including miR-21, miR-221/222, miR-34a, miR-519a, miR-93, miR-96, and let-7c) was linked to disease progression from normal liver through cirrhosis to full-blown HCC. miR-221/222, the most up-regulated miRNAs in tumor samples, are shown to target the CDK inhibitor p27 and to enhance cell growth in vitro. Conversely, these activities can be efficiently inhibited by an antagomiR specific for miR-221. In addition, we show, using a mouse model of liver cancer, that miR-221 overexpression stimulates growth of tumorigenic murine hepatic progenitor cells. Finally, we identified DNA damage-inducible transcript 4 (DDIT4), a modulator of mTOR pathway, as a bona fide target of miR-221. Taken together, these data reveal an important contribution for miR-221 in hepatocarcinogenesis and suggest a role for DDIT4 dysregulation in this process. Thus, the use of synthetic inhibitors of miR-221 may prove to be a promising approach to liver cancer treatment.
LinkOut: [PMID: 20018759]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1C    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions HT-29 , Lovo , SW-480Caco2
Disease colorectal cancer
Location of target site 3'UTR
Tools used in this research microRNA.org , PicTar , TargetScan
Original Description (Extracted from the article) ... MiR-221 binds to the target site in the 3 ’ -UTR of the CDKN1C/p57 mRNA to inhibit CDKN1C/p57 expression by post-transcriptional gene silencing to promote CRC occurrence and progress, therefore serving as a potential therapeutic target for the prevention and treatment of CRC. ...

- Sun, K. Wang, W. Zeng, J. J. Wu, C. T. Lei, et al., 2011, Acta pharmacologica Sinica.

Article - Sun, K. Wang, W. Zeng, J. J. Wu, C. T. Lei, et al.
- Acta pharmacologica Sinica, 2011
Aim:To investigate the regulatory effect of microRNA-221 (miR-221) on CDKN1C/p57 expression in colorectal carcinoma (CRC).Methods:Thirty four CRC and adjacent non-tumorous tissue samples were collected individually. Total RNA and protein were isolatedand from these samples and four human CRC-derived cell lines (including HT-29, Lovo, SW-480 and Caco2). MiR-221 expression was examined using real-time RT-PCR. CRC cells were treated with or without anti-p57-siRNA prior to the addition of pre-miR-221 or anti-miR-221. The mRNA and protein levels of CDKN1C/p57 were examined using semi-quantitative RT-PCR and Western blot, respectively. CRC cell proliferation and apoptosis were assessed using MTT assay and flow cytometry, respectively. The CDKN1C/p57 3'-UTR fragment was amplified using PCR from the genomic DNA of human colon cells and inserted into a luciferase reporter construct. The reporter construct was then transfected into CRC cells together with pre-miR-221 or anti-miR-221, and the luciferase activity in the transfected cells was examined.Results:MiR-221 expression was significantly up-regulated in 90% of CRC samples compared to that in the adjacent non-tumorous tissue, and the expression level was positively correlated to an advanced TNM stage and local invasion. There was no significant difference in CDKN1C/p57 mRNA expression between CRC and corresponding non-tumorous tissues, whereas CDKN1C/p57 protein expression was markedly decreased in the CRC samples. A significant inverse correlation between miR-221 and CDKN1C/p57 expression was found in CRC cells. Moreover, a miR-221-specific inhibitor significantly increased CDKN1C/p57 protein expression in CRC cells. Anti-miR-221 markedly inhibited CRC cell proliferation and induced apoptosis. This inhibitory effect was abolished by pretreatment with anti-p57-siRNA, suggesting that the inhibition was mediated by CDKN1C/p57. A significant increase of the luciferase activity was observed in CRC cells co-transfected with the luciferase reporter construct and anti-miR-221.Conclusion:MiR-221 binds to the target site in the 3'-UTR of the CDKN1C/p57 mRNA to inhibit CDKN1C/p57 expression by post-transcriptional gene silencing to promote CRC occurrence and progress, therefore serving as a potential therapeutic target for the prevention and treatment of CRC.
LinkOut: [PMID: 21278784]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
252 hsa-miR-221-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000137 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 6 24
MIRT000140 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 2
MIRT000141 BMF Bcl2 modifying factor 4 1
MIRT000434 FOXO3 forkhead box O3 4 1
MIRT001780 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 5 12
MIRT001971 HOXB5 homeobox B5 1 1
MIRT002272 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 5 5
MIRT002335 TMED7 transmembrane emp24 protein transport domain containing 7 4 9
MIRT003358 DDIT4 DNA-damage-inducible transcript 4 6 2
MIRT003359 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 5 1
MIRT003360 TBK1 TANK-binding kinase 1 4 1
MIRT003361 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 2 1
MIRT003362 DKK2 dickkopf homolog 2 (Xenopus laevis) 2 1
MIRT003363 CREBZF CREB/ATF bZIP transcription factor 2 1
MIRT003364 BRAP BRCA1 associated protein 2 1
MIRT003365 USP18 ubiquitin specific peptidase 18 2 1
MIRT003366 ARIH2 ariadne homolog 2 (Drosophila) 2 1
MIRT003367 BBC3 BCL2 binding component 3 4 3
MIRT003368 HMGXB4 HMG box domain containing 4 2 1
MIRT003452 TIMP3 TIMP metallopeptidase inhibitor 3 3 4
MIRT003757 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 2 1
MIRT004430 ICAM1 intercellular adhesion molecule 1 3 2
MIRT004484 FOS FBJ murine osteosarcoma viral oncogene homolog 4 2
MIRT004753 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 5 1
MIRT005295 NAIP NLR family, apoptosis inhibitory protein 2 1
MIRT005320 ESR1 estrogen receptor 1 4 1
MIRT005475 TICAM1 toll-like receptor adaptor molecule 1 4 1
MIRT005585 PTEN phosphatase and tensin homolog 4 3
MIRT005714 SELE selectin E 1 1
MIRT005785 TP53 tumor protein p53 1 1
MIRT005787 CORO1A coronin, actin binding protein, 1A 2 2
MIRT005789 TCEAL1 transcription elongation factor A (SII)-like 1 1 1
MIRT006018 DIRAS3 DIRAS family, GTP-binding RAS-like 3 3 1
MIRT006063 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT006376 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006841 TRPS1 trichorhinophalangeal syndrome I 4 1
MIRT006917 CERS2 LAG1 homolog, ceramide synthase 2 3 1
MIRT007377 FMR1 fragile X mental retardation 1 1 1
MIRT024137 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT024138 ABHD3 abhydrolase domain containing 3 1 1
MIRT024139 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT024140 SPTSSA chromosome 14 open reading frame 147 1 1
MIRT024141 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 1
MIRT024142 NR2C2AP nuclear receptor 2C2-associated protein 1 1
MIRT024143 APOL2 apolipoprotein L, 2 1 1
MIRT024144 TDRP chromosome 8 open reading frame 42 1 1
MIRT024145 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT024146 TMEM168 transmembrane protein 168 1 1
MIRT024147 TUB tubby homolog (mouse) 1 1
MIRT024148 ZNF652 zinc finger protein 652 1 1
MIRT024149 DVL2 dishevelled, dsh homolog 2 (Drosophila) 2 1
MIRT024150 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT024151 TNIP1 TNFAIP3 interacting protein 1 1 1
MIRT024152 KLF9 Kruppel-like factor 9 1 1
MIRT024153 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT024154 TMEM64 transmembrane protein 64 1 1
MIRT024155 GID8 chromosome 20 open reading frame 11 1 1
MIRT024156 ZNF571 zinc finger protein 571 1 1
MIRT024157 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT024158 ATL2 atlastin GTPase 2 1 1
MIRT024159 E2F3 E2F transcription factor 3 1 1
MIRT024160 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT024161 CXorf38 chromosome X open reading frame 38 1 1
MIRT024162 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT024163 NHSL1 NHS-like 1 1 1
MIRT024164 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 1
MIRT024165 WDR61 WD repeat domain 61 1 1
MIRT024166 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 1
MIRT024167 SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1 1
MIRT024168 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT024169 RNF20 ring finger protein 20 1 1
MIRT024170 PHF12 PHD finger protein 12 1 1
MIRT024171 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT024172 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT024173 LYSMD1 LysM, putative peptidoglycan-binding, domain containing 1 1 1
MIRT024174 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT024175 TIPARP TCDD-inducible poly(ADP-ribose) polymerase 1 1
MIRT024176 GPR107 G protein-coupled receptor 107 1 1
MIRT024177 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT024178 STAMBP STAM binding protein 1 1
MIRT024179 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT024180 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT024181 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT024182 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT024183 RNF4 ring finger protein 4 1 1
MIRT024184 ASXL3 additional sex combs like 3 (Drosophila) 1 1
MIRT024185 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT024186 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT024187 RNF44 ring finger protein 44 1 1
MIRT024188 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT024189 ZNF275 zinc finger protein 275 1 1
MIRT024190 TMEM132B transmembrane protein 132B 1 1
MIRT024191 CCSAP chromosome 1 open reading frame 96 1 1
MIRT024192 BRD1 bromodomain containing 1 1 1
MIRT024193 AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 1 1
MIRT024194 FBXO28 F-box protein 28 1 1
MIRT024195 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT024196 PANK3 pantothenate kinase 3 1 1
MIRT024197 ZKSCAN8 zinc finger protein 192 1 1
MIRT024198 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT024199 UBE2J1 ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) 1 1
MIRT024200 MIDN midnolin 1 1
MIRT024201 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT024202 ATXN1 ataxin 1 1 2
MIRT024203 POGZ pogo transposable element with ZNF domain 1 1
MIRT024204 PPP1R15B protein phosphatase 1, regulatory (inhibitor) subunit 15B 1 1
MIRT024205 HECTD2 HECT domain containing 2 1 1
MIRT024206 POU3F2 POU class 3 homeobox 2 1 1
MIRT024207 HOXC10 homeobox C10 1 1
MIRT024208 MEOX2 mesenchyme homeobox 2 2 1
MIRT024209 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT046837 RUNDC3B RUN domain containing 3B 1 1
MIRT046838 TRAF4 TNF receptor-associated factor 4 1 1
MIRT046839 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT046840 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT046841 RBM33 RNA binding motif protein 33 1 1
MIRT046842 CROT carnitine O-octanoyltransferase 1 1
MIRT046843 ACTB actin, beta 1 1
MIRT046844 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT046845 USP28 ubiquitin specific peptidase 28 1 1
MIRT046846 PALB2 partner and localizer of BRCA2 1 1
MIRT046847 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT046848 YY1 YY1 transcription factor 1 1
MIRT046849 PLP2 proteolipid protein 2 (colonic epithelium-enriched) 1 1
MIRT046850 PXN paxillin 1 1
MIRT046851 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT046852 RPS24 ribosomal protein S24 1 1
MIRT046853 TSN translin 1 1
MIRT046854 HIST1H3D histone cluster 1, H3d 1 1
MIRT046855 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT046856 PSMD4 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 1 1
MIRT046857 PELO pelota homolog (Drosophila) 1 1
MIRT046859 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT046860 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT046861 HIST2H3D histone cluster 2, H3d 1 1
MIRT046862 MTSS1L metastasis suppressor 1-like 1 1
MIRT046863 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046864 NOP58 NOP58 ribonucleoprotein homolog (yeast) 1 1
MIRT046865 TUBA1C tubulin, alpha 1c 1 1
MIRT046866 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT046867 TMEM248 chromosome 7 open reading frame 42 1 1
MIRT046868 RAB5C RAB5C, member RAS oncogene family 1 1
MIRT046869 RPL15 ribosomal protein L15 1 1
MIRT046870 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT046871 LPHN2 latrophilin 2 1 1
MIRT046872 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT046873 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT046874 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT046875 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT046876 B4GALT2 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 1 1
MIRT046877 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT046878 PEX19 peroxisomal biogenesis factor 19 1 1
MIRT046879 PITPNM1 phosphatidylinositol transfer protein, membrane-associated 1 1 1
MIRT046880 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT046881 KIF16B kinesin family member 16B 1 1
MIRT046882 SEPHS1 selenophosphate synthetase 1 1 1
MIRT046883 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT046884 SF1 splicing factor 1 1 1
MIRT046885 RHOA ras homolog gene family, member A 1 1
MIRT046886 RBM39 RNA binding motif protein 39 1 1
MIRT046887 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT046888 FLNA filamin A, alpha 1 1
MIRT046889 CCDC142 coiled-coil domain containing 142 1 1
MIRT046890 ZYX zyxin 1 1
MIRT046891 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT046892 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT046893 MDFIC MyoD family inhibitor domain containing 1 1
MIRT046894 NME2 non-metastatic cells 2, protein (NM23B) expressed in 1 1
MIRT046895 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT046896 UBC ubiquitin C 1 1
MIRT046897 UQCR10 ubiquinol-cytochrome c reductase, complex III subunit X 1 1
MIRT046898 ADD1 adducin 1 (alpha) 1 1
MIRT046899 HECTD1 HECT domain containing 1 1 1
MIRT046900 FUS fused in sarcoma 1 1
MIRT046901 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT046902 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT046903 RPL21 ribosomal protein L21 1 1
MIRT046904 WDR34 WD repeat domain 34 1 1
MIRT046905 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT046906 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT046907 AP3B1 adaptor-related protein complex 3, beta 1 subunit 1 1
MIRT046908 EVL Enah/Vasp-like 1 1
MIRT046909 NCL nucleolin 1 1
MIRT046910 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT046911 PEG10 paternally expressed 10 1 1
MIRT046912 ANKRD28 ankyrin repeat domain 28 1 1
MIRT046913 TMEM183A transmembrane protein 183A 1 1
MIRT046914 LDHB lactate dehydrogenase B 1 1
MIRT046915 TRIM28 tripartite motif-containing 28 1 1
MIRT046916 NUP210 nucleoporin 210kDa 1 1
MIRT046917 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT046918 PEX1 peroxisomal biogenesis factor 1 1 1
MIRT046919 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT046920 SRP68 signal recognition particle 68kDa 1 1
MIRT046921 NUF2 NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT046922 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT046923 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT046924 CLIC1 chloride intracellular channel 1 1 1
MIRT046925 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT046926 NFYC nuclear transcription factor Y, gamma 1 1
MIRT046927 PHF21A PHD finger protein 21A 1 1
MIRT046928 TSC22D2 TSC22 domain family, member 2 1 1
MIRT046929 PKM pyruvate kinase, muscle 1 1
MIRT046930 CENPT centromere protein T 1 1
MIRT046931 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT046932 LAMTOR5 hepatitis B virus x interacting protein 1 1
MIRT046933 MIEN1 chromosome 17 open reading frame 37 1 1
MIRT046934 RPS7 ribosomal protein S7 1 1
MIRT046935 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT046936 IQCE IQ motif containing E 1 1
MIRT046937 RPLP0 ribosomal protein, large, P0 1 1
MIRT046938 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT046939 CDC25C cell division cycle 25 homolog C (S. pombe) 1 1
MIRT046940 TOB2 transducer of ERBB2, 2 1 1
MIRT046941 MBNL1 muscleblind-like (Drosophila) 1 1
MIRT046942 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT046943 SPAG5 sperm associated antigen 5 1 1
MIRT046944 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT046945 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT046946 SAPCD2 chromosome 9 open reading frame 140 1 1
MIRT046947 NFYA nuclear transcription factor Y, alpha 1 1
MIRT046948 KHSRP KH-type splicing regulatory protein 1 1
MIRT046949 AMOT angiomotin 1 1
MIRT046950 POLG polymerase (DNA directed), gamma 1 1
MIRT046951 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT046952 FBN3 fibrillin 3 1 1
MIRT046953 SPRYD3 SPRY domain containing 3 1 1
MIRT046954 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT046955 BAG3 BCL2-associated athanogene 3 1 1
MIRT046956 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT046957 PRDM16 PR domain containing 16 1 1
MIRT046958 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT046959 UNC13B unc-13 homolog B (C. elegans) 1 1
MIRT046960 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT046961 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046962 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT046963 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT046964 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT046965 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT046966 RBM6 RNA binding motif protein 6 1 1
MIRT046967 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT046968 CNRIP1 cannabinoid receptor interacting protein 1 1 1
MIRT046969 NUP205 nucleoporin 205kDa 1 1
MIRT046970 DENR density-regulated protein 1 1
MIRT046971 ACTG1 actin, gamma 1 1 1
MIRT046972 ZNF35 zinc finger protein 35 1 1
MIRT046973 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT046974 NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 1 1
MIRT046975 CABYR calcium binding tyrosine-(Y)-phosphorylation regulated 1 1
MIRT046976 MFN2 mitofusin 2 1 1
MIRT046977 ARHGAP42 Rho GTPase activating protein 42 1 1
MIRT046978 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1