Accession ID: MIRT002298 [miRNA, hsa-miR-34a-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34aLinkOut: [miRBase ]
Description Homo sapiens miR-34a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34a-5p
Mature Sequence 22| UGGCAGUGUCUUAGCUGGUUGU |43
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0006   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_0006|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUUGGUCGAUUCUGUGACGGu 5'
            ||:||||| |  :|||||| 
Target 5' cgAATCAGCT-ATTTACTGCCa 3'
192 - 212 151.00 -23.50
2
miRNA  3' uguuggUCGAUUCU----GUGACGGu 5'
                |||| |||    |||||:| 
Target 5' tgatggAGCTCAGAATTCCACTGTCa 3'
1095 - 1120 142.00 -15.80
3
miRNA  3' uguuggucgaUUC--UGUGACGGu 5'
                    |||  |||:|||| 
Target 5' ttgttggaaaAAGTCACATTGCCa 3'
5195 - 5218 134.00 -12.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Chang, T. C. Wentzel, E. A. Kent, O. A. et al.
- Mol Cell, 2007
The p53 tumor suppressor protein is a critical regulator of the cellular response to cancer-initiating insults such as genotoxic stress. In this report, we demonstrate that microRNAs (miRNAs) are important components of the p53 transcriptional network. Global miRNA expression analyses identified a cohort of miRNAs that exhibit p53-dependent upregulation following DNA damage. One such miRNA, miR-34a, is commonly deleted in human cancers and, as shown here, frequently absent in pancreatic cancer cells. Characterization of the miR-34a primary transcript and promoter demonstrates that this miRNA is directly transactivated by p53. Expression of miR-34a causes dramatic reprogramming of gene expression and promotes apoptosis. Much like the known set of p53-regulated genes, miR-34a-responsive genes are highly enriched for those that regulate cell-cycle progression, apoptosis, DNA repair, and angiogenesis. Therefore, it is likely that an important function of miR-34a is the modulation and fine-tuning of the gene expression program initiated by p53.
LinkOut: [PMID: 17540599]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , Western blot , Other
Conditions SW480 , Wi38
Location of target site 3'UTR
Tools used in this research RNA22
Original Description (Extracted from the article) ... The fact that the loss of miRNA34a expression induces a phenotype despite intact miRNA34bc function might be explained by the overall lower miRNA34b and miRNA34c levels in the cell lines. ...

- Bommer, G. T. Gerin, I. Feng, Y. et al., 2007, Curr Biol.

Article - Bommer, G. T. Gerin, I. Feng, Y. et al.
- Curr Biol, 2007
BACKGROUND: In response to varied cell stress signals, the p53 tumor-suppressor protein activates a multitude of genes encoding proteins with functions in cell-cycle control, DNA repair, senescence, and apoptosis. The role of p53 in transcription of other types of RNAs, such as microRNAs (miRNAs) is essentially unknown. RESULTS: Using gene-expression analyses, reporter gene assays, and chromatin-immunoprecipitation approaches, we present definitive evidence that the abundance of the three-member miRNA34 family is directly regulated by p53 in cell lines and tissues. Using array-based approaches and algorithm predictions, we define genes likely to be directly regulated by miRNA34, with cell-cycle regulatory genes being the most prominent class. In addition, we provide functional evidence, obtained via antisense oligonucleotide transfection and the use of mouse embryonic stem cells with loss of miRNA34a function, that the BCL2 protein is regulated directly by miRNA34. Finally, we demonstrate that the expression of two miRNA34s is dramatically reduced in 6 of 14 (43%) non-small cell lung cancers (NSCLCs) and that the restoration of miRNA34 expression inhibits growth of NSCLC cells. CONCLUSIONS: Taken together, the data suggest the miRNA34s might be key effectors of p53 tumor-suppressor function, and their inactivation might contribute to certain cancers.
LinkOut: [PMID: 17656095]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Microarray
Conditions HCT116 , H1299 , U2OS , MCF-7
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-34 seed regions, and several individual genes, including CDK4, CDK6, cyclin E2 and E2F3 have been experimentally validated as miR-34 targets by western blotting. ...

- He, L. He, X. Lowe, S. W. Hannon, G. J., 2007, Nat Rev Cancer.

Article - He, L. He, X. Lowe, S. W. Hannon, G. J.
- Nat Rev Cancer, 2007
Several recent studies have found a conserved microRNA (miRNA) family, the miR-34s, to be direct transcriptional targets of p53. miR-34 activation can recapitulate elements of p53 activity, including induction of cell-cycle arrest and promotion of apoptosis, and loss of miR-34 can impair p53-mediated cell death. These data reinforce the growing awareness that non-coding RNAs are key players in tumour development by placing miRNAs in a central role in a well-known tumour-suppressor network.
LinkOut: [PMID: 17914404]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Luciferase reporter assay , Other
Tools used in this research DIANA-microT , miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... This suggests that in some neuroblastoma cell lines, the effect of miR-34a–mediated BCL2 protein inhibition may also be in part mediated by an effect on BCL2 mRNA.We were able to confirm that the computationally predicted miR-34a target neuroblastoma oncogene MYCN also had decreased protein expression after miR-34a transfection ...

- Cole, K. A. Attiyeh, E. F. Mosse, Y. P. et al., 2008, Mol Cancer Res.

Article - Cole, K. A. Attiyeh, E. F. Mosse, Y. P. et al.
- Mol Cancer Res, 2008
MicroRNAs are small noncoding RNAs that have critical roles in regulating a number of cellular functions through transcriptional silencing. They have been implicated as oncogenes and tumor suppressor genes (oncomirs) in several human neoplasms. We used an integrated genomics and functional screening strategy to identify potential oncomirs in the pediatric neoplasm neuroblastoma. We first identified microRNAs that map within chromosomal regions that we and others have defined as frequently deleted (1p36, 3p22, and 11q23-24) or gained (17q23) in high-risk neuroblastoma. We then transiently transfected microRNA precursor mimics or inhibitors into a panel of six neuroblastoma cell lines that we characterized for these genomic aberrations. The majority of transfections showed no phenotypic effect, but the miR-34a (1p36) and miR-34c (11q23) mimics showed dramatic growth inhibition in cell lines with 1p36 hemizygous deletion. In contrast, there was no growth inhibition by these mimics in cell lines without 1p36 deletions. Quantitative reverse transcription-PCR showed a perfect correlation of absent miR-34a expression in cell lines with a 1p36 aberration and phenotypic effect after mimetic add-back. Expression of miR-34a was also decreased in primary tumors (n = 54) with 1p36 deletion (P = 0.009), but no mutations were discovered in resequencing of the miR-34a locus in 30 neuroblastoma cell lines. Flow cytometric time series analyses showed that the likely mechanism of miR-34a growth inhibition is through cell cycle arrest followed by apoptosis. BCL2 and MYCN were identified as miR-34a targets and likely mediators of the tumor suppressor phenotypic effect. These data support miR-34a as a tumor suppressor gene in human neuroblastoma.
LinkOut: [PMID: 18505919]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions KATO-III
Location of target site 3'UTR
Tools used in this research Literature survey
Article - Ji, Q. Hao, X. Meng, Y. Zhang, M. Desano, et al.
- BMC Cancer, 2008
BACKGROUND: MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. METHODS: Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. RESULTS: Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. CONCLUSION: Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. The mechanism of miR-34-mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer.
LinkOut: [PMID: 18803879]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Fujita, Y. Kojima, K. Hamada, N. Ohhashi, et al.
- Biochem Biophys Res Commun, 2008
Tumor suppressor p53 transcriptionally regulates expression of microRNA-34a, which confers translational inhibition and mRNA degradation of genes involved in cell cycle control and apoptosis. In various cancers, miR-34a expression is lost or reduced. Here, we investigated the role of miR-34a in prostate cancer cell lines. MiR-34a expression was markedly reduced in p53-null PC3 cells and p53-mutated DU145 cells compared with LNCaP cells expressing wild-type p53. In PC3 cell, ectopic expression of miR-34a decreased the SIRT1 mRNA and protein levels as well as protein levels of known direct target genes. Reporter assays revealed that miR-34a-induced SIRT1 inhibition occurred at the transcriptional but not post-transcriptional level despite the presence of a potential miR-34a binding site within its 3'-UTR. Ectopic miR-34a expression resulted in cell cycle arrest and growth inhibition and attenuated chemoresistance to anticancer drug camptothecin by inducing apoptosis, suggesting a potential role of miR-34a for the treatment of p53-defective prostate cancer.
LinkOut: [PMID: 18834855]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... b Listed are genes that are presumably inhibited by miR-34 at the translational level. This was shown by co-expression of miR-34 and reporter constructs containing the target 30-UTR with the indicated wild-type miR-34-binding site(s) or mutant versions and subsequent luciferase reporter assays. ...

- Hermeking, H., 2010, Cell Death Differ.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ugUUGGUCGAUUCUGUGACGGu 5'
            ||:||||| |  :|||||| 
Target 5' cgAAUCAGCU-AUUUACUGCCa 3'
2 - 22
Article - Hermeking, H.
- Cell Death Differ, 2010
Recently, the transcription factor encoded by tumor suppressor gene p53 was shown to regulate the expression of microRNAs. The most significant induction by p53 was observed for the microRNAs miR-34a and miR-34b/c, which turned out to be direct p53 target genes. Ectopic miR-34 expression induces apoptosis, cell-cycle arrest or senescence. In many tumor types the promoters of the miR-34a and the miR-34b/c genes are subject to inactivation by CpG methylation. MiR-34a resides on 1p36 and is commonly deleted in neuroblastomas. Furthermore, the loss of miR-34 expression has been linked to resistance against apoptosis induced by p53 activating agents used in chemotherapy. In this review, the evidence for a role of miR-34a and miR-34b/c in the apoptotic response of normal and tumor cells is surveyed.
LinkOut: [PMID: 19461653]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other , Reporter assay;Western blot;qRT-PCR;Other
Conditions SH-SY5Y , HEK293T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... The luciferase activity assays at 48 h post-transfection showed that the over-expression of miR-34a produced a 52% decrease in luciferase expression, measured as relative luciferase activity, compared to controls (Fig. 3).//A Western blot performed on the same cells showed that bcl2 protein was clearly reduced (49%) in the stable transfection cell line of miR-34a, as compared to cells transfected with the control vector (Fig. 4B and C). ...

- Wang, X. Liu, P. Zhu, H. Xu, Y. Ma, C. Dai, et al., 2009, Brain Res Bull.

Article - Wang, X. Liu, P. Zhu, H. Xu, Y. Ma, C. Dai, et al.
- Brain Res Bull, 2009
MicroRNAs (miRNAs) are short noncoding regulatory RNA molecules that modulate protein expression by inhibiting mRNA translation or promoting mRNA degradation. However, little is understood about the roles of miRNAs in Alzheimer's disease. During a research for miRNAs that are differentially expressed in cerebral cortex of APPswe/PSDeltaE9 mice (a model for Alzheimer's disease) and age-matched controls, one candidate miRNA that is relatively highly expressed, miR-34a, was studied further because sequence analysis suggested a likely interaction with the 3'- untranslated region of bcl2 mRNA. We show that the expression of miR-34a is inversely correlated with the protein level of bcl2 in APPswe/PSDeltaE9 mice and age-matched controls, and miR-34a expression directly inhibits bcl2 translation in SH-SY5Y cells. No effect on bcl2 mRNA level was observed. Western blot analysis of active caspase-3 showed higher levels in APPswe/PSDeltaE9 mice and stable transfecant cell line of miR-34a than in controls. Consistently, miR-34a knockdown through antisense LNA oligonucleotides increased the level of bcl2 protein in SH-SY5Y cells, which was accompanied by a decrease of active caspase-3. These findings suggested that bcl2 is an important functional target for miR-34a, and the abnormal expression of miR-34a may contribute to the pathogenesis of Alzheimer's disease, at least in part by affecting the expression of bcl2.
LinkOut: [PMID: 19683563]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Wang, B. D. Kline, C. L. Pastor, D. M. et al.
- Mol Cancer, 2010
ABSTRACT: BACKGROUND: Diminished expression or activity of prostate apoptosis response protein 4 (Par-4) has been demonstrated in a number of cancers, although reports on Par-4 expression during colon cancer progression are lacking. An understanding of the molecular events in conjunction with the genetic networks affected by Par-4 is warranted. RESULTS: Colon cancer specimens derived from patients have significantly diminished expression of Par-4 mRNA relative to paired normal colon. Hence, the functional consequences of reintroducing Par-4 into HT29 colon cancer cells were assessed. Overexpression augmented the interaction of Par-4 with NFkappaB in the cytosol but not nucleus, and facilitated apoptosis in the presence of 5-fluorouracil (5-FU). Analogous findings were obtained when AKT1 pro-survival signaling was inhibited. Transcriptome profiling identified ~700 genes differentially regulated by Par-4 overexpression in HT29 cells. Nearly all Par-4-regulated genes were shown by promoter analysis to contain cis-binding sequences for NFkappaB, and meta-analysis of patient expression data revealed that one-third of these genes exist as a recurrent co-regulated network in colon cancer specimens. Sets of genes involved in programmed cell death, cell cycle regulation and interestingly the microRNA pathway were found overrepresented in the network. Noteworthy, Par-4 overexpression decreased NFkappaB occupancy at the promoter of one particular network gene DROSHA, encoding a microRNA processing enzyme. The resulting down-regulation of DROSHA was associated with expression changes in a cohort of microRNAs. Many of these microRNAs are predicted to target mRNAs encoding proteins with apoptosis-related functions. Western and functional analyses were employed to validate several predictions. For instance, miR-34a up-regulation corresponded with a down-regulation of BCL2 protein. Treating Par-4-overexpressing HT29 cells with a miR-34a antagomir functionally reversed both BCL2 down-regulation and apoptosis by 5-FU. Conversely, bypassing Par-4 overexpression by direct knockdown of DROSHA expression in native HT29 cells increased miR-34a expression and 5-FU sensitivity. CONCLUSION: Our findings suggest that the initiation of apoptotic sensitivity in colon cancer cells can be mediated by Par-4 binding to NFkappaB in the cytoplasm with consequential changes in the expression of microRNA pathway components.
LinkOut: [PMID: 20433755]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Flow , Immunoblot , Luciferase reporter assay , Reporter assay
Conditions 293T , WEHI-231 , 70Z/3
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Foxp1 was a direct target of miR-34a in a 3'-untranslated region (UTR)-dependent fashion. Knockdown of Foxp1 by siRNA recapitulated the B cell developmental phenotype induced by miR-34a, whereas cotransduction of Foxp1 lacking its 3' UTR with miR-34a rescued B cell maturation.// As controls, we examined repression of a UTR containing two repeats of the anti- sense sequence to miR-34a (two repeats of antisense 22-mer), which showed the greatest repression (Figure 3B, antisense 2-mer), as well as repression of a BCL2-30 UTR containing construct, a previously reported miR-34a target (Figure 3B; BCL2 and BCL2mt; Bommer et al., 2007). ...

- Rao, D. S. O'Connell, R. M. Chaudhuri, A. et al., 2010, Immunity.

Article - Rao, D. S. O'Connell, R. M. Chaudhuri, A. et al.
- Immunity, 2010
MicroRNAs (miRNAs) can influence lineage choice or affect critical developmental checkpoints during hematopoiesis. We examined the role of the p53-induced microRNA miR-34a in hematopoiesis by gain-of-function analysis in murine bone marrow. Constitutive expression of miR-34a led to a block in B cell development at the pro-B-cell-to-pre-B-cell transition, leading to a reduction in mature B cells. This block appeared to be mediated primarily by inhibited expression of the transcription factor Foxp1. Foxp1 was a direct target of miR-34a in a 3'-untranslated region (UTR)-dependent fashion. Knockdown of Foxp1 by siRNA recapitulated the B cell developmental phenotype induced by miR-34a, whereas cotransduction of Foxp1 lacking its 3' UTR with miR-34a rescued B cell maturation. Knockdown of miR-34a resulted in increased amounts of Foxp1 and mature B cells. These findings identify a role for miR-34a in connecting the p53 network with suppression of Foxp1, a known B cell oncogene.
LinkOut: [PMID: 20598588]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Reporter assay;Other
Article - Kastl, L. Brown, I. Schofield, A. C.
- Breast Cancer Res Treat, 2012
Docetaxel is a chemotherapy drug to treat breast cancer, however as with many chemotherapeutic drugs resistance to docetaxel occurs in 50% of patients, and the underlying molecular mechanisms of drug resistance are not fully understood. Gene regulation through microRNAs (miRNA) has been shown to play an important role in cancer drug resistance. By directly targeting mRNA, miRNAs are able to inhibit genes that are necessary for signalling pathways or drug induced apoptosis rendering cells drug resistant. This study investigated the role of differential miRNA expression in two in vitro breast cancer cell line models (MCF-7, MDA-MB-231) of acquired docetaxel resistance. MiRNA microarray analysis identified 299 and 226 miRNAs altered in MCF-7 and MDA-MB-231 docetaxel-resistant cells, respectively. Docetaxel resistance was associated with increased expression of miR-34a and miR-141 and decreased expression of miR-7, miR-16, miR-30a, miR-125a-5p, miR-126. Computational target prediction revealed eight candidate genes targeted by these miRNAs. Quantitative PCR and western analysis confirmed decreased expression of two genes, BCL-2 and CCND1, in docetaxel-resistant cells, which are both targeted by miR-34a. Modulation of miR-34a expression was correlated with BCL-2 and cyclin D1 protein expression changes and a direct interaction of miR-34a with BCL-2 was shown by luciferase assay. Inhibition of miR-34a enhanced response to docetaxel in MCF-7 docetaxel-resistant cells, whereas overexpression of miR-34a conferred resistance in MCF-7 docetaxel-sensitive cells. This study is the first to show differences in miRNA expression, in particular, increased expression of miR-34a in an acquired model of docetaxel resistance in breast cancer. This serves as a mechanism of acquired docetaxel resistance in these cells, possibly through direct interactions with BCL-2 and CCND1, therefore presenting a potential therapeutic target for the treatment of docetaxel-resistant breast cancer.
LinkOut: [PMID: 21399894]
Experimental Support 12 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: BCL2    [ Functional MTI ]
Validation Method Proteomics
Article - Kaller, M. Liffers, S. T. Oeljeklaus, S. et al.
- Mol Cell Proteomics, 2011
The gene encoding the miR-34a microRNA is a transcriptional target of the p53 tumor suppressor protein and subject to epigenetic inactivation in colorectal cancer and numerous other tumor types. Here, we combined pulsed SILAC (pSILAC) and microarray analyses to identify miR-34a-induced changes in protein and mRNA expression. pSILAC allowed to quantify the de novo protein synthesis of 1206 proteins after activation of a conditional miR-34a allele in a colorectal cancer cell line. approximately 19% of the detected proteins were differentially regulated, with 113 proteins being down- and 115 up-regulated. The proteins with a miR-34a seed-matching-sequence in the 3'-untranslated region (UTR) of the corresponding mRNA showed a clear bias toward translational repression. Proteins involved in DNA replication, e.g. the MCM proteins, and cell proliferation, were over-represented among indirectly down-regulated proteins lacking a miR-34a seed-match. The decrease in de novo protein synthesis of direct miR-34a targets correlated with reduced levels of the corresponding mRNA in most cases, indicating an interdependence of both types of regulation. In addition, 43 mRNAs encoding proteins not detected by pSILAC were down-regulated after miR-34a expression and contained miR-34a seed-matches. The direct regulation of selected miR-34a target-mRNAs was confirmed using reporter assays. Via down-regulation of the proteins encoded by these mRNAs miR-34a presumably inhibits glycolysis (LDHA), WNT-signaling (LEF1), invasion/migration (AXL) and lipid metabolism (ACSL1, ACSL4). Furthermore, miR-34a may activate p53 by inhibiting its acetylation (MTA2, HDAC1) and degradation (YY1). In summary, miR-34a presumably participates in multiple tumor suppressive pathways by directly and indirectly suppressing the expression of numerous, critical proteins.
LinkOut: [PMID: 21566225]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
492 hsa-miR-34a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000071 BIRC3 baculoviral IAP repeat-containing 3 2 1
MIRT000073 GRM7 glutamate receptor, metabotropic 7 3 2
MIRT000074 JAG1 jagged 1 (Alagille syndrome) 5 2
MIRT000695 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 6 6
MIRT000720 MYB v-myb myeloblastosis viral oncogene homolog (avian) 4 2
MIRT000748 HMGA2 high mobility group AT-hook 2 2 2
MIRT000750 E2F5 E2F transcription factor 5, p130-binding 2 1
MIRT000751 CDC25C cell division cycle 25 homolog C (S. pombe) 2 1
MIRT000759 MET met proto-oncogene (hepatocyte growth factor receptor) 4 10
MIRT000763 CDK4 cyclin-dependent kinase 4 5 6
MIRT000768 CCNE2 cyclin E2 4 4
MIRT000980 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 4 7
MIRT001010 CCND3 cyclin D3 2 1
MIRT001011 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT001012 CDK6 cyclin-dependent kinase 6 5 8
MIRT001013 CCND1 cyclin D1 5 6
MIRT001231 WNT1 wingless-type MMTV integration site family, member 1 4 2
MIRT001232 AXIN2 axin 2 2 1
MIRT001756 E2F3 E2F transcription factor 3 5 10
MIRT001757 DLL1 delta-like 1 (Drosophila) 2 3
MIRT001758 VAMP2 vesicle-associated membrane protein 2 (synaptobrevin 2) 1 1
MIRT002098 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 4 11
MIRT002298 BCL2 B-cell CLL/lymphoma 2 5 13
MIRT002875 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 5 11
MIRT003148 E2f3 E2F transcription factor 3 3 1
MIRT003149 Mycn v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 3 1
MIRT003150 Sirt1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 3 1
MIRT003356 HNF4A hepatocyte nuclear factor 4, alpha 4 2
MIRT004045 YY1 YY1 transcription factor 3 2
MIRT004109 MAGEA12 melanoma antigen family A, 12 3 1
MIRT004110 MAGEA6 melanoma antigen family A, 6 4 1
MIRT004111 MAGEA3 melanoma antigen family A, 3 4 1
MIRT004112 MAGEA2 melanoma antigen family A, 2 4 1
MIRT004403 MDM4 Mdm4 p53 binding protein homolog (mouse) 2 1
MIRT004483 MAP2K1 mitogen-activated protein kinase kinase 1 4 1
MIRT004502 PEA15 phosphoprotein enriched in astrocytes 15 2 2
MIRT004513 VEGFA vascular endothelial growth factor A 2 1
MIRT004617 IFNB1 interferon, beta 1, fibroblast 3 1
MIRT004821 E2F1 E2F transcription factor 1 3 2
MIRT004905 TNFRSF6B tumor necrosis factor receptor superfamily, member 6b, decoy 2 1
MIRT005029 NOTCH2 Notch homolog 2 (Drosophila) 5 2
MIRT005075 EMP1 epithelial membrane protein 1 2 1
MIRT005480 CD44 CD44 molecule (Indian blood group) 4 1
MIRT005546 FOXP1 forkhead box P1 3 2
MIRT005606 MAP3K9 mitogen-activated protein kinase kinase kinase 9 4 1
MIRT005723 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 1 1
MIRT005724 SPI1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 1 1
MIRT005760 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 2 2
MIRT006212 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 3 1
MIRT006222 NANOG Nanog homeobox 2 1
MIRT006223 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006254 IMPA1 inositol(myo)-1(or 4)-monophosphatase 1 1 1
MIRT006255 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT006286 ULBP2 UL16 binding protein 2 2 1
MIRT006304 SYT1 synaptotagmin I 2 1
MIRT006305 STX1A syntaxin 1A (brain) 2 1
MIRT006546 FOSL1 FOS-like antigen 1 3 1
MIRT006576 EPHA5 EPH receptor A5 2 1
MIRT006664 AXL AXL receptor tyrosine kinase 4 2
MIRT006869 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT006874 KLB klotho beta 1 1
MIRT007112 TP53 tumor protein p53 1 1
MIRT007193 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT007204 BMP7 bone morphogenetic protein 7 1 1
MIRT025210 KIF4A kinesin family member 4A 1 1
MIRT025211 HIST1H2AB histone cluster 1, H2ab 1 1
MIRT025212 ATXN2L ataxin 2-like 1 2
MIRT025213 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT025214 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT025215 ACSL4 acyl-CoA synthetase long-chain family member 4 2 1
MIRT025216 HIST3H3 histone cluster 3, H3 1 1
MIRT025217 TNPO3 transportin 3 1 1
MIRT025218 HIST1H2BE histone cluster 1, H2be 1 1
MIRT025219 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT025220 STAM2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 1 1
MIRT025221 HIST1H3J histone cluster 1, H3j 1 1
MIRT025222 HIST2H3A histone cluster 2, H3a 1 1
MIRT025223 HIST1H4I histone cluster 1, H4i 1 1
MIRT025224 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT025225 CRYAA crystallin, alpha A 1 1
MIRT025226 RPIA ribose 5-phosphate isomerase A 1 1
MIRT025227 HIST1H4K histone cluster 1, H4k 1 1
MIRT025228 RNF40 ring finger protein 40 1 1
MIRT025229 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT025230 MST1 macrophage stimulating 1 (hepatocyte growth factor-like) 1 1
MIRT025231 CCNL1 cyclin L1 1 1
MIRT025232 MCM3 minichromosome maintenance complex component 3 1 1
MIRT025233 MTA2 metastasis associated 1 family, member 2 3 2
MIRT025234 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT025235 HIST2H4A histone cluster 2, H4a 1 1
MIRT025236 H1FX H1 histone family, member X 1 1
MIRT025237 KIF5B kinesin family member 5B 1 1
MIRT025238 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT025239 HIST2H2AB histone cluster 2, H2ab 1 1
MIRT025240 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT025241 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT025242 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT025243 TOMM40 translocase of outer mitochondrial membrane 40 homolog (yeast) 1 1
MIRT025244 WBP11 WW domain binding protein 11 1 1
MIRT025245 MAP1B microtubule-associated protein 1B 1 1
MIRT025246 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT025247 SETD3 SET domain containing 3 1 1
MIRT025248 PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 1 1
MIRT025249 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT025250 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT025251 DSP desmoplakin 1 1
MIRT025252 HIST1H4A histone cluster 1, H4a 1 1
MIRT025253 HIST1H2BO histone cluster 1, H2bo 1 1
MIRT025254 DHCR7 7-dehydrocholesterol reductase 1 1
MIRT025255 GRB2 growth factor receptor-bound protein 2 1 1
MIRT025256 LRRC40 leucine rich repeat containing 40 1 1
MIRT025257 GAS1 growth arrest-specific 1 1 1
MIRT025258 MTDH metadherin 1 1
MIRT025259 RRAS related RAS viral (r-ras) oncogene homolog 1 1
MIRT025260 SPTAN1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 1 1
MIRT025261 RALB v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) 1 1
MIRT025262 BAG6 HLA-B associated transcript 3 1 1
MIRT025263 BCLAF1 BCL2-associated transcription factor 1 1 1
MIRT025264 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT025265 ARF6 ADP-ribosylation factor 6 1 1
MIRT025266 RBM26 RNA binding motif protein 26 1 1
MIRT025267 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT025268 UHRF1 ubiquitin-like with PHD and ring finger domains 1 2 2
MIRT025269 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT025270 RRM2 ribonucleotide reductase M2 1 1
MIRT025271 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT025272 DDX56 DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 1 1
MIRT025273 HIST1H2BB histone cluster 1, H2bb 1 1
MIRT025274 NUPL2 nucleoporin like 2 1 1
MIRT025275 WASF2 WAS protein family, member 2 1 1
MIRT025276 HIST3H2BB histone cluster 3, H2bb 1 1
MIRT025277 AHNAK AHNAK nucleoprotein 1 1
MIRT025278 STAT1 signal transducer and activator of transcription 1, 91kDa 1 1
MIRT025279 HIST1H4L histone cluster 1, H4l 1 1
MIRT025280 ARHGAP1 Rho GTPase activating protein 1 2 2
MIRT025281 ERLIN2 ER lipid raft associated 2 1 1
MIRT025282 HIST1H4D histone cluster 1, H4d 1 1
MIRT025283 CXCL9 chemokine (C-X-C motif) ligand 9 1 1
MIRT025284 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT025285 HIST1H1B histone cluster 1, H1b 1 1
MIRT025286 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT025287 HIST1H3G histone cluster 1, H3g 1 1
MIRT025288 AIMP2 aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 1 1
MIRT025289 EFNB1 ephrin-B1 1 1
MIRT025290 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT025291 ITGA6 integrin, alpha 6 1 1
MIRT025293 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT025294 ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like 1 1
MIRT025295 KIF11 kinesin family member 11 1 1
MIRT025296 EHD1 EH-domain containing 1 1 1
MIRT025297 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT025298 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 1 1
MIRT025299 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT025300 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT025301 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT025302 HSPA1A heat shock 70kDa protein 1A 1 1
MIRT025303 HIST1H1E histone cluster 1, H1e 1 1
MIRT025304 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT025305 IMP3 IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT025306 CLTB clathrin, light chain B 1 1
MIRT025307 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT025309 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT025310 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT025311 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT025312 RBM12 RNA binding motif protein 12 1 1
MIRT025313 TSN translin 1 1
MIRT025314 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT025315 SNX12 sorting nexin 12 1 1
MIRT025316 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT025317 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT025318 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT025319 MTAP methylthioadenosine phosphorylase 2 2
MIRT025320 HIBADH 3-hydroxyisobutyrate dehydrogenase 1 1
MIRT025321 CALD1 caldesmon 1 1 1
MIRT025322 MCM4 minichromosome maintenance complex component 4 1 1
MIRT025324 HIST1H3E histone cluster 1, H3e 1 1
MIRT025325 BTF3L4 basic transcription factor 3-like 4 1 1
MIRT025326 ZSWIM7 zinc finger, SWIM-type containing 7 1 1
MIRT025327 THOC2 THO complex 2 1 1
MIRT025328 ECD ecdysoneless homolog (Drosophila) 1 1
MIRT025329 HIST1H4J histone cluster 1, H4j 1 1
MIRT025330 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT025331 ANXA4 annexin A4 1 1
MIRT025332 STAG2 stromal antigen 2 1 1
MIRT025333 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT025334 CFL1 cofilin 1 (non-muscle) 1 1
MIRT025335 KIF2C kinesin family member 2C 1 1
MIRT025336 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 1 1
MIRT025337 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT025338 CAPRIN1 cell cycle associated protein 1 1 1
MIRT025339 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT025340 EPS8L2 EPS8-like 2 1 1
MIRT025341 CAPN1 calpain 1, (mu/I) large subunit 1 1
MIRT025342 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT025343 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT025344 ZFR zinc finger RNA binding protein 1 1
MIRT025345 GDI1 GDP dissociation inhibitor 1 1 1
MIRT025346 IRGQ immunity-related GTPase family, Q 1 1
MIRT025347 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT025348 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 1
MIRT025349 HIST1H2AL histone cluster 1, H2al 1 1
MIRT025350 KIF2A kinesin heavy chain member 2A 1 1
MIRT025351 AKR1A1 aldo-keto reductase family 1, member A1 (aldehyde reductase) 1 1
MIRT025352 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT025353 HIST1H4C histone cluster 1, H4c 1 1
MIRT025354 HIST1H4F histone cluster 1, H4f 1 1
MIRT025355 APOL2 apolipoprotein L, 2 1 1
MIRT025356 TJP2 tight junction protein 2 (zona occludens 2) 1 1
MIRT025357 NSUN5 NOP2/Sun domain family, member 5 1 1
MIRT025358 HDLBP high density lipoprotein binding protein 1 1
MIRT025359 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT025360 PYGB phosphorylase, glycogen; brain 1 1
MIRT025361 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT025362 QDPR quinoid dihydropteridine reductase 1 1
MIRT025363 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT025364 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT025365 UBAP2 ubiquitin associated protein 2 1 1
MIRT025366 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT025367 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT025368 CYB5B cytochrome b5 type B (outer mitochondrial membrane) 1 1
MIRT025369 PLCG1 phospholipase C, gamma 1 1 1
MIRT025370 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT025371 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT025372 PUM2 pumilio homolog 2 (Drosophila) 1 1
MIRT025373 B4GALT3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 1 1
MIRT025374 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT025375 TNRC18 trinucleotide repeat containing 18 1 1
MIRT025376 TSPAN14 tetraspanin 14 1 1
MIRT025377 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT025378 ZNF644 zinc finger protein 644 1 1
MIRT025379 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT025380 LEF1 lymphoid enhancer-binding factor 1 2 1
MIRT025381 ACSL1 acyl-CoA synthetase long-chain family member 1 2 1
MIRT025382 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT025383 ERLIN1 ER lipid raft associated 1 2 2
MIRT025384 PLIN3 perilipin 3 1 1
MIRT025385 CPT2 carnitine palmitoyltransferase 2 1 2
MIRT025386 MCMBP chromosome 10 open reading frame 119 1 1
MIRT025387 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT025388 HIST1H2AA histone cluster 1, H2aa 1 1
MIRT025389 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT025390 DHX38 DEAH (Asp-Glu-Ala-His) box polypeptide 38 1 1
MIRT025391 CDKN2AIP CDKN2A interacting protein 1 1
MIRT025392 RBCK1 RanBP-type and C3HC4-type zinc finger containing 1 1 1
MIRT025393 AKR7L aldo-keto reductase family 7-like 1 1
MIRT025394 C12orf5 chromosome 12 open reading frame 5 1 1
MIRT025395 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1 1
MIRT025396 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 1 1
MIRT025397 HIST2H4B histone cluster 2, H4b 2 2
MIRT025398 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT025399 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT025400 MCM2 minichromosome maintenance complex component 2 1 1
MIRT025401 H3F3A H3 histone, family 3A 2 2
MIRT025402 HIST1H1D histone cluster 1, H1d 1 1
MIRT025403 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT025404 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT025405 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT025406 HIST1H3I histone cluster 1, H3i 1 1
MIRT025407 HIST1H4E histone cluster 1, H4e 1 1
MIRT025408 SERPINB1 serpin peptidase inhibitor, clade B (ovalbumin), member 1 1 1
MIRT025409 NDRG1 N-myc downstream regulated 1 1 1
MIRT025410 HIST1H3H histone cluster 1, H3h 1 1
MIRT025411 UBQLN2 ubiquilin 2 1 1
MIRT025412 AFAP1L2 actin filament associated protein 1-like 2 1 1
MIRT025413 PUS7 pseudouridylate synthase 7 homolog (S. cerevisiae) 1 1
MIRT025414 CDC20 cell division cycle 20 homolog (S. cerevisiae) 2 2
MIRT025415 HIST2H2BE histone cluster 2, H2be 1 1
MIRT025416 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT025417 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT025418 POP1 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT025419 FAM3C family with sequence similarity 3, member C 1 1
MIRT025420 EPHA2 EPH receptor A2 1 1
MIRT025421 ADNP activity-dependent neuroprotector homeobox 1 1
MIRT025422 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT025423 HIST1H4H histone cluster 1, H4h 1 1
MIRT025424 SURF4 surfeit 4 1 2
MIRT025425 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025426 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT025427 FIGN fidgetin 1 1
MIRT025428 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT025429 TPPP tubulin polymerization promoting protein 1 1
MIRT025430 FAM76A family with sequence similarity 76, member A 1 2
MIRT025431 LDHA lactate dehydrogenase A 2 1
MIRT025432 RSU1 Ras suppressor protein 1 1 1
MIRT025433 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT025434 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT025435 TMOD2 tropomodulin 2 (neuronal) 1 1
MIRT025436 SEPT1 septin 1 1 1
MIRT025437 GIGYF2 GRB10 interacting GYF protein 2 1 1
MIRT025438 H3F3AP6 H3 histone pseudogene 1 1
MIRT025439 KLC1 kinesin light chain 1 1 1
MIRT025440 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT025441 HIST1H2AG histone cluster 1, H2ag 1 1
MIRT025442 PPP6R3 SAPS domain family, member 3 1 1
MIRT025443 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 1 1
MIRT025444 UBE3C ubiquitin protein ligase E3C 1 1
MIRT025445 GFPT1 glutamine--fructose-6-phosphate transaminase 1 1 1
MIRT025446 HIST1H2AK histone cluster 1, H2ak 1 1
MIRT025447 TXNRD1 thioredoxin reductase 1 1 1
MIRT025448 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT025449 HIST1H3D histone cluster 1, H3d 1 1
MIRT025450 TFRC transferrin receptor (p90, CD71) 1 1
MIRT025451 HIST1H3C histone cluster 1, H3c 1 1
MIRT025452 CORO1B coronin, actin binding protein, 1B 1 1
MIRT025453 RCN1 reticulocalbin 1, EF-hand calcium binding domain 1 1
MIRT025454 ME1 malic enzyme 1, NADP(+)-dependent, cytosolic 1 1
MIRT025455 DUT deoxyuridine triphosphatase 1 1
MIRT025456 SAA1 serum amyloid A1 1 1
MIRT025457 CARF amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 1 1
MIRT025458 HIST2H3C histone cluster 2, H3c 1 1
MIRT025459 KTN1 kinectin 1 (kinesin receptor) 1 1
MIRT025460 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT025461 HIST1H4B histone cluster 1, H4b 1 1
MIRT025462 STRAP serine/threonine kinase receptor associated protein 1 1
MIRT025463 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT025464 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT025465 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT025466 TATDN2 TatD DNase domain containing 2 1 1
MIRT025467 POGZ pogo transposable element with ZNF domain 1 1
MIRT025469 MCM7 minichromosome maintenance complex component 7 1 1
MIRT025470 CKAP5 cytoskeleton associated protein 5 1 1
MIRT025471 SH3BGRL3 SH3 domain binding glutamic acid-rich protein like 3 1 1
MIRT025472 HIST1H2BA histone cluster 1, H2ba 1 1
MIRT025473 CTTN cortactin 1 1
MIRT025474 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT025475 RTN4 reticulon 4 2 2
MIRT025476 S100A2 S100 calcium binding protein A2 1 1
MIRT025477 HIST1H2AH histone cluster 1, H2ah 1 1
MIRT025478 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT025479 CAPZB capping protein (actin filament) muscle Z-line, beta 1 1
MIRT025480 TES testis derived transcript (3 LIM domains) 1 1
MIRT025481 FEN1 flap structure-specific endonuclease 1 1 1
MIRT025482 GPI glucose-6-phosphate isomerase 1 1
MIRT025483 DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 1 1
MIRT025484 NELFCD TH1-like (Drosophila) 1 1
MIRT025485 HIST1H3A histone cluster 1, H3a 1 1
MIRT025486 HIST2H2AA4 histone cluster 2, H2aa4 1 1
MIRT025487 TYMS thymidylate synthetase 1 1
MIRT025488 EFHD2 EF-hand domain family, member D2 1 1
MIRT025489 PKP2 plakophilin 2 1 1
MIRT025490 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT025491 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT025492 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT025493 CAPG capping protein (actin filament), gelsolin-like 1 1
MIRT025494 GYG1 glycogenin 1 1 1
MIRT025495 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT025496 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT025497 FAM104A family with sequence similarity 104, member A 1 1
MIRT025498 MYOF myoferlin 1 1
MIRT025499 CMAS cytidine monophosphate N-acetylneuraminic acid synthetase 1 1
MIRT025500 MAP4 microtubule-associated protein 4 1 1
MIRT025501 HIST1H2AD histone cluster 1, H2ad 1 1
MIRT025502 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT025503 HIST2H3D histone cluster 2, H3d 1 1
MIRT025504 ACSL6 acyl-CoA synthetase long-chain family member 6 1 1
MIRT025505 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT025507 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT025508 SLC6A16 solute carrier family 6, member 16 1 1
MIRT025509 NT5E 5'-nucleotidase, ecto (CD73) 1 1
MIRT025510 IMMT inner membrane protein, mitochondrial 1 1
MIRT025511 NUP98 nucleoporin 98kDa 1 1
MIRT025513 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT025514 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT025515 DTYMK deoxythymidylate kinase (thymidylate kinase) 1 1
MIRT025516 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT025517 PTMS parathymosin 1 1
MIRT025518 HIST1H2AM histone cluster 1, H2am 1 1
MIRT025519 HIST1H2AJ histone cluster 1, H2aj 1 1
MIRT025520 USP47 ubiquitin specific peptidase 47 1 1
MIRT025521 MCM5 minichromosome maintenance complex component 5 1 1
MIRT025522 VCL vinculin 1 1
MIRT025523 MYO1C myosin IC 1 1
MIRT025524 TMEM109 transmembrane protein 109 1 1
MIRT025525 HIST4H4 histone cluster 4, H4 1 1
MIRT025526 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT025527 KIAA0196 KIAA0196 1 1
MIRT025528 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT025529 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT025530 MTMR9 myotubularin related protein 9 1 1
MIRT025531 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT025532 SATB2 SATB homeobox 2 1 1
MIRT025533 ACSS1 acyl-CoA synthetase short-chain family member 1 1 1
MIRT025534 DRG1 developmentally regulated GTP binding protein 1 1 1
MIRT025535 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT025536 HIST1H1C histone cluster 1, H1c 1 1
MIRT025537 HIST1H2AI histone cluster 1, H2ai 1 1
MIRT025538 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT025539 IK IK cytokine, down-regulator of HLA II 1 1
MIRT025540 HIST3H2A histone cluster 3, H2a 1 1
MIRT025541 HIST1H1A histone cluster 1, H1a 1 1
MIRT025542 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT025543 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT025544 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT025545 MCM6 minichromosome maintenance complex component 6 1 1
MIRT025546 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT025547 AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) 1 1
MIRT025548 TBL3 transducin (beta)-like 3 1 1
MIRT025549 HIST1H3B histone cluster 1, H3b 1 1
MIRT025550 SORT1 sortilin 1 1 1
MIRT025551 GNPDA1 glucosamine-6-phosphate deaminase 1 1 1
MIRT025552 HOXB8 homeobox B8 1 1
MIRT025553 REEP3 receptor accessory protein 3 1 1
MIRT025554 TXNIP thioredoxin interacting protein 1 1
MIRT025555 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 1
MIRT025556 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT025557 HDAC1 histone deacetylase 1 2 1
MIRT025558 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT025559 HIST1H3F histone cluster 1, H3f 1 1
MIRT025560 TPM1 tropomyosin 1 (alpha) 1 1
MIRT025561 SNAP23 synaptosomal-associated protein, 23kDa 1 1
MIRT025562 STAG3L3 stromal antigen 3-like 3 1 1
MIRT025563 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT025564 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT025565 DDAH2 dimethylarginine dimethylaminohydrolase 2 1 1
MIRT025566 RAB3GAP2 RAB3 GTPase activating protein subunit 2 (non-catalytic) 1 1
MIRT025567 UCK2 uridine-cytidine kinase 2 1 1
MIRT025568 U2SURP U2-associated SR140 protein 1 1
MIRT025569 SFN stratifin 1 1
MIRT025570 TRAIP TRAF interacting protein 1 1
MIRT025572 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT025573 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT025574 NUP62 nucleoporin 62kDa 1 1
MIRT025575 TNPO1 transportin 1 1 1
MIRT025576 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 1 1
MIRT025577 YIPF2 Yip1 domain family, member 2 1 1
MIRT025578 METAP1 methionyl aminopeptidase 1 1 1
MIRT025579 SOCS4 suppressor of cytokine signaling 4 1 1
MIRT025580 CDON Cdon homolog (mouse) 1 1
MIRT025581 POU2F1 POU class 2 homeobox 1 1 1
MIRT025582 PHF19 PHD finger protein 19 1 1
MIRT025583 UBP1 upstream binding protein 1 (LBP-1a) 1 1
MIRT025584 TPD52 tumor protein D52 2 2
MIRT025585 CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) 2 1
MIRT047341 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT047342 CYTH1 cytohesin 1 1 1
MIRT047343 YBX1 Y box binding protein 1 1 1
MIRT047344 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT047345 SNX3 sorting nexin 3 1 1
MIRT047346 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT047347 OPA1 optic atrophy 1 (autosomal dominant) 1 1
MIRT047348 MTMR2 myotubularin related protein 2 1 1
MIRT047349 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT047350 ACTG1 actin, gamma 1 1 1
MIRT047351 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT047352 EXT2 exostosin 2 1 1
MIRT047353 RPL37 ribosomal protein L37 1 1
MIRT047354 MCM10 minichromosome maintenance complex component 10 1 1
MIRT047355 CEP170 centrosomal protein 170kDa 1 1
MIRT047356 WDR77 WD repeat domain 77 1 1
MIRT047357 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT047358 FAM208A chromosome 3 open reading frame 63 1 1
MIRT047359 RBM33 RNA binding motif protein 33 1 1
MIRT047360 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047361 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT047362 ALS2 amyotrophic lateral sclerosis 2 (juvenile) 1 1
MIRT047363 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT047364 RPS2 ribosomal protein S2 1 1
MIRT047365 RNF167 ring finger protein 167 1 1
MIRT047366 NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 1 1
MIRT047367 PRR3 proline rich 3 1 1
MIRT047368 RBM15B RNA binding motif protein 15B 1 1
MIRT047369 MAPK3 mitogen-activated protein kinase 3 1 1
MIRT047370 INTS10 integrator complex subunit 10 1 1
MIRT047371 MED15 mediator complex subunit 15 1 1
MIRT047372 ZNF598 zinc finger protein 598 1 1
MIRT047373 PTCD3 Pentatricopeptide repeat domain 3 1 1
MIRT047374 BIRC6 baculoviral IAP repeat-containing 6 1 1
MIRT047375 DEGS1 degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) 1 1
MIRT047376 D2HGDH D-2-hydroxyglutarate dehydrogenase 1 1
MIRT047377 DIABLO diablo homolog (Drosophila) 1 1
MIRT047378 RRAGA Ras-related GTP binding A 1 1
MIRT047379 RPS7 ribosomal protein S7 1 1
MIRT047380 PIGT phosphatidylinositol glycan anchor biosynthesis, class T 1 1
MIRT047381 RAP2A RAP2A, member of RAS oncogene family 1 1
MIRT047382 PRR12 proline rich 12 1 1
MIRT047383 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT047384 SON SON DNA binding protein 1 1
MIRT047385 CDAN1 congenital dyserythropoietic anemia, type I 1 1
MIRT047386 KANSL2 chromosome 12 open reading frame 41 1 1
MIRT047387 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 1 1
MIRT047388 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT047389 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT047390 SEPT7 septin 7 1 1
MIRT047391 TFAM transcription factor A, mitochondrial 1 1
MIRT047392 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT047393 FH fumarate hydratase 1 1
MIRT047394 GATA4 GATA binding protein 4 1 1
MIRT047395 FAM46A family with sequence similarity 46, member A 1 1
MIRT047396 LRRC28 leucine rich repeat containing 28 1 1
MIRT047397 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT047398 MFN2 mitofusin 2 1 1
MIRT047399 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1