Accession ID: MIRT002354 [miRNA, hsa-miR-133b :: PITX3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-133bLinkOut: [miRBase ]
Synonyms MIRN133B, miRNA133B, mir-133b, MIR133B
Description Homo sapiens miR-133b stem-loop
Comment miR-133b was predicted based on comparative analysis of human, mouse and Fugu .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-133b
Mature Sequence 66| UUUGGUCCCCUUCAACCAGCUA |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-133b Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-133b :: PITX3    [ Functional MTI ]
Validation Method FACS , Luciferase reporter assay , Other
Conditions primary embryonic rat midbrain
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Pitx3 is a target of miR-133b activity. ...

- Kim, J. Inoue, K. Ishii, J. Vanti, W. B. et al., 2007, Science.

Article - Kim, J. Inoue, K. Ishii, J. Vanti, W. B. et al.
- Science, 2007
MicroRNAs (miRNAs) are evolutionarily conserved, 18- to 25-nucleotide, non-protein coding transcripts that posttranscriptionally regulate gene expression during development. miRNAs also occur in postmitotic cells, such as neurons in the mammalian central nervous system, but their function is less well characterized. We investigated the role of miRNAs in mammalian midbrain dopaminergic neurons (DNs). We identified a miRNA, miR-133b, that is specifically expressed in midbrain DNs and is deficient in midbrain tissue from patients with Parkinson's disease. miR-133b regulates the maturation and function of midbrain DNs within a negative feedback circuit that includes the paired-like homeodomain transcription factor Pitx3. We propose a role for this feedback circuit in the fine-tuning of dopaminergic behaviors such as locomotion.
LinkOut: [PMID: 17761882]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
67 hsa-miR-133b Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001076 BCL2L2 BCL2-like 2 4 4
MIRT001815 PKM pyruvate kinase, muscle 1 1
MIRT001985 CASP9 caspase 9, apoptosis-related cysteine peptidase 1 1
MIRT002354 PITX3 paired-like homeodomain 3 2 1
MIRT003052 PTBP2 polypyrimidine tract binding protein 2 2 1
MIRT003260 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 3 3
MIRT004460 IGF1R insulin-like growth factor 1 receptor 3 2
MIRT004832 KCNH2 potassium voltage-gated channel, subfamily H (eag-related), member 2 4 1
MIRT006554 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 3 4
MIRT006650 FAIM Fas apoptotic inhibitory molecule 4 1
MIRT007069 EGFR epidermal growth factor receptor 3 2
MIRT007113 FGFR1 fibroblast growth factor receptor 1 3 1
MIRT007125 CDK13 cyclin-dependent kinase 13 1 1
MIRT007126 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT007127 RB1CC1 RB1-inducible coiled-coil 1 1 1
MIRT007128 CPNE3 copine III 1 1
MIRT007382 PRDM16 PR domain containing 16 1 1
MIRT016690 KLF15 Kruppel-like factor 15 1 1
MIRT016691 MET met proto-oncogene (hepatocyte growth factor receptor) 2 2
MIRT016692 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 1 1
MIRT016693 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 1 1
MIRT016694 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 4 1
MIRT052938 STK3 serine/threonine kinase 3 4 1
MIRT053177 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 2
MIRT053178 RHOA ras homolog family member A 4 1
MIRT053596 GLI1 GLI family zinc finger 1 3 1
MIRT053758 SP1 Sp1 transcription factor 2 1
MIRT054827 TAGLN2 transgelin 2 3 1
MIRT054875 AKT1 v-akt murine thymoma viral oncogene homolog 1 3 1
MIRT055600 FAM160B1 family with sequence similarity 160, member B1 1 1
MIRT438214 CXCR4 chemokine (C-X-C motif) receptor 4 3 1
MIRT438251 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 1 1
MIRT438303 CTGF connective tissue growth factor 1 1
MIRT438513 DUX4L9 double homeobox 4 like 9 1 1
MIRT438580 FOXL2 forkhead box L2 4 1
MIRT479112 CNN2 calponin 2 1 1
MIRT483851 EMID1 EMI domain containing 1 1 1
MIRT504442 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) 1 1
MIRT505702 SESN3 sestrin 3 1 1
MIRT513520 RHOQ ras homolog family member Q 1 2
MIRT517422 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT526598 DCAKD dephospho-CoA kinase domain containing 1 1
MIRT533059 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT534699 RNF103-CHMP3 RNF103-CHMP3 readthrough 1 2
MIRT535731 MYPN myopalladin 1 1
MIRT538528 CHMP3 charged multivesicular body protein 3 1 2
MIRT553867 SYAP1 synapse associated protein 1 1 1
MIRT558811 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 1
MIRT559366 ATP13A3 ATPase type 13A3 1 1
MIRT560940 ZFP28 zinc finger protein 28 homolog (mouse) 1 1
MIRT565462 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT566235 PTMA prothymosin, alpha 1 1
MIRT568216 C11orf24 chromosome 11 open reading frame 24 1 1
MIRT613228 CCDC39 coiled-coil domain containing 39 1 1
MIRT623562 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT641668 CCNI cyclin I 1 1
MIRT644754 TXNRD3NB thioredoxin reductase 3 neighbor 1 1
MIRT646710 PDE1A phosphodiesterase 1A, calmodulin-dependent 1 1
MIRT647576 RBMXL1 RNA binding motif protein, X-linked-like 1 1 1
MIRT647758 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT649266 C17orf64 chromosome 17 open reading frame 64 1 1
MIRT651237 ZMAT4 zinc finger, matrin-type 4 1 1
MIRT652145 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT668310 FOSL2 FOS-like antigen 2 1 1
MIRT699724 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT709495 ANGPT4 angiopoietin 4 1 1
MIRT721676 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*