Accession ID: MIRT002354 [miRNA, hsa-miR-133b :: PITX3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-133bLinkOut: [miRBase ]
Synonyms MIRN133B, miRNA133B, mir-133b, MIR133B
Description Homo sapiens miR-133b stem-loop
Comment miR-133b was predicted based on comparative analysis of human, mouse and Fugu .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-133b
Mature Sequence 66| UUUGGUCCCCUUCAACCAGCUA |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-133b Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PITX3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTPP4, MGC12766, PTX3
Description paired-like homeodomain 3
Transcript NM_0050    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PITX3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PITX3
(miRNA target sites are highlighted)
>PITX3|NM_0050|3'UTR
   1 TGAGCGGCCCCGCCCGTAGATCATCCCCGAGGGCGGGGGCAACGATTCACAGCCTCCGCGGACTGGGGTCATTTTGACTG
  81 GCTTGCTCCCGCCCCAGGGTCTGAAAGGGGTGTTTGGGCAGCTGGGGGGCACCGGCTCAGGAGAGGGCCTTCCCCTCCCA
 161 GCCCTGAGGGGTGGACTAGGCCCTACACACAGACCGCGCCCCTGGGACTAAAGCCAGGAACAGGGACCAGCTCCCCGGGG
 241 GCCAACTCACCCTTGGCCCATCCCGCCTTCTCCAGGCTTCCCCTCCCTCGTTTTCAAAGATAAATGAAATAAACGTGCGC
 321 GGACTGTCAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aucgaccaacuuCCCCUGGUUu 5'
                      ||||:|||| 
Target 5' gaccagctccccGGGGGCCAAc 3'
225 - 246 134.00 -16.20
2
miRNA  3' aucgaccaacuucCCCUGGUUu 5'
                       |||||:|| 
Target 5' agaccgcgcccctGGGACTAAa 3'
191 - 212 129.00 -11.20
3
miRNA  3' aucgaccaACUUCC--CCUGGUUu 5'
                  |||:||  ||||:|: 
Target 5' cccagcccTGAGGGGTGGACTAGg 3'
157 - 180 124.00 -15.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-133b :: PITX3    [ Functional MTI ]
Validation Method FACS , Luciferase reporter assay , Other
Conditions primary embryonic rat midbrain
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Pitx3 is a target of miR-133b activity. ...

- Kim, J. Inoue, K. Ishii, J. Vanti, W. B. et al., 2007, Science.

Article - Kim, J. Inoue, K. Ishii, J. Vanti, W. B. et al.
- Science, 2007
MicroRNAs (miRNAs) are evolutionarily conserved, 18- to 25-nucleotide, non-protein coding transcripts that posttranscriptionally regulate gene expression during development. miRNAs also occur in postmitotic cells, such as neurons in the mammalian central nervous system, but their function is less well characterized. We investigated the role of miRNAs in mammalian midbrain dopaminergic neurons (DNs). We identified a miRNA, miR-133b, that is specifically expressed in midbrain DNs and is deficient in midbrain tissue from patients with Parkinson's disease. miR-133b regulates the maturation and function of midbrain DNs within a negative feedback circuit that includes the paired-like homeodomain transcription factor Pitx3. We propose a role for this feedback circuit in the fine-tuning of dopaminergic behaviors such as locomotion.
LinkOut: [PMID: 17761882]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
22 hsa-miR-133b Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001076 BCL2L2 BCL2-like 2 3 2
MIRT001815 PKM pyruvate kinase, muscle 1 1
MIRT001985 CASP9 caspase 9, apoptosis-related cysteine peptidase 1 1
MIRT002354 PITX3 paired-like homeodomain 3 2 1
MIRT003052 PTBP2 polypyrimidine tract binding protein 2 2 1
MIRT003260 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 3 2
MIRT004460 IGF1R insulin-like growth factor 1 receptor 2 1
MIRT004832 KCNH2 potassium voltage-gated channel, subfamily H (eag-related), member 2 4 1
MIRT006554 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 3 2
MIRT006650 FAIM Fas apoptotic inhibitory molecule 4 1
MIRT007069 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 3 1
MIRT007113 FGFR1 fibroblast growth factor receptor 1 3 1
MIRT007125 CDK13 cyclin-dependent kinase 13 1 1
MIRT007126 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT007127 RB1CC1 RB1-inducible coiled-coil 1 1 1
MIRT007128 CPNE3 copine III 1 1
MIRT007382 PRDM16 PR domain containing 16 1 1
MIRT016690 KLF15 Kruppel-like factor 15 1 1
MIRT016691 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT016692 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 1 1
MIRT016693 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 1 1
MIRT016694 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 4 1