Accession ID: MIRT002409 [miRNA, hsa-miR-21-5p :: SLC16A10, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-21LinkOut: [miRBase ]
Synonyms MIRN21, hsa-mir-21, miR-21, miRNA21, MIR21
Description Homo sapiens miR-21 stem-loop
Comment Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-21-5p
Mature Sequence 8| UAGCUUAUCAGACUGAUGUUGA |29
Evidence Experimental
Experiments Northern
Putative hsa-miR-21-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SLC16A10 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PRO0813, TAT1
Description solute carrier family 16, member 10 (aromatic amino acid transporter)
Transcript NM_0185    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SLC16A10 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SLC16A10
(miRNA target sites are highlighted)
>SLC16A10|NM_0185|3'UTR
   1 TAATATCTTACATACCTCCACCAGACTGGACTTGCTTTTTGAATTTTAAGCAAGTTTCCTTTCCTTTTATACAAATTGCA
  81 AATTTCATATTTTTTTAATCACATCCTAGGAATAGCACAATAATTGGGAAATAGAACCCTTATCACTAGAAGAACCATTT
 161 TCTGCCACTAAATATCTCTGATGTTTCCATGAGTCTGAGGGCAGAGACTCTGGTATATGAAAACGTCTGAAAGTCACATA
 241 TTGTGAAAATTTGAAGCTATCTCAGTAAAAAGCAGCTTTGGAAACTGTGAATGATCTTTAGCTTGTACAAATGTTTAAAA
 321 ATACCTCAGGCTATACTGAAAGGGTTGCAGTTTGGTTAGGAGTGGAAATATTTTGTTTGTTAATGATGTCTTCAGTTCTG
 401 GTACCTCTGTTTTACTTTCTTATGCTCTTTGGAAACTTTTTGCAAAATTTAAGCCTGGGTTCTAGATAATACCAGATCTA
 481 CCTAAACCTCAAGTCTATGTTAAAGTTGCTTTCCTGCTGTTAAATAAGCTATGATATTAAGATATTCTGACTTGCTCCAG
 561 TGTCAAGGGACCTTCTGGGAGCAGGTGCTAACATAGTGTTCAGAATCAATATGTGAGATGAAAAGGATCCCCTCCAGGAG
 641 GATCCTGAGCTGTTCAGAAATCATTTAAGTTTACAGCGTTGTTCCCTTTGCGTTTGCAGTGCGTTTTACTCAAGTAGCCA
 721 GAAACACCCCACGTTTCTGAATTTGTTTAAACTGTAACAATAAAGTAAAATAGAATGCATGAAAGATATTCTGGCGATTG
 801 TAACTTAGAATTTTTCTGACTTCTGGATTTGTTGGCACTAGAACCTGATATTTAAAGTCTTACTGAGCAGCTATCAAGTG
 881 GCAGTTACAGGCACAAATTGGTGGAGGCTGGAGGATGGGGAGGGGAGCAAAACCCTTTATATTTGTGAAGAAAATATCTG
 961 TAGCTGATAGAAATAATTGCTTAAATTGGTTTATGAAATTAATGAGTCTGAAAAGGTTAAAAGCACTTATAAAAAGAACC
1041 AAGTCCTACATTTCCAGAACTTTCTGGCAAAAATTTGCACTCATATTATTTATCCTATGAACATTCCCATTGTTTTTTTT
1121 TGCTATTTATATACAGATTATCATAAGAAAGCTCTCAGTTTGAGGACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguuguaGUCAGACUAUUCGAu 5'
                 | ||:  ||||||| 
Target 5' tttcctgCTGTTAAATAAGCTa 3'
510 - 531 147.00 -9.10
2
miRNA  3' agUUGUAGUCA--GAC------UAUU--CGAu 5'
            ||:||| ||  |||      ||||  ||| 
Target 5' aaAATATCTGTAGCTGATAGAAATAATTGCTt 3'
951 - 982 120.00 -11.40
3
miRNA  3' agUUG--UAGUCAGACUAUUCGAu 5'
            ||:  || ||||||| ||| | 
Target 5' gaAATTAATGAGTCTGAAAAGGTt 3'
995 - 1018 114.00 -12.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-21-5p :: SLC16A10    [ Functional MTI ]
Validation Method Other
Article - Frankel, L. B. Christoffersen, N. R. et al.
- J Biol Chem, 2008
MicroRNAs are emerging as important regulators of cancer-related processes. The miR-21 microRNA is overexpressed in a wide variety of cancers and has been causally linked to cellular proliferation, apoptosis, and migration. Inhibition of mir-21 in MCF-7 breast cancer cells causes reduced cell growth. Using array expression analysis of MCF-7 cells depleted of miR-21, we have identified mRNA targets of mir-21 and have shown a link between miR-21 and the p53 tumor suppressor protein. We furthermore found that the tumor suppressor protein Programmed Cell Death 4 (PDCD4) is regulated by miR-21 and demonstrated that PDCD4 is a functionally important target for miR-21 in breast cancer cells.
LinkOut: [PMID: 17991735]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-21-5p :: SLC16A10    [ Functional MTI ]
Validation Method Microarray
Article - Gabriely, G. Wurdinger, T. Kesari, S. Esau, et al.
- Mol Cell Biol, 2008
Substantial data indicate that microRNA 21 (miR-21) is significantly elevated in glioblastoma (GBM) and in many other tumors of various origins. This microRNA has been implicated in various aspects of carcinogenesis, including cellular proliferation, apoptosis, and migration. We demonstrate that miR-21 regulates multiple genes associated with glioma cell apoptosis, migration, and invasiveness, including the RECK and TIMP3 genes, which are suppressors of malignancy and inhibitors of matrix metalloproteinases (MMPs). Specific inhibition of miR-21 with antisense oligonucleotides leads to elevated levels of RECK and TIMP3 and therefore reduces MMP activities in vitro and in a human model of gliomas in nude mice. Moreover, downregulation of miR-21 in glioma cells leads to decreases of their migratory and invasion abilities. Our data suggest that miR-21 contributes to glioma malignancy by downregulation of MMP inhibitors, which leads to activation of MMPs, thus promoting invasiveness of cancer cells. Our results also indicate that inhibition of a single oncomir, like miR-21, with specific antisense molecules can provide a novel therapeutic approach for "physiological" modulation of multiple proteins whose expression is deregulated in cancer.
LinkOut: [PMID: 18591254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
525 hsa-miR-21-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000019 RASGRP1 RAS guanyl releasing protein 1 (calcium and DAG-regulated) 5 3
MIRT000157 CDC25A cell division cycle 25 homolog A (S. pombe) 4 3
MIRT000158 TP53 tumor protein p53 1 1
MIRT000159 BCL2 B-cell CLL/lymphoma 2 4 8
MIRT000163 WIBG within bgcn homolog (Drosophila) 1 2
MIRT000164 WFS1 Wolfram syndrome 1 (wolframin) 1 2
MIRT000166 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT000167 RTN4 reticulon 4 2 2
MIRT000168 RPS7 ribosomal protein S7 5 17
MIRT000169 PLOD3 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 2 2
MIRT000170 PDHA2 pyruvate dehydrogenase (lipoamide) alpha 2 1 2
MIRT000171 NCAPG non-SMC condensin I complex, subunit G 2 2
MIRT000172 DERL1 Der1-like domain family, member 1 3 3
MIRT000173 BASP1 brain abundant, membrane attached signal protein 1 2 3
MIRT000174 SPRY1 sprouty homolog 1, antagonist of FGF signaling (Drosophila) 1 1
MIRT000175 WNT1 wingless-type MMTV integration site family, member 1 1 1
MIRT000176 JAG1 jagged 1 (Alagille syndrome) 4 3
MIRT000177 REST RE1-silencing transcription factor 2 1
MIRT000672 SPRY2 sprouty homolog 2 (Drosophila) 3 4
MIRT000954 TIMP3 TIMP metallopeptidase inhibitor 3 5 4
MIRT000960 SOX5 SRY (sex determining region Y)-box 5 5 2
MIRT000961 MTAP methylthioadenosine phosphorylase 4 2
MIRT000969 RECK reversion-inducing-cysteine-rich protein with kazal motifs 5 7
MIRT001121 E2F2 E2F transcription factor 2 1 1
MIRT001188 FMOD fibromodulin 2 1
MIRT001189 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 5 5
MIRT001190 PTEN phosphatase and tensin homolog 5 33
MIRT001191 E2F1 E2F transcription factor 1 4 2
MIRT001208 TGFBI transforming growth factor, beta-induced, 68kDa 3 2
MIRT001220 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 4 3
MIRT001221 MARCKS myristoylated alanine-rich protein kinase C substrate 3 1
MIRT001980 TPM1 tropomyosin 1 (alpha) 5 9
MIRT002090 NFIB nuclear factor I/B 4 6
MIRT002406 CDK6 cyclin-dependent kinase 6 2 2
MIRT002407 RP2 retinitis pigmentosa 2 (X-linked recessive) 2 2
MIRT002408 SGK3 serum/glucocorticoid regulated kinase family, member 3 2 2
MIRT002409 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) 2 2
MIRT002410 APAF1 apoptotic peptidase activating factor 1 5 3
MIRT002411 GLCCI1 glucocorticoid induced transcript 1 2 2
MIRT002412 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT002414 SESN1 sestrin 1 2 2
MIRT002416 BTG2 BTG family, member 2 6 4
MIRT002418 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT002419 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT002420 FAM3C family with sequence similarity 3, member C 2 2
MIRT002421 FAS Fas (TNF receptor superfamily, member 6) 2 2
MIRT002422 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT003054 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 6 35
MIRT003146 Pdcd4 programmed cell death 4 3 1
MIRT003147 Pten phosphatase and tensin homolog 3 1
MIRT003317 RHOB ras homolog gene family, member B 4 4
MIRT003567 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 4 7
MIRT003837 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 5 5
MIRT003988 RASA1 RAS p21 protein activator (GTPase activating protein) 1 3 1
MIRT004287 TGIF1 TGFB-induced factor homeobox 1 2 1
MIRT004306 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004307 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 2 1
MIRT004318 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT004812 SPATS2L spermatogenesis associated, serine-rich 2-like 1 1
MIRT004813 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 1
MIRT004814 PCBP1 poly(rC) binding protein 1 2 2
MIRT004838 Pten phosphatase and tensin homolog 3 1
MIRT004839 Reck reversion-inducing-cysteine-rich protein with kazal motifs 3 1
MIRT005323 JMY junction mediating and regulatory protein, p53 cofactor 3 1
MIRT005324 TOPORS topoisomerase I binding, arginine/serine-rich 4 3
MIRT005325 HNRNPK heterogeneous nuclear ribonucleoprotein K 3 4
MIRT005327 DAXX death-domain associated protein 4 1
MIRT005328 TP53BP2 tumor protein p53 binding protein, 2 3 1
MIRT005329 TP63 tumor protein p63 4 2
MIRT005330 TGFBR3 transforming growth factor, beta receptor III 4 3
MIRT005331 PPIF peptidylprolyl isomerase F 3 2
MIRT005429 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 5 3
MIRT005430 MSH6 mutS homolog 6 (E. coli) 4 1
MIRT005565 TIAM1 T-cell lymphoma invasion and metastasis 1 4 2
MIRT005717 ISCU iron-sulfur cluster scaffold homolog (E. coli) 3 1
MIRT005737 MEF2C myocyte enhancer factor 2C 1 1
MIRT005772 EIF4A2 eukaryotic translation initiation factor 4A2 4 1
MIRT005773 ANKRD46 ankyrin repeat domain 46 4 1
MIRT005807 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 4 2
MIRT005951 IL1B interleukin 1, beta 3 1
MIRT005952 ICAM1 intercellular adhesion molecule 1 3 1
MIRT005953 PLAT plasminogen activator, tissue 3 1
MIRT005954 PTX3 pentraxin 3, long 1 1
MIRT005955 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT005956 CCR1 chemokine (C-C motif) receptor 1 1 1
MIRT005974 CDK2AP1 cyclin-dependent kinase 2 associated protein 1 3 2
MIRT006199 CCL20 chemokine (C-C motif) ligand 20 1 1
MIRT006236 SP1 Sp1 transcription factor 2 1
MIRT006288 PIAS3 protein inhibitor of activated STAT, 3 1 1
MIRT006313 DOCK4 dedicator of cytokinesis 4 2 1
MIRT006314 DOCK5 dedicator of cytokinesis 5 2 1
MIRT006315 DOCK7 dedicator of cytokinesis 7 2 1
MIRT006323 DUSP10 dual specificity phosphatase 10 3 1
MIRT006422 PPARA peroxisome proliferator-activated receptor alpha 4 2
MIRT006515 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 3 1
MIRT006516 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 3 1
MIRT006529 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 1 1
MIRT006797 NTF3 neurotrophin 3 2 1
MIRT006821 COL4A1 collagen, type IV, alpha 1 2 1
MIRT006989 FASLG Fas ligand (TNF superfamily, member 6) 4 3
MIRT006997 SOD3 superoxide dismutase 3, extracellular 1 1
MIRT007085 TCF21 transcription factor 21 1 1
MIRT007362 SMAD7 SMAD family member 7 2 1
MIRT030661 PHIP pleckstrin homology domain interacting protein 1 1
MIRT030662 PALLD palladin, cytoskeletal associated protein 1 1
MIRT030663 BOC Boc homolog (mouse) 1 1
MIRT030664 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT030665 C20orf194 chromosome 20 open reading frame 194 1 1
MIRT030666 COL5A2 collagen, type V, alpha 2 1 1
MIRT030667 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT030668 NIN ninein (GSK3B interacting protein) 1 1
MIRT030669 PPAP2A phosphatidic acid phosphatase type 2A 1 1
MIRT030670 TRIM38 tripartite motif-containing 38 1 1
MIRT030671 DDR2 discoidin domain receptor tyrosine kinase 2 1 1
MIRT030672 VPS54 vacuolar protein sorting 54 homolog (S. cerevisiae) 1 1
MIRT030673 KIAA1715 KIAA1715 1 1
MIRT030674 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT030675 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT030676 USP34 ubiquitin specific peptidase 34 1 1
MIRT030677 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 1 1
MIRT030678 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT030679 CLOCK clock homolog (mouse) 1 1
MIRT030680 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT030681 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT030682 DDHD2 DDHD domain containing 2 1 1
MIRT030683 C2orf43 chromosome 2 open reading frame 43 1 1
MIRT030684 SGCB sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) 1 1
MIRT030685 FANCI Fanconi anemia, complementation group I 1 1
MIRT030686 EDIL3 EGF-like repeats and discoidin I-like domains 3 1 1
MIRT030687 DTX3L deltex 3-like (Drosophila) 1 1
MIRT030688 IREB2 iron-responsive element binding protein 2 1 1
MIRT030689 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A 1 1
MIRT030690 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT030691 CYBRD1 cytochrome b reductase 1 1 1
MIRT030692 SLAIN2 SLAIN motif family, member 2 1 1
MIRT030693 KIAA1551 chromosome 12 open reading frame 35 1 1
MIRT030694 SOX2 SRY (sex determining region Y)-box 2 1 1
MIRT030695 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 1
MIRT030696 RRAGC Ras-related GTP binding C 1 1
MIRT030697 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT030698 HPS5 Hermansky-Pudlak syndrome 5 1 1
MIRT030699 SESTD1 SEC14 and spectrin domains 1 1 1
MIRT030700 MEF2A myocyte enhancer factor 2A 1 1
MIRT030701 ZBTB47 zinc finger and BTB domain containing 47 1 1
MIRT030702 ELOVL4 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 1 1
MIRT030703 EPHA4 EPH receptor A4 1 1
MIRT030704 ENAH enabled homolog (Drosophila) 1 1
MIRT030705 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT030706 NBEA neurobeachin 1 1
MIRT030707 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT030708 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT030709 CD47 CD47 molecule 1 1
MIRT030710 LATS1 LATS, large tumor suppressor, homolog 1 (Drosophila) 1 1
MIRT030711 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT030712 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT030713 KBTBD7 kelch repeat and BTB (POZ) domain containing 7 1 1
MIRT030714 MEIS1 Meis homeobox 1 1 1
MIRT030715 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT030716 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 1 1
MIRT030717 VEGFA vascular endothelial growth factor A 2 2
MIRT030718 REV3L REV3-like, catalytic subunit of DNA polymerase zeta (yeast) 1 1
MIRT030719 TXLNG2P chromosome Y open reading frame 15A 1 1
MIRT030720 KLHL3 kelch-like 3 (Drosophila) 1 1
MIRT030721 SCAF11 splicing factor, arginine/serine-rich 2, interacting protein 1 1
MIRT030722 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT030723 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT030724 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT030725 CERS6 LAG1 homolog, ceramide synthase 6 1 1
MIRT030726 SNX13 sorting nexin 13 1 1
MIRT030727 SNRNP48 small nuclear ribonucleoprotein 48kDa (U11/U12) 1 1
MIRT030728 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT030729 RTF1 Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT030730 TGFB1 transforming growth factor, beta 1 1 1
MIRT030731 ANKRD28 ankyrin repeat domain 28 1 1
MIRT030732 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT030733 OSBPL1A oxysterol binding protein-like 1A 1 1
MIRT030734 RSPRY1 ring finger and SPRY domain containing 1 1 1
MIRT030735 SRSF11 splicing factor, arginine/serine-rich 11 1 1
MIRT030736 ASRGL1 asparaginase like 1 1 1
MIRT030737 CUL3 cullin 3 1 1
MIRT030738 RB1 retinoblastoma 1 1 1
MIRT030739 TSN translin 1 1
MIRT030740 EXOC8 exocyst complex component 8 1 1
MIRT030741 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT030742 UTRN utrophin 1 1
MIRT030743 RASSF9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT030744 ACAT1 acetyl-CoA acetyltransferase 1 1 1
MIRT030745 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT030746 PDGFD platelet derived growth factor D 1 1
MIRT030747 COBLL1 COBL-like 1 1 1
MIRT030748 SAMD5 sterile alpha motif domain containing 5 1 1
MIRT030749 MOAP1 modulator of apoptosis 1 1 1
MIRT030750 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT030751 ZNF326 zinc finger protein 326 1 1
MIRT030752 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT030753 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT030754 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT030755 TNS3 tensin 3 1 1
MIRT030756 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT030757 MYEF2 myelin expression factor 2 1 1
MIRT030758 PPP1R3B protein phosphatase 1, regulatory (inhibitor) subunit 3B 1 1
MIRT030759 PKD2 polycystic kidney disease 2 (autosomal dominant) 1 1
MIRT030760 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT030761 PAN3 PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1
MIRT030762 ZRANB1 zinc finger, RAN-binding domain containing 1 1 1
MIRT030763 MON2 MON2 homolog (S. cerevisiae) 1 1
MIRT030764 RASEF RAS and EF-hand domain containing 1 1
MIRT030765 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT030766 HERPUD2 HERPUD family member 2 1 1
MIRT030767 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT030768 THOC2 THO complex 2 1 1
MIRT030769 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT030770 PHF17 PHD finger protein 17 1 1
MIRT030771 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT030772 GTF2I general transcription factor IIi 1 1
MIRT030773 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT030774 CLCN5 chloride channel 5 1 1
MIRT030775 TRIM2 tripartite motif-containing 2 1 1
MIRT030776 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT030777 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT030778 PHF16 PHD finger protein 16 1 1
MIRT030779 ELOVL7 ELOVL family member 7, elongation of long chain fatty acids (yeast) 1 1
MIRT030780 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT030781 SASH1 SAM and SH3 domain containing 1 1 1
MIRT030782 RAB22A RAB22A, member RAS oncogene family 1 1
MIRT030783 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT030784 SPIN1 spindlin 1 1 1
MIRT030785 POLR3B polymerase (RNA) III (DNA directed) polypeptide B 1 1
MIRT030786 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT030787 CCDC34 coiled-coil domain containing 34 1 1
MIRT030788 PGRMC2 progesterone receptor membrane component 2 1 1
MIRT030789 TRPM7 transient receptor potential cation channel, subfamily M, member 7 1 1
MIRT030790 GID4 chromosome 17 open reading frame 39 1 1
MIRT030791 FAM63B family with sequence similarity 63, member B 1 1
MIRT030792 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT030793 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT030794 ZNF367 zinc finger protein 367 1 1
MIRT030795 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT030796 MBNL1 muscleblind-like (Drosophila) 1 1
MIRT030797 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT030798 ZNF35 zinc finger protein 35 1 1
MIRT030799 PSRC1 proline/serine-rich coiled-coil 1 1 1
MIRT030800 FOXN3 forkhead box N3 1 1
MIRT030801 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT030802 FBXO3 F-box protein 3 1 1
MIRT030803 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT030804 PM20D2 peptidase M20 domain containing 2 1 1
MIRT030805 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT030806 DMTF1 cyclin D binding myb-like transcription factor 1 1 1
MIRT030807 DDX46 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 1 1
MIRT030808 ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 1 1
MIRT030809 LMBR1 limb region 1 homolog (mouse) 1 1
MIRT030810 MUC1 mucin 1, cell surface associated 1 1
MIRT030811 IL6R interleukin 6 receptor 1 1
MIRT030812 TUBGCP5 tubulin, gamma complex associated protein 5 1 1
MIRT030813 RHOQ ras homolog gene family, member Q 1 1
MIRT030814 TET1 tet oncogene 1 1 1
MIRT030815 CASC5 cancer susceptibility candidate 5 1 1
MIRT030816 ARHGAP21 Rho GTPase activating protein 21 1 1
MIRT030817 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT030818 LARS leucyl-tRNA synthetase 1 1
MIRT030819 FAXDC2 chromosome 5 open reading frame 4 1 1
MIRT030820 CDK19 cyclin-dependent kinase 19 1 1
MIRT030821 LAMP2 lysosomal-associated membrane protein 2 1 1
MIRT030822 MOXD1 monooxygenase, DBH-like 1 1 1
MIRT030823 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 1 1
MIRT030824 PIK3C2A phosphoinositide-3-kinase, class 2, alpha polypeptide 1 1
MIRT030825 TMEM2 transmembrane protein 2 1 1
MIRT030826 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT030827 RAI14 retinoic acid induced 14 1 1
MIRT030828 MYO9A myosin IXA 1 1
MIRT030829 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT030830 FBXL17 F-box and leucine-rich repeat protein 17 1 1
MIRT030831 AGGF1 angiogenic factor with G patch and FHA domains 1 1 1
MIRT030832 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT030833 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT030834 SREK1 splicing factor, arginine/serine-rich 12 1 1
MIRT030835 FAM20B family with sequence similarity 20, member B 1 1
MIRT030836 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT030837 SERPINI1 serpin peptidase inhibitor, clade I (neuroserpin), member 1 1 1
MIRT030838 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT030839 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT030840 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT030841 JPH1 junctophilin 1 1 1
MIRT030842 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT030843 FKBP5 FK506 binding protein 5 1 1
MIRT030844 TGFB2 transforming growth factor, beta 2 1 1
MIRT030845 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT030846 TRIM33 tripartite motif-containing 33 1 1
MIRT030847 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT030848 MTPN myotrophin 1 1
MIRT030849 GOLGA4 golgin A4 1 1
MIRT030850 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT030851 ATAD2B ATPase family, AAA domain containing 2B 1 1
MIRT030852 FIGN fidgetin 1 1
MIRT030853 EPM2A epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) 1 1
MIRT030854 RAB6C RAB6C, member RAS oncogene family 1 1
MIRT030855 TSNAX translin-associated factor X 1 1
MIRT030856 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT030857 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT030858 CALD1 caldesmon 1 1 1
MIRT030859 LYRM7 Lyrm7 homolog (mouse) 1 1
MIRT030860 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT030861 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT030862 ADNP activity-dependent neuroprotector homeobox 1 1
MIRT030863 LRRC57 leucine rich repeat containing 57 1 1
MIRT030864 DUSP8 dual specificity phosphatase 8 1 1
MIRT030865 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT030866 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT030867 PBRM1 polybromo 1 1 1
MIRT030868 SMNDC1 survival motor neuron domain containing 1 1 1
MIRT030869 NCSTN nicastrin 1 1
MIRT030870 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT030871 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 1 1
MIRT030872 PARP9 poly (ADP-ribose) polymerase family, member 9 1 1
MIRT030873 CKAP5 cytoskeleton associated protein 5 1 1
MIRT030874 CAPRIN1 cell cycle associated protein 1 1 1
MIRT030875 CNTRL centrosomal protein 110kDa 1 1
MIRT030876 PHTF1 putative homeodomain transcription factor 1 1 1
MIRT030877 MRAP2 melanocortin 2 receptor accessory protein 2 1 1
MIRT030878 MYCBP2 MYC binding protein 2 1 1
MIRT030879 ITSN2 intersectin 2 1 1
MIRT030880 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 1
MIRT030881 PPFIA4 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4 1 1
MIRT030882 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT030883 ZNF667 zinc finger protein 667 1 1
MIRT030884 ETNK1 ethanolamine kinase 1 1 1
MIRT030885 CYP4V2 cytochrome P450, family 4, subfamily V, polypeptide 2 1 1
MIRT030886 BRCA1 breast cancer 1, early onset 1 1
MIRT030887 DOCK10 dedicator of cytokinesis 10 1 1
MIRT030888 DMD dystrophin 1 1
MIRT030889 TMX4 thioredoxin-related transmembrane protein 4 1 1
MIRT030890 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT030891 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT030892 CCT6P1 chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1 1 1
MIRT030893 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT030894 NEK1 NIMA (never in mitosis gene a)-related kinase 1 1 1
MIRT030895 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT030896 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT030897 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 1
MIRT030898 TRIM59 tripartite motif-containing 59 1 1
MIRT030899 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT030900 TMEM56 transmembrane protein 56 1 1
MIRT030901 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT030902 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT030903 ZNF217 zinc finger protein 217 1 1
MIRT030904 FAM217B chromosome 20 open reading frame 177 1 1
MIRT030905 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT030906 FNBP1 formin binding protein 1 1 1
MIRT030907 ZFYVE16 zinc finger, FYVE domain containing 16 1 1
MIRT030908 VPS13A vacuolar protein sorting 13 homolog A (S. cerevisiae) 1 1
MIRT030909 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 1 1
MIRT030910 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 1
MIRT030911 GPD1L glycerol-3-phosphate dehydrogenase 1-like 1 1
MIRT030912 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT030913 PRKCE protein kinase C, epsilon 1 1
MIRT030914 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT030915 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT030916 TAF1 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa 1 1
MIRT030917 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT030918 PTK2 PTK2 protein tyrosine kinase 2 1 1
MIRT030919 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 1 1
MIRT030920 SSFA2 sperm specific antigen 2 1 1
MIRT030921 HECTD1 HECT domain containing 1 1 1
MIRT030922 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 1
MIRT030923 SFXN1 sideroflexin 1 1 1
MIRT030924 HAPLN1 hyaluronan and proteoglycan link protein 1 1 1
MIRT030925 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT030926 KLHL42 kelch domain containing 5 1 1
MIRT030927 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT030928 SLC9A6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 1 1
MIRT030929 ZNF207 zinc finger protein 207 1 1
MIRT030930 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT030931 FAM46A family with sequence similarity 46, member A 1 1
MIRT030932 MTMR12 myotubularin related protein 12 1 1
MIRT030933 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT030934 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT030935 ABCD3 ATP-binding cassette, sub-family D (ALD), member 3 1 1
MIRT030936 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT030937 RAB11FIP2 RAB11 family interacting protein 2 (class I) 1 1
MIRT030938 PURB purine-rich element binding protein B 1 1
MIRT030939 LCORL ligand dependent nuclear receptor corepressor-like 1 1
MIRT030940 KLF5 Kruppel-like factor 5 (intestinal) 1 1
MIRT030941 ST6GAL1 ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 1 1
MIRT030942 GPR64 G protein-coupled receptor 64 1 1
MIRT030943 SKP2 S-phase kinase-associated protein 2 (p45) 1 1
MIRT030944 ECI2 peroxisomal D3,D2-enoyl-CoA isomerase 1 1
MIRT030945 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT030946 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT030947 HS3ST3B1 heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 1 1
MIRT030948 ELAVL4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) 1 1
MIRT030949 CORO2A coronin, actin binding protein, 2A 1 1
MIRT030950 TTC33 tetratricopeptide repeat domain 33 1 2
MIRT030951 AUTS2 autism susceptibility candidate 2 2 2
MIRT030952 AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 1 1
MIRT030953 NKTR natural killer-tumor recognition sequence 1 2
MIRT030954 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT030955 STXBP5 syntaxin binding protein 5 (tomosyn) 1 1
MIRT030956 MGA MAX gene associated 1 3
MIRT030957 SMC5 structural maintenance of chromosomes 5 1 1
MIRT030958 KIFAP3 kinesin-associated protein 3 1 1
MIRT030959 SPG11 spastic paraplegia 11 (autosomal recessive) 1 1
MIRT030960 PER3 period homolog 3 (Drosophila) 1 1
MIRT030961 ZNF292 zinc finger protein 292 1 1
MIRT030962 ZNF587 zinc finger protein 587 1 1
MIRT030963 AIM1 absent in melanoma 1 1 1
MIRT030964 DSE dermatan sulfate epimerase 1 1
MIRT030965 SRPK2 SFRS protein kinase 2 1 1
MIRT030966 TSHZ3 teashirt zinc finger homeobox 3 1 1
MIRT030967 CEP97 centrosomal protein 97kDa 1 1
MIRT030968 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT030969 PHF20 PHD finger protein 20 1 1
MIRT030970 SEMA5A sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A 1 1
MIRT030971 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT030972 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT030973 VPS36 vacuolar protein sorting 36 homolog (S. cerevisiae) 1 1
MIRT030974 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT030975 NUBPL nucleotide binding protein-like 1 1
MIRT030976 LIMCH1 LIM and calponin homology domains 1 1 1
MIRT030977 MTMR9 myotubularin related protein 9 1 1
MIRT030978 SERAC1 serine active site containing 1 1 1
MIRT030979 RUFY3 RUN and FYVE domain containing 3 1 1
MIRT030980 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT030981 PBX1 pre-B-cell leukemia homeobox 1 1 1
MIRT030982 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT030983 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT030984 REV1 REV1 homolog (S. cerevisiae) 1 1
MIRT030985 FBXL2 F-box and leucine-rich repeat protein 2 1 1
MIRT030986 HOXA9 homeobox A9 1 1
MIRT030987 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT030988 FMR1 fragile X mental retardation 1 1 1
MIRT030989 SNX30 sorting nexin family member 30 1 1
MIRT030990 SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 1 1
MIRT030991 PREPL prolyl endopeptidase-like 1 1
MIRT030992 CCDC14 coiled-coil domain containing 14 1 1
MIRT030993 ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 1 1
MIRT030994 USP47 ubiquitin specific peptidase 47 1 1
MIRT030995 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT030996 ARID4A AT rich interactive domain 4A (RBP1-like) 1 1
MIRT030997 ATP11B ATPase, class VI, type 11B 1 1
MIRT030998 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT030999 DLG1 discs, large homolog 1 (Drosophila) 1 1
MIRT031000 SOWAHC ankyrin repeat domain 57 1 1
MIRT031001 RSF1 remodeling and spacing factor 1 1 1
MIRT031002 SNRK SNF related kinase 1 1
MIRT031003 PLD1 phospholipase D1, phosphatidylcholine-specific 1 1
MIRT031004 TLR4 toll-like receptor 4 1 1
MIRT031005 VPS26A vacuolar protein sorting 26 homolog A (S. pombe) 1 1
MIRT031006 ZYG11B zyg-11 homolog B (C. elegans) 1 1
MIRT031007 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT031008 TESK2 testis-specific kinase 2 1 1
MIRT031009 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT031010 RAB6A RAB6A, member RAS oncogene family 1 1
MIRT031011 PURA purine-rich element binding protein A 1 1
MIRT031012 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT031013 KLF9 Kruppel-like factor 9 1 1
MIRT031014 ATMIN ATM interactor 1 1
MIRT031015 PRPF39 PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae) 1 1
MIRT031016 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT031017 STAG2 stromal antigen 2 1 1
MIRT031018 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT031019 AKT2 v-akt murine thymoma viral oncogene homolog 2 2 1
MIRT031020 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT031021 PRRC1 proline-rich coiled-coil 1 1 1
MIRT031022 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT031023 ZNF532 zinc finger protein 532 1 1
MIRT031024 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT031025 TCF4 transcription factor 4 1 1
MIRT031026 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT031027 THBS1 thrombospondin 1 1 1
MIRT031028 PTPN3 protein tyrosine phosphatase, non-receptor type 3 1 1
MIRT031029 ATF2 activating transcription factor 2 1 1
MIRT031030 RBM27 RNA binding motif protein 27 1 1
MIRT031031 EXOC5 exocyst complex component 5 1 1
MIRT031032 AFTPH aftiphilin 1 1
MIRT031033 BID BH3 interacting domain death agonist 1 1
MIRT031034 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT031035 WDR7 WD repeat domain 7 1 1
MIRT031036 FAM126B family with sequence similarity 126, member B 1 1
MIRT031037 PTGFR prostaglandin F receptor (FP) 1 1
MIRT031038 PHF20L1 PHD finger protein 20-like 1 1 1
MIRT031039 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT031040 GLG1 golgi glycoprotein 1 1 1
MIRT031041 CEP152 centrosomal protein 152kDa 1 1
MIRT031042 HMGB3 high-mobility group box 3 1 1
MIRT031043 BDH2 3-hydroxybutyrate dehydrogenase, type 2 1 1
MIRT031044 LPIN1 lipin 1 1 1
MIRT031045 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT031046 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT031047 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT031048 TSC1 tuberous sclerosis 1 1 1
MIRT031049 ALMS1 Alstrom syndrome 1 1 1
MIRT031050 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT031051 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT031052 PIGX phosphatidylinositol glycan anchor biosynthesis, class X 1 1
MIRT031053 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT031054 APC adenomatous polyposis coli 1 1
MIRT031055 SLMAP sarcolemma associated protein 1 1
MIRT031056 SOCS4 suppressor of cytokine signaling 4 1 1
MIRT031057 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT031058 OSR1 odd-skipped related 1 (Drosophila) 1 1
MIRT031059 FBXO11 F-box protein 11 1 1
MIRT031060 SCRN1 secernin 1 1 1
MIRT031061 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT031062 CCNG1 cyclin G1 1 1
MIRT031063 MEGF9 multiple EGF-like-domains 9 1 1
MIRT031064 TNPO1 transportin 1 1 1
MIRT031065 FERMT2 fermitin family homolog 2 (Drosophila) 1 1
MIRT031066 KAT6A MYST histone acetyltransferase (monocytic leukemia) 3 1 1
MIRT031067 TNFRSF11B tumor necrosis factor receptor superfamily, member 11b 1 1
MIRT031068 WWC2 WW and C2 domain containing 2 1 2
MIRT031069 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT031070 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT031071 VASH2 vasohibin 2 1 2
MIRT031072 SLK STE20-like kinase (yeast) 1 2
MIRT031073 FILIP1L filamin A interacting protein 1-like 1 2
MIRT031074 DCP1A DCP1 decapping enzyme homolog A (S. cerevisiae) 1 4
MIRT031075 RNF11 ring finger protein 11 1 2
MIRT031076 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 4
MIRT031077 PELI1 pellino homolog 1 (Drosophila) 2 2
MIRT031078 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 2 2
MIRT031079 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 3 2
MIRT035524 BCL6 B-cell CLL/lymphoma 6 1 1
MIRT050474 OTUD1 OTU domain containing 1 1 1
MIRT050475 TMEM147 transmembrane protein 147 1 1