Accession ID: MIRT002639 [miRNA, hsa-miR-124 :: GSN, target gene]
miRNA Infomation
miRNA namehsa-miR-124
miRNA-target interaction network
Gene Information
Gene Symbol GSN LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DKFZp313L0718
Description gelsolin
Transcript NM_000177   LinkOut: [ RefSeq ]
Other Transcripts NM_001127662, NM_001127663, NM_001127664, NM_001127665, NM_001127666, NM_001127667, NM_198252   
Expression LinkOut: [ BioGPS ]
KEGG Pathway hsa04666    Fc gamma R-mediated phagocytosis - Homo sapiens (human)
hsa04810    Regulation of actin cytoskeleton - Homo sapiens (human)
Putative miRNA Targets on GSN LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GSN
(miRNA target sites are highlighted)		 
>GSN|NM_000177|3'UTR
   1 GCTGCCTGAGGAGGGGCAGGGCCCACCCATGTCACCGGTCAGTGCCTTTTGGAACTGTCCTTCCCTCAAAGAGGCCTTAG
  81 AGCGAGCAGAGCAGCTCTGCTATGAGTGTGTGTGTGTGTGTGTGTTGTTTCTTTTTTTTTTTTTTACAGTATCCAAAAAT
 161 AGCCCTGCAAAAATTCAGAGTCCTTGCAAAATTGTCTAAAATGTCAGTGTTTGGGAAATTAAATCCAATAAAAACATTTT
 241 GAAGTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-124 :: GSN    [ Functional MTI ]
Validation Method Microarray
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... Filtering the expression profiles for genes characterized by the LocusLink database12 that were significantly downregulated (P < 0.001) at both 12 and 24 h, gave sets of 96 and 174 annotated genes downregulated by miR-1 and miR-124, respectively (Supplementary Tables 1 and 2).//{These MTI shown in Supplementary Table 1,2,4} ...

- Lim, L. P. Lau, N. C. Garrett-Engele, P. et al., 2005, Nature.
miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1 
miRNA  3' ccguaaguggcgCACGGAau 5'
                      ||||||  
Target 5' ------------GUGCCU-- 3'
 		1 - 6
Article - Lim, L. P. Lau, N. C. Garrett-Engele, P. et al.
- Nature, 2005
MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression in plants and animals. To investigate the influence of miRNAs on transcript levels, we transfected miRNAs into human cells and used microarrays to examine changes in the messenger RNA profile. Here we show that delivering miR-124 causes the expression profile to shift towards that of brain, the organ in which miR-124 is preferentially expressed, whereas delivering miR-1 shifts the profile towards that of muscle, where miR-1 is preferentially expressed. In each case, about 100 messages were downregulated after 12 h. The 3' untranslated regions of these messages had a significant propensity to pair to the 5' region of the miRNA, as expected if many of these messages are the direct targets of the miRNAs. Our results suggest that metazoan miRNAs can reduce the levels of many of their target transcripts, not just the amount of protein deriving from these transcripts. Moreover, miR-1 and miR-124, and presumably other tissue-specific miRNAs, seem to downregulate a far greater number of targets than previously appreciated, thereby helping to define tissue-specific gene expression in humans.
LinkOut: [PMID: 15685193]