Accession ID: MIRT002875 [miRNA, hsa-miR-34a-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34aLinkOut: [miRBase ]
Description Homo sapiens miR-34a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34a-5p
Mature Sequence 22| UGGCAGUGUCUUAGCUGGUUGU |43
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uguuggucgaUUCUGUGACGGu 5'
                    ||||||||||| 
Target 5' tttctggggaAAGACACTGCCt 3'
898 - 919 160.00 -19.50
2
miRNA  3' uguUG-GUCGAUUCUGUGACGGu 5'
             || |||  || |||||||| 
Target 5' tttACACAG--AA-ACACTGCCt 3'
171 - 190 154.00 -15.00
3
miRNA  3' uguUGGUCGAUUC--UGUGACGGu 5'
             ||::|  | |   |:||||| 
Target 5' tgcACTGGGGACGCTCCGCTGCCg 3'
1372 - 1395 129.00 -16.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Other
Article - Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al.
- Cell, 2003
MicroRNAs (miRNAs) can play important gene regulatory roles in nematodes, insects, and plants by basepairing to mRNAs to specify posttranscriptional repression of these messages. However, the mRNAs regulated by vertebrate miRNAs are all unknown. Here we predict more than 400 regulatory target genes for the conserved vertebrate miRNAs by identifying mRNAs with conserved pairing to the 5' region of the miRNA and evaluating the number and quality of these complementary sites. Rigorous tests using shuffled miRNA controls supported a majority of these predictions, with the fraction of false positives estimated at 31% for targets identified in human, mouse, and rat and 22% for targets identified in pufferfish as well as mammals. Eleven predicted targets (out of 15 tested) were supported experimentally using a HeLa cell reporter system. The predicted regulatory targets of mammalian miRNAs were enriched for genes involved in transcriptional regulation but also encompassed an unexpectedly broad range of other functions.
LinkOut: [PMID: 14697198]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , Other
Conditions SH-SY5Y
Location of target site 3'UTR
Original Description (Extracted from the article) ... overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. ...

- Fukuda, Y. Kawasaki, H. Taira, K., 2005, Nucleic Acids Symp Ser (Oxf).

Article - Fukuda, Y. Kawasaki, H. Taira, K.
- Nucleic Acids Symp Ser (Oxf), 2005
MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that inhibit protein translation in a sequence specific manner. We carried out microarray analyses of 180 human pre-miRNAs in neuroblastoma cell, SH-SY5Y, following stimulation by TPA. Twelve of the pre-miRNAs were up-regulated by the TPA stimulation. We also explored miRNA target genes associated with neuronal differentiation. Some miRNAs have complementarity with 3'UTR of the Notch1 gene, a regulator of neuronal differentiation, and luciferase assay showed that overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. Our results suggest that miRNAs can be associated with TPA induced signalling pathways and expression of Notch1 gene.
LinkOut: [PMID: 17150773]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Other
Article - Ji, Q. Hao, X. Meng, Y. Zhang, M. Desano, et al.
- BMC Cancer, 2008
BACKGROUND: MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. METHODS: Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. RESULTS: Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. CONCLUSION: Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. The mechanism of miR-34-mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer.
LinkOut: [PMID: 18803879]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Other
Article - Tryndyak, V. P. Ross, S. A. Beland, F. A. et al.
- Mol Carcinog, 2009
Altered expression of microRNAs (miRNAs) has been reported in diverse human cancers; however, the down-regulation or up-regulation of any particular miRNAs in cancer is not sufficient to address the role of these changes in carcinogenesis. In this study, using the rat model of liver carcinogenesis induced by a methyl-deficient diet, which is relevant to the hepatocarcinogenesis in humans associated with viral hepatitis C and B infections, alcohol exposure and metabolic liver diseases, we showed that the development of hepatocellular carcinoma (HCC) is characterized by prominent early changes in expression of miRNA genes, specifically by inhibition of expression of microRNAs miR-34a, miR-127, miR-200b, and miR-16a involved in the regulation of apoptosis, cell proliferation, cell-to-cell connection, and epithelial-mesenchymal transition. The mechanistic link between these alterations in miRNAs expression and the development of HCC was confirmed by the corresponding changes in the levels of E2F3, NOTCH1, BCL6, ZFHX1B, and BCL2 proteins targeted by these miRNAs. The significance of miRNAs expression dysregulation in respect to hepatocarcinogenesis was confirmed by the persistence of these miRNAs alterations in the livers of methyl-deficient rats re-fed a methyl-adequate diet. Altogether, the early occurrence of alterations in miRNAs expression and their persistence during the entire process of hepatocarcinogenesis indicate that the dysregulation of microRNAs expression may be an important contributing factor in the development of HCC.
LinkOut: [PMID: 18942116]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Microarray
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... c Listed are exemplary genes whose expression levels are downregulated on the mRNA and/or protein level as determined by microarray expression, quantitative PCR and/or western blot analyses after expression or transfection of ectopic miR-34. A direct regulation of these genes by miR-34 by the use of reporter assays has not been validated yet. ...

- Hermeking, H., 2010, Cell Death Differ.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' uguuggucgaUUCUGUGACGGu 5'
                    ||||||||||| 
Target 5' uuucuggggaAAGACACUGCCu 3'
1 - 22
Article - Hermeking, H.
- Cell Death Differ, 2010
Recently, the transcription factor encoded by tumor suppressor gene p53 was shown to regulate the expression of microRNAs. The most significant induction by p53 was observed for the microRNAs miR-34a and miR-34b/c, which turned out to be direct p53 target genes. Ectopic miR-34 expression induces apoptosis, cell-cycle arrest or senescence. In many tumor types the promoters of the miR-34a and the miR-34b/c genes are subject to inactivation by CpG methylation. MiR-34a resides on 1p36 and is commonly deleted in neuroblastomas. Furthermore, the loss of miR-34 expression has been linked to resistance against apoptosis induced by p53 activating agents used in chemotherapy. In this review, the evidence for a role of miR-34a and miR-34b/c in the apoptotic response of normal and tumor cells is surveyed.
LinkOut: [PMID: 19461653]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions U87 , A172 , LN-Z308 , U373 , T98G , 0308
Location of target site 3'UTR
Tools used in this research miRBase Target Database
Original Description (Extracted from the article) ... Transfection of miR-34a also reduced the protein levels of Notch-1, Notch-2, and CDK6 in glioma cells and stem cells (Fig. 1A).//Together, these data show that miR-34a binds to c-Met 3'-UTR, Notch-1 3'-UTR, and Notch-2 3'-UTR and down-regulates c-Met, Notch-1, Notch-2, and CDK6 protein expressions. ...

- Li, Y. Guessous, F. Zhang, Y. Dipierro, C. et al., 2009, Cancer Res.

Article - Li, Y. Guessous, F. Zhang, Y. Dipierro, C. et al.
- Cancer Res, 2009
MicroRNA-34a (miR-34a) is a transcriptional target of p53 that is down-regulated in some cancer cell lines. We studied the expression, targets, and functional effects of miR-34a in brain tumor cells and human gliomas. Transfection of miR-34a down-regulated c-Met in human glioma and medulloblastoma cells and Notch-1, Notch-2, and CDK6 protein expressions in glioma cells. miR-34a expression inhibited c-Met reporter activities in glioma and medulloblastoma cells and Notch-1 and Notch-2 3'-untranslated region reporter activities in glioma cells and stem cells. Analysis of human specimens showed that miR-34a expression is down-regulated in glioblastoma tissues as compared with normal brain and in mutant p53 gliomas as compared with wild-type p53 gliomas. miR-34a levels in human gliomas inversely correlated to c-Met levels measured in the same tumors. Transient transfection of miR-34a into glioma and medulloblastoma cell lines strongly inhibited cell proliferation, cell cycle progression, cell survival, and cell invasion, but transfection of miR-34a into human astrocytes did not affect cell survival and cell cycle status. Forced expression of c-Met or Notch-1/Notch-2 transcripts lacking the 3'-untranslated region sequences partially reversed the effects of miR-34a on cell cycle arrest and cell death in glioma cells and stem cells, respectively. Also, transient expression of miR-34a in glioblastoma cells strongly inhibited in vivo glioma xenograft growth. Together, these findings represent the first comprehensive analysis of the role of miR-34a in gliomas. They show that miR-34a suppresses brain tumor growth by targeting c-Met and Notch. The results also suggest that miR-34a could serve as a potential therapeutic agent for brain tumors.
LinkOut: [PMID: 19773441]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions HeLa , JAR , SiHa
Location of target site 3'UTR
Tools used in this research TargetScan , PicTar
Original Description (Extracted from the article) ... Notch1 and Jagged1 are functional targets of miR-34a//Besides, we have knockdown miR-34a in SiHa cells which has the highest endogenous miR-34a expression. We found that the expression of Notch1, Jagged1 and Hes-1 were increased (Supplementary Figure 3).//By using functional assays, miR-34a was demonstrated to bind to the 3’UTRs of Notch1 and Jagged1. ...

- Pang, R. T. Leung, C. O. Ye, T. M. Liu, W. et al., 2010, Carcinogenesis.

Article - Pang, R. T. Leung, C. O. Ye, T. M. Liu, W. et al.
- Carcinogenesis, 2010
MicroRNAs (miRNAs) are small non-coding RNAs that regulate the expression of other genes by transcriptional inhibition or translational repression. miR-34a is a known tumor suppressor gene and inhibits abnormal cell growth. However, its role in other tumorigenic processes is not fully known. This study aimed to investigate the action of miR-34a on cell invasion. We found that miR-34a is expressed at various levels in cervical cancer (HeLa, SiHa, C4I, C33a and CaSki) and trophoblast (BeWo and JAR) cell lines. Transient forced expression of miR-34a did not affect the proliferation of these cell lines. Computational miRNA target prediction suggested that Notch1 and Jagged1 were targets of miR-34a. By using functional assays, miR-34a was demonstrated to bind to the 3' untranslated regions of Notch1 and Jagged1. Forced expression of miR-34a altered the expression of Notch1 and Jagged1 protein as well as Notch signaling as shown by the response of Hairy Enhancer of Split-1 protein to these treatments using western blot analysis. Forced expression of miR-34a suppressed the invasiveness of HeLa and JAR cells. By using gamma-secretase inhibitor (N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester) that interfered Notch signaling and RNA interference that knockdown Notch1 expression, we confirmed that downregulation of Notch1 reduced the invasiveness of the cells. Transfection of intracellular domain of Notch nullifies the effect of miR-34a on the invasiveness of the cells. Besides, we identified that miR-34a affected cell invasion by regulating expression of urokinase plasminogen activator through Notch. Our results provide evidence that miR-34a inhibits invasiveness through regulation of the Notch pathway and its downstream matrix degrading enzyme.
LinkOut: [PMID: 20351093]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Immunofluorescence , Immunohistochemistry , Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions HK-2
Original Description (Extracted from the article) ... miR-34a directly targets Jagged1 and Notch1, essential negative regulators of the Notch pathway. ...

- Du, R. Sun, W. Xia, L. Zhao, A. Yu, Y. et al., 2012, PLoS One.

Article - Du, R. Sun, W. Xia, L. Zhao, A. Yu, Y. et al.
- PLoS One, 2012
BACKGROUND: Hypoxia-induced renal tubular cell epithelial-mesenchymal transition (EMT) is an important event leading to renal fibrosis. MicroRNAs (miRNAs) are small non-coding RNA molecules that bind to their mRNA targets, thereby leading to translational repression. The role of miRNA in hypoxia-induced EMT is largely unknown. METHODOLOGY/PRINCIPAL FINDINGS: miRNA profiling was performed for the identification of differentially expressed miRNAs in HK-2 cells under normal and low oxygen, and the results were then verified by quantitative real time RT-PCR (qRT-PCR). The function of miRNAs in hypoxia-induced renal tubular cell EMT was assessed by the transfection of specific miRNA inhibitors and mimics. Luciferase reporter gene assays and western blot analysis were performed to validate the target genes of miR-34a. siRNA against Jagged1 was designed to investigate the role of the miR-34a-Notch pathway in hypoxia induced renal tubular cell EMT. miRNA-34a was identified as being downregulated in hypoxic renal tubular epithelial cells. Inhibition of miR-34a expression in HK-2 cells, which highly express endogenous miR-34a, promoted a mesenchymal phenotype accompanied by reduced expression of the epithelial marker Z0-1, E-cadherin and increased expression of the mesenchymal markers alpha-SMA and vimentin. Conversely, miR-34a mimics effectively prevented hypoxia-induced EMT. Transfection of miRNA-34a in HK-2 cells under hypoxia abolished hypoxia-induced expression of Notch1 and Jagged1 as well as Notch downstream signals, such as snail. Western blot analysis and luciferase reporter gene assays showed direct evidence for miR-34a targeting Notch1 and Jagged1. siRNAs against Jagged1 or Notch1 effectively prevented miR-34a inhibitor-induced tubular epithelial cell EMT. CONCLUSIONS/SIGNIFICANCE: Our study provides evidence that the hypoxia-induced decrease of miR-34a expression could promote EMT in renal tubular epithelial cells by directly targeting Notch1 and Jagged1, and subsequently, Notch downstream signaling.
LinkOut: [PMID: 22363487]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions 253J , J82
Location of target site 3'UTR
Tools used in this research TargetRank , TargetScan
Original Description (Extracted from the article) ... Notch1 as a direct target of miR-34a ...

- Zhang, C. Yao, Z. Zhu, M. Ma, X. Shi, T. et al., 2012, J Huazhong Univ Sci Technolog Med Sci.

Article - Zhang, C. Yao, Z. Zhu, M. Ma, X. Shi, T. et al.
- J Huazhong Univ Sci Technolog Med Sci, 2012
MicroRNAs (miRNAs or miRs) are a class of short, non-coding RNAs that participate in various oncological processes. This study aims to explore the roles of microRNA-34a (miR-34a) in invasive urothelial bladder carcinoma. miR-34a was transfected into bladder cancer cell lines 253J and J82. The miR-34a expression levels in tissues and cells were detected by using qRT-PCR. The Notch1 expression was detected by qRT-PCR and Western blotting. Cell migratory and invasive abilities were measured by Transwell chamber assay. Bioinformatics and luciferase assay were performed to predict and analyze the binding sites between miRNA-34a and Notch1. It was found that there was aberrant expression of miR-34a in bladder cancer tissues. Moreover, we revealed that ectopic expression of miR-34a suppressed cell migration and invasion, while forced expression of Notch1 increased cell migratory and invasive abilities. Finally, we observed that miR-34a transfection significantly down-regulated luciferase activity and reduced the mRNA and protein levels of Notch1. Our study concluded that microRNA-34a antagonizes Notch1 and inhibits cell migration and invasion of bladder cancer cells, which indicates the tumor-suppressive function of microRNA-34a in bladder cancer.
LinkOut: [PMID: 22684561]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions MCF-7 , ADR
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... miR-34a directly interacts with the 3'UTR of the Notch1 gene ...

- Li, X. J. Ji, M. H. Zhong, S. L. Zha, Q. B. et al., 2012, Arch Med Res.

Article - Li, X. J. Ji, M. H. Zhong, S. L. Zha, Q. B. et al.
- Arch Med Res, 2012
BACKGROUND AND AIMS: MicroRNA-34a (miR-34a) as a tumor suppressor has been reported in many other studies. However, its role in modulating the sensitivity of breast cancer cells to adriamycin (ADR) remains unclear. The aim of this study is to evaluate the role of miR-34a in the sensitivity of breast cancer cells to ADR. METHODS: The role of miR-34a in breast cancer cells was detected using MTT assay, flow cytometry assay, real-time PCR and Western blot, etc. The association of miR-34a and Notch1 was analyzed by dual-luciferase reporter assay and Notch1-siRNA technology. Real-time PCR assay was performed to test the expression of miR-34a and Notch1 in 38 selective breast cancer tissue samples. RESULTS: Ectopic overexpression of miR-34a could sensitize MCF-7 breast cancer cells to ADR. MiR-34a mimic could inhibit the luciferase activity of the construct containing wild-type 3' UTR of Notch1 in MCF-7/ADR cells. Notch1-siRNA could partially reverse the effect of miR-34a inhibitor in inducing chemoresistance of MCF-7 cells to ADR. Further, there was an inverse association between Notch1 and miR-34a expression in breast cancer. CONCLUSION: Dysregulation of miR-34a plays critical roles in the acquired ADR resistance of breast cancer, at least in part via targeting Notch1.
LinkOut: [PMID: 23085450]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Western blot
Conditions Human fetal dental papilla
Location of target site 3'UTR
Tools used in this research miRBase Target Database
Original Description (Extracted from the article) ... We propose that by targeting NOTCH1, miR-34a suppresses the NOTCH signals in developing human dental mesenchyme ...

- Wan, M. Gao, B. Sun, F. Tang, Y. Ye, L. et al., 2012, PLoS One.

Article - Wan, M. Gao, B. Sun, F. Tang, Y. Ye, L. et al.
- PLoS One, 2012
Odontogenesis relies on the reciprocal signaling interactions between dental epithelium and neural crest-derived mesenchyme, which is regulated by several signaling pathways. Subtle changes in the activity of these major signaling pathways can have dramatic effects on tooth development. An important regulator of such subtle changes is the fine tuning function of microRNAs (miRNAs). However, the underlying mechanism by which miRNAs regulate tooth development remains elusive. This study determined the expression of miRNAs during cytodifferentiation in the human tooth germ and studied miR-34a as a regulator of dental papilla cell differentiation. Using microarrays, miRNA expression profiles were established at selected times during development (early bell stage or late bell stage) of the human fetal tooth germ. We identified 29 differentially expressed miRNAs from early bell stage/late bell stage comparisons. Out of 6 miRNAs selected for validation by qPCR, all transcripts were confirmed to be differentially expressed. miR-34a was selected for further investigation because it has been previously reported to regulate organogenesis. miR-34a mimics and inhibitors were transfected into human fetal dental papilla cells, mRNA levels of predicted target genes were detected by quantitative real-time PCR, and levels of putative target proteins were examined by western blotting. ALP and DSPP expression were also tested by qPCR, western blotting, and immunofluorescence. Findings from these studies suggested that miR-34a may play important roles in dental papilla cell differentiation during human tooth development by targeting NOTCH and TGF-beta signaling.
LinkOut: [PMID: 23226240]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
492 hsa-miR-34a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000071 BIRC3 baculoviral IAP repeat-containing 3 2 1
MIRT000073 GRM7 glutamate receptor, metabotropic 7 3 2
MIRT000074 JAG1 jagged 1 (Alagille syndrome) 5 2
MIRT000695 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 6 6
MIRT000720 MYB v-myb myeloblastosis viral oncogene homolog (avian) 4 2
MIRT000748 HMGA2 high mobility group AT-hook 2 2 2
MIRT000750 E2F5 E2F transcription factor 5, p130-binding 2 1
MIRT000751 CDC25C cell division cycle 25 homolog C (S. pombe) 2 1
MIRT000759 MET met proto-oncogene (hepatocyte growth factor receptor) 4 10
MIRT000763 CDK4 cyclin-dependent kinase 4 5 6
MIRT000768 CCNE2 cyclin E2 4 4
MIRT000980 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 4 7
MIRT001010 CCND3 cyclin D3 2 1
MIRT001011 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT001012 CDK6 cyclin-dependent kinase 6 5 8
MIRT001013 CCND1 cyclin D1 5 6
MIRT001231 WNT1 wingless-type MMTV integration site family, member 1 4 2
MIRT001232 AXIN2 axin 2 2 1
MIRT001756 E2F3 E2F transcription factor 3 5 10
MIRT001757 DLL1 delta-like 1 (Drosophila) 2 3
MIRT001758 VAMP2 vesicle-associated membrane protein 2 (synaptobrevin 2) 1 1
MIRT002098 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 4 11
MIRT002298 BCL2 B-cell CLL/lymphoma 2 5 13
MIRT002875 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 5 11
MIRT003148 E2f3 E2F transcription factor 3 3 1
MIRT003149 Mycn v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 3 1
MIRT003150 Sirt1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 3 1
MIRT003356 HNF4A hepatocyte nuclear factor 4, alpha 4 2
MIRT004045 YY1 YY1 transcription factor 3 2
MIRT004109 MAGEA12 melanoma antigen family A, 12 3 1
MIRT004110 MAGEA6 melanoma antigen family A, 6 4 1
MIRT004111 MAGEA3 melanoma antigen family A, 3 4 1
MIRT004112 MAGEA2 melanoma antigen family A, 2 4 1
MIRT004403 MDM4 Mdm4 p53 binding protein homolog (mouse) 2 1
MIRT004483 MAP2K1 mitogen-activated protein kinase kinase 1 4 1
MIRT004502 PEA15 phosphoprotein enriched in astrocytes 15 2 2
MIRT004513 VEGFA vascular endothelial growth factor A 2 1
MIRT004617 IFNB1 interferon, beta 1, fibroblast 3 1
MIRT004821 E2F1 E2F transcription factor 1 3 2
MIRT004905 TNFRSF6B tumor necrosis factor receptor superfamily, member 6b, decoy 2 1
MIRT005029 NOTCH2 Notch homolog 2 (Drosophila) 5 2
MIRT005075 EMP1 epithelial membrane protein 1 2 1
MIRT005480 CD44 CD44 molecule (Indian blood group) 4 1
MIRT005546 FOXP1 forkhead box P1 3 2
MIRT005606 MAP3K9 mitogen-activated protein kinase kinase kinase 9 4 1
MIRT005723 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 1 1
MIRT005724 SPI1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 1 1
MIRT005760 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 2 2
MIRT006212 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 3 1
MIRT006222 NANOG Nanog homeobox 2 1
MIRT006223 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006254 IMPA1 inositol(myo)-1(or 4)-monophosphatase 1 1 1
MIRT006255 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT006286 ULBP2 UL16 binding protein 2 2 1
MIRT006304 SYT1 synaptotagmin I 2 1
MIRT006305 STX1A syntaxin 1A (brain) 2 1
MIRT006546 FOSL1 FOS-like antigen 1 3 1
MIRT006576 EPHA5 EPH receptor A5 2 1
MIRT006664 AXL AXL receptor tyrosine kinase 4 2
MIRT006869 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT006874 KLB klotho beta 1 1
MIRT007112 TP53 tumor protein p53 1 1
MIRT007193 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT007204 BMP7 bone morphogenetic protein 7 1 1
MIRT025210 KIF4A kinesin family member 4A 1 1
MIRT025211 HIST1H2AB histone cluster 1, H2ab 1 1
MIRT025212 ATXN2L ataxin 2-like 1 2
MIRT025213 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT025214 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT025215 ACSL4 acyl-CoA synthetase long-chain family member 4 2 1
MIRT025216 HIST3H3 histone cluster 3, H3 1 1
MIRT025217 TNPO3 transportin 3 1 1
MIRT025218 HIST1H2BE histone cluster 1, H2be 1 1
MIRT025219 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT025220 STAM2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 1 1
MIRT025221 HIST1H3J histone cluster 1, H3j 1 1
MIRT025222 HIST2H3A histone cluster 2, H3a 1 1
MIRT025223 HIST1H4I histone cluster 1, H4i 1 1
MIRT025224 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT025225 CRYAA crystallin, alpha A 1 1
MIRT025226 RPIA ribose 5-phosphate isomerase A 1 1
MIRT025227 HIST1H4K histone cluster 1, H4k 1 1
MIRT025228 RNF40 ring finger protein 40 1 1
MIRT025229 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT025230 MST1 macrophage stimulating 1 (hepatocyte growth factor-like) 1 1
MIRT025231 CCNL1 cyclin L1 1 1
MIRT025232 MCM3 minichromosome maintenance complex component 3 1 1
MIRT025233 MTA2 metastasis associated 1 family, member 2 3 2
MIRT025234 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT025235 HIST2H4A histone cluster 2, H4a 1 1
MIRT025236 H1FX H1 histone family, member X 1 1
MIRT025237 KIF5B kinesin family member 5B 1 1
MIRT025238 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT025239 HIST2H2AB histone cluster 2, H2ab 1 1
MIRT025240 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT025241 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT025242 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT025243 TOMM40 translocase of outer mitochondrial membrane 40 homolog (yeast) 1 1
MIRT025244 WBP11 WW domain binding protein 11 1 1
MIRT025245 MAP1B microtubule-associated protein 1B 1 1
MIRT025246 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT025247 SETD3 SET domain containing 3 1 1
MIRT025248 PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 1 1
MIRT025249 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT025250 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT025251 DSP desmoplakin 1 1
MIRT025252 HIST1H4A histone cluster 1, H4a 1 1
MIRT025253 HIST1H2BO histone cluster 1, H2bo 1 1
MIRT025254 DHCR7 7-dehydrocholesterol reductase 1 1
MIRT025255 GRB2 growth factor receptor-bound protein 2 1 1
MIRT025256 LRRC40 leucine rich repeat containing 40 1 1
MIRT025257 GAS1 growth arrest-specific 1 1 1
MIRT025258 MTDH metadherin 1 1
MIRT025259 RRAS related RAS viral (r-ras) oncogene homolog 1 1
MIRT025260 SPTAN1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 1 1
MIRT025261 RALB v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) 1 1
MIRT025262 BAG6 HLA-B associated transcript 3 1 1
MIRT025263 BCLAF1 BCL2-associated transcription factor 1 1 1
MIRT025264 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT025265 ARF6 ADP-ribosylation factor 6 1 1
MIRT025266 RBM26 RNA binding motif protein 26 1 1
MIRT025267 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT025268 UHRF1 ubiquitin-like with PHD and ring finger domains 1 2 2
MIRT025269 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT025270 RRM2 ribonucleotide reductase M2 1 1
MIRT025271 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT025272 DDX56 DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 1 1
MIRT025273 HIST1H2BB histone cluster 1, H2bb 1 1
MIRT025274 NUPL2 nucleoporin like 2 1 1
MIRT025275 WASF2 WAS protein family, member 2 1 1
MIRT025276 HIST3H2BB histone cluster 3, H2bb 1 1
MIRT025277 AHNAK AHNAK nucleoprotein 1 1
MIRT025278 STAT1 signal transducer and activator of transcription 1, 91kDa 1 1
MIRT025279 HIST1H4L histone cluster 1, H4l 1 1
MIRT025280 ARHGAP1 Rho GTPase activating protein 1 2 2
MIRT025281 ERLIN2 ER lipid raft associated 2 1 1
MIRT025282 HIST1H4D histone cluster 1, H4d 1 1
MIRT025283 CXCL9 chemokine (C-X-C motif) ligand 9 1 1
MIRT025284 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT025285 HIST1H1B histone cluster 1, H1b 1 1
MIRT025286 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT025287 HIST1H3G histone cluster 1, H3g 1 1
MIRT025288 AIMP2 aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 1 1
MIRT025289 EFNB1 ephrin-B1 1 1
MIRT025290 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT025291 ITGA6 integrin, alpha 6 1 1
MIRT025293 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT025294 ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like 1 1
MIRT025295 KIF11 kinesin family member 11 1 1
MIRT025296 EHD1 EH-domain containing 1 1 1
MIRT025297 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT025298 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 1 1
MIRT025299 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT025300 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT025301 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT025302 HSPA1A heat shock 70kDa protein 1A 1 1
MIRT025303 HIST1H1E histone cluster 1, H1e 1 1
MIRT025304 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT025305 IMP3 IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT025306 CLTB clathrin, light chain B 1 1
MIRT025307 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT025309 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT025310 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT025311 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT025312 RBM12 RNA binding motif protein 12 1 1
MIRT025313 TSN translin 1 1
MIRT025314 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT025315 SNX12 sorting nexin 12 1 1
MIRT025316 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT025317 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT025318 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT025319 MTAP methylthioadenosine phosphorylase 2 2
MIRT025320 HIBADH 3-hydroxyisobutyrate dehydrogenase 1 1
MIRT025321 CALD1 caldesmon 1 1 1
MIRT025322 MCM4 minichromosome maintenance complex component 4 1 1
MIRT025324 HIST1H3E histone cluster 1, H3e 1 1
MIRT025325 BTF3L4 basic transcription factor 3-like 4 1 1
MIRT025326 ZSWIM7 zinc finger, SWIM-type containing 7 1 1
MIRT025327 THOC2 THO complex 2 1 1
MIRT025328 ECD ecdysoneless homolog (Drosophila) 1 1
MIRT025329 HIST1H4J histone cluster 1, H4j 1 1
MIRT025330 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT025331 ANXA4 annexin A4 1 1
MIRT025332 STAG2 stromal antigen 2 1 1
MIRT025333 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT025334 CFL1 cofilin 1 (non-muscle) 1 1
MIRT025335 KIF2C kinesin family member 2C 1 1
MIRT025336 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 1 1
MIRT025337 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT025338 CAPRIN1 cell cycle associated protein 1 1 1
MIRT025339 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT025340 EPS8L2 EPS8-like 2 1 1
MIRT025341 CAPN1 calpain 1, (mu/I) large subunit 1 1
MIRT025342 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT025343 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT025344 ZFR zinc finger RNA binding protein 1 1
MIRT025345 GDI1 GDP dissociation inhibitor 1 1 1
MIRT025346 IRGQ immunity-related GTPase family, Q 1 1
MIRT025347 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT025348 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 1
MIRT025349 HIST1H2AL histone cluster 1, H2al 1 1
MIRT025350 KIF2A kinesin heavy chain member 2A 1 1
MIRT025351 AKR1A1 aldo-keto reductase family 1, member A1 (aldehyde reductase) 1 1
MIRT025352 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT025353 HIST1H4C histone cluster 1, H4c 1 1
MIRT025354 HIST1H4F histone cluster 1, H4f 1 1
MIRT025355 APOL2 apolipoprotein L, 2 1 1
MIRT025356 TJP2 tight junction protein 2 (zona occludens 2) 1 1
MIRT025357 NSUN5 NOP2/Sun domain family, member 5 1 1
MIRT025358 HDLBP high density lipoprotein binding protein 1 1
MIRT025359 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT025360 PYGB phosphorylase, glycogen; brain 1 1
MIRT025361 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT025362 QDPR quinoid dihydropteridine reductase 1 1
MIRT025363 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT025364 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT025365 UBAP2 ubiquitin associated protein 2 1 1
MIRT025366 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT025367 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT025368 CYB5B cytochrome b5 type B (outer mitochondrial membrane) 1 1
MIRT025369 PLCG1 phospholipase C, gamma 1 1 1
MIRT025370 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT025371 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT025372 PUM2 pumilio homolog 2 (Drosophila) 1 1
MIRT025373 B4GALT3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 1 1
MIRT025374 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT025375 TNRC18 trinucleotide repeat containing 18 1 1
MIRT025376 TSPAN14 tetraspanin 14 1 1
MIRT025377 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT025378 ZNF644 zinc finger protein 644 1 1
MIRT025379 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT025380 LEF1 lymphoid enhancer-binding factor 1 2 1
MIRT025381 ACSL1 acyl-CoA synthetase long-chain family member 1 2 1
MIRT025382 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT025383 ERLIN1 ER lipid raft associated 1 2 2
MIRT025384 PLIN3 perilipin 3 1 1
MIRT025385 CPT2 carnitine palmitoyltransferase 2 1 2
MIRT025386 MCMBP chromosome 10 open reading frame 119 1 1
MIRT025387 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT025388 HIST1H2AA histone cluster 1, H2aa 1 1
MIRT025389 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT025390 DHX38 DEAH (Asp-Glu-Ala-His) box polypeptide 38 1 1
MIRT025391 CDKN2AIP CDKN2A interacting protein 1 1
MIRT025392 RBCK1 RanBP-type and C3HC4-type zinc finger containing 1 1 1
MIRT025393 AKR7L aldo-keto reductase family 7-like 1 1
MIRT025394 C12orf5 chromosome 12 open reading frame 5 1 1
MIRT025395 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1 1
MIRT025396 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 1 1
MIRT025397 HIST2H4B histone cluster 2, H4b 2 2
MIRT025398 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT025399 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT025400 MCM2 minichromosome maintenance complex component 2 1 1
MIRT025401 H3F3A H3 histone, family 3A 2 2
MIRT025402 HIST1H1D histone cluster 1, H1d 1 1
MIRT025403 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT025404 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT025405 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT025406 HIST1H3I histone cluster 1, H3i 1 1
MIRT025407 HIST1H4E histone cluster 1, H4e 1 1
MIRT025408 SERPINB1 serpin peptidase inhibitor, clade B (ovalbumin), member 1 1 1
MIRT025409 NDRG1 N-myc downstream regulated 1 1 1
MIRT025410 HIST1H3H histone cluster 1, H3h 1 1
MIRT025411 UBQLN2 ubiquilin 2 1 1
MIRT025412 AFAP1L2 actin filament associated protein 1-like 2 1 1
MIRT025413 PUS7 pseudouridylate synthase 7 homolog (S. cerevisiae) 1 1
MIRT025414 CDC20 cell division cycle 20 homolog (S. cerevisiae) 2 2
MIRT025415 HIST2H2BE histone cluster 2, H2be 1 1
MIRT025416 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT025417 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT025418 POP1 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT025419 FAM3C family with sequence similarity 3, member C 1 1
MIRT025420 EPHA2 EPH receptor A2 1 1
MIRT025421 ADNP activity-dependent neuroprotector homeobox 1 1
MIRT025422 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT025423 HIST1H4H histone cluster 1, H4h 1 1
MIRT025424 SURF4 surfeit 4 1 2
MIRT025425 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025426 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT025427 FIGN fidgetin 1 1
MIRT025428 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT025429 TPPP tubulin polymerization promoting protein 1 1
MIRT025430 FAM76A family with sequence similarity 76, member A 1 2
MIRT025431 LDHA lactate dehydrogenase A 2 1
MIRT025432 RSU1 Ras suppressor protein 1 1 1
MIRT025433 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT025434 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT025435 TMOD2 tropomodulin 2 (neuronal) 1 1
MIRT025436 SEPT1 septin 1 1 1
MIRT025437 GIGYF2 GRB10 interacting GYF protein 2 1 1
MIRT025438 H3F3AP6 H3 histone pseudogene 1 1
MIRT025439 KLC1 kinesin light chain 1 1 1
MIRT025440 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT025441 HIST1H2AG histone cluster 1, H2ag 1 1
MIRT025442 PPP6R3 SAPS domain family, member 3 1 1
MIRT025443 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 1 1
MIRT025444 UBE3C ubiquitin protein ligase E3C 1 1
MIRT025445 GFPT1 glutamine--fructose-6-phosphate transaminase 1 1 1
MIRT025446 HIST1H2AK histone cluster 1, H2ak 1 1
MIRT025447 TXNRD1 thioredoxin reductase 1 1 1
MIRT025448 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT025449 HIST1H3D histone cluster 1, H3d 1 1
MIRT025450 TFRC transferrin receptor (p90, CD71) 1 1
MIRT025451 HIST1H3C histone cluster 1, H3c 1 1
MIRT025452 CORO1B coronin, actin binding protein, 1B 1 1
MIRT025453 RCN1 reticulocalbin 1, EF-hand calcium binding domain 1 1
MIRT025454 ME1 malic enzyme 1, NADP(+)-dependent, cytosolic 1 1
MIRT025455 DUT deoxyuridine triphosphatase 1 1
MIRT025456 SAA1 serum amyloid A1 1 1
MIRT025457 CARF amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 1 1
MIRT025458 HIST2H3C histone cluster 2, H3c 1 1
MIRT025459 KTN1 kinectin 1 (kinesin receptor) 1 1
MIRT025460 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT025461 HIST1H4B histone cluster 1, H4b 1 1
MIRT025462 STRAP serine/threonine kinase receptor associated protein 1 1
MIRT025463 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT025464 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT025465 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT025466 TATDN2 TatD DNase domain containing 2 1 1
MIRT025467 POGZ pogo transposable element with ZNF domain 1 1
MIRT025469 MCM7 minichromosome maintenance complex component 7 1 1
MIRT025470 CKAP5 cytoskeleton associated protein 5 1 1
MIRT025471 SH3BGRL3 SH3 domain binding glutamic acid-rich protein like 3 1 1
MIRT025472 HIST1H2BA histone cluster 1, H2ba 1 1
MIRT025473 CTTN cortactin 1 1
MIRT025474 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT025475 RTN4 reticulon 4 2 2
MIRT025476 S100A2 S100 calcium binding protein A2 1 1
MIRT025477 HIST1H2AH histone cluster 1, H2ah 1 1
MIRT025478 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT025479 CAPZB capping protein (actin filament) muscle Z-line, beta 1 1
MIRT025480 TES testis derived transcript (3 LIM domains) 1 1
MIRT025481 FEN1 flap structure-specific endonuclease 1 1 1
MIRT025482 GPI glucose-6-phosphate isomerase 1 1
MIRT025483 DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 1 1
MIRT025484 NELFCD TH1-like (Drosophila) 1 1
MIRT025485 HIST1H3A histone cluster 1, H3a 1 1
MIRT025486 HIST2H2AA4 histone cluster 2, H2aa4 1 1
MIRT025487 TYMS thymidylate synthetase 1 1
MIRT025488 EFHD2 EF-hand domain family, member D2 1 1
MIRT025489 PKP2 plakophilin 2 1 1
MIRT025490 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT025491 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT025492 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT025493 CAPG capping protein (actin filament), gelsolin-like 1 1
MIRT025494 GYG1 glycogenin 1 1 1
MIRT025495 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT025496 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT025497 FAM104A family with sequence similarity 104, member A 1 1
MIRT025498 MYOF myoferlin 1 1
MIRT025499 CMAS cytidine monophosphate N-acetylneuraminic acid synthetase 1 1
MIRT025500 MAP4 microtubule-associated protein 4 1 1
MIRT025501 HIST1H2AD histone cluster 1, H2ad 1 1
MIRT025502 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT025503 HIST2H3D histone cluster 2, H3d 1 1
MIRT025504 ACSL6 acyl-CoA synthetase long-chain family member 6 1 1
MIRT025505 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT025507 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT025508 SLC6A16 solute carrier family 6, member 16 1 1
MIRT025509 NT5E 5'-nucleotidase, ecto (CD73) 1 1
MIRT025510 IMMT inner membrane protein, mitochondrial 1 1
MIRT025511 NUP98 nucleoporin 98kDa 1 1
MIRT025513 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT025514 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT025515 DTYMK deoxythymidylate kinase (thymidylate kinase) 1 1
MIRT025516 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT025517 PTMS parathymosin 1 1
MIRT025518 HIST1H2AM histone cluster 1, H2am 1 1
MIRT025519 HIST1H2AJ histone cluster 1, H2aj 1 1
MIRT025520 USP47 ubiquitin specific peptidase 47 1 1
MIRT025521 MCM5 minichromosome maintenance complex component 5 1 1
MIRT025522 VCL vinculin 1 1
MIRT025523 MYO1C myosin IC 1 1
MIRT025524 TMEM109 transmembrane protein 109 1 1
MIRT025525 HIST4H4 histone cluster 4, H4 1 1
MIRT025526 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT025527 KIAA0196 KIAA0196 1 1
MIRT025528 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT025529 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT025530 MTMR9 myotubularin related protein 9 1 1
MIRT025531 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT025532 SATB2 SATB homeobox 2 1 1
MIRT025533 ACSS1 acyl-CoA synthetase short-chain family member 1 1 1
MIRT025534 DRG1 developmentally regulated GTP binding protein 1 1 1
MIRT025535 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT025536 HIST1H1C histone cluster 1, H1c 1 1
MIRT025537 HIST1H2AI histone cluster 1, H2ai 1 1
MIRT025538 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT025539 IK IK cytokine, down-regulator of HLA II 1 1
MIRT025540 HIST3H2A histone cluster 3, H2a 1 1
MIRT025541 HIST1H1A histone cluster 1, H1a 1 1
MIRT025542 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT025543 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT025544 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT025545 MCM6 minichromosome maintenance complex component 6 1 1
MIRT025546 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT025547 AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) 1 1
MIRT025548 TBL3 transducin (beta)-like 3 1 1
MIRT025549 HIST1H3B histone cluster 1, H3b 1 1
MIRT025550 SORT1 sortilin 1 1 1
MIRT025551 GNPDA1 glucosamine-6-phosphate deaminase 1 1 1
MIRT025552 HOXB8 homeobox B8 1 1
MIRT025553 REEP3 receptor accessory protein 3 1 1
MIRT025554 TXNIP thioredoxin interacting protein 1 1
MIRT025555 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 1
MIRT025556 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT025557 HDAC1 histone deacetylase 1 2 1
MIRT025558 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT025559 HIST1H3F histone cluster 1, H3f 1 1
MIRT025560 TPM1 tropomyosin 1 (alpha) 1 1
MIRT025561 SNAP23 synaptosomal-associated protein, 23kDa 1 1
MIRT025562 STAG3L3 stromal antigen 3-like 3 1 1
MIRT025563 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT025564 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT025565 DDAH2 dimethylarginine dimethylaminohydrolase 2 1 1
MIRT025566 RAB3GAP2 RAB3 GTPase activating protein subunit 2 (non-catalytic) 1 1
MIRT025567 UCK2 uridine-cytidine kinase 2 1 1
MIRT025568 U2SURP U2-associated SR140 protein 1 1
MIRT025569 SFN stratifin 1 1
MIRT025570 TRAIP TRAF interacting protein 1 1
MIRT025572 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT025573 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT025574 NUP62 nucleoporin 62kDa 1 1
MIRT025575 TNPO1 transportin 1 1 1
MIRT025576 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 1 1
MIRT025577 YIPF2 Yip1 domain family, member 2 1 1
MIRT025578 METAP1 methionyl aminopeptidase 1 1 1
MIRT025579 SOCS4 suppressor of cytokine signaling 4 1 1
MIRT025580 CDON Cdon homolog (mouse) 1 1
MIRT025581 POU2F1 POU class 2 homeobox 1 1 1
MIRT025582 PHF19 PHD finger protein 19 1 1
MIRT025583 UBP1 upstream binding protein 1 (LBP-1a) 1 1
MIRT025584 TPD52 tumor protein D52 2 2
MIRT025585 CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) 2 1
MIRT047341 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT047342 CYTH1 cytohesin 1 1 1
MIRT047343 YBX1 Y box binding protein 1 1 1
MIRT047344 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT047345 SNX3 sorting nexin 3 1 1
MIRT047346 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT047347 OPA1 optic atrophy 1 (autosomal dominant) 1 1
MIRT047348 MTMR2 myotubularin related protein 2 1 1
MIRT047349 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT047350 ACTG1 actin, gamma 1 1 1
MIRT047351 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT047352 EXT2 exostosin 2 1 1
MIRT047353 RPL37 ribosomal protein L37 1 1
MIRT047354 MCM10 minichromosome maintenance complex component 10 1 1
MIRT047355 CEP170 centrosomal protein 170kDa 1 1
MIRT047356 WDR77 WD repeat domain 77 1 1
MIRT047357 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT047358 FAM208A chromosome 3 open reading frame 63 1 1
MIRT047359 RBM33 RNA binding motif protein 33 1 1
MIRT047360 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047361 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT047362 ALS2 amyotrophic lateral sclerosis 2 (juvenile) 1 1
MIRT047363 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT047364 RPS2 ribosomal protein S2 1 1
MIRT047365 RNF167 ring finger protein 167 1 1
MIRT047366 NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 1 1
MIRT047367 PRR3 proline rich 3 1 1
MIRT047368 RBM15B RNA binding motif protein 15B 1 1
MIRT047369 MAPK3 mitogen-activated protein kinase 3 1 1
MIRT047370 INTS10 integrator complex subunit 10 1 1
MIRT047371 MED15 mediator complex subunit 15 1 1
MIRT047372 ZNF598 zinc finger protein 598 1 1
MIRT047373 PTCD3 Pentatricopeptide repeat domain 3 1 1
MIRT047374 BIRC6 baculoviral IAP repeat-containing 6 1 1
MIRT047375 DEGS1 degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) 1 1
MIRT047376 D2HGDH D-2-hydroxyglutarate dehydrogenase 1 1
MIRT047377 DIABLO diablo homolog (Drosophila) 1 1
MIRT047378 RRAGA Ras-related GTP binding A 1 1
MIRT047379 RPS7 ribosomal protein S7 1 1
MIRT047380 PIGT phosphatidylinositol glycan anchor biosynthesis, class T 1 1
MIRT047381 RAP2A RAP2A, member of RAS oncogene family 1 1
MIRT047382 PRR12 proline rich 12 1 1
MIRT047383 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT047384 SON SON DNA binding protein 1 1
MIRT047385 CDAN1 congenital dyserythropoietic anemia, type I 1 1
MIRT047386 KANSL2 chromosome 12 open reading frame 41 1 1
MIRT047387 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 1 1
MIRT047388 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT047389 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT047390 SEPT7 septin 7 1 1
MIRT047391 TFAM transcription factor A, mitochondrial 1 1
MIRT047392 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT047393 FH fumarate hydratase 1 1
MIRT047394 GATA4 GATA binding protein 4 1 1
MIRT047395 FAM46A family with sequence similarity 46, member A 1 1
MIRT047396 LRRC28 leucine rich repeat containing 28 1 1
MIRT047397 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT047398 MFN2 mitofusin 2 1 1
MIRT047399 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1