Accession ID: MIRT002876 [miRNA, hsa-miR-30a-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30aLinkOut: [miRBase ]
Description Homo sapiens miR-30a stem-loop
Comment The mature sequences miR-30 . Related miRNAs are processed from the 5' arms of other precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736; mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30a-5p
Mature Sequence 6| UGUAAACAUCCUCGACUGGAAG |27
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-30a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , Other
Conditions SH-SY5Y
Location of target site 3'UTR
Original Description (Extracted from the article) ... overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. ...

- Fukuda, Y. Kawasaki, H. Taira, K., 2005, Nucleic Acids Symp Ser (Oxf).

Article - Fukuda, Y. Kawasaki, H. Taira, K.
- Nucleic Acids Symp Ser (Oxf), 2005
MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that inhibit protein translation in a sequence specific manner. We carried out microarray analyses of 180 human pre-miRNAs in neuroblastoma cell, SH-SY5Y, following stimulation by TPA. Twelve of the pre-miRNAs were up-regulated by the TPA stimulation. We also explored miRNA target genes associated with neuronal differentiation. Some miRNAs have complementarity with 3'UTR of the Notch1 gene, a regulator of neuronal differentiation, and luciferase assay showed that overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. Our results suggest that miRNAs can be associated with TPA induced signalling pathways and expression of Notch1 gene.
LinkOut: [PMID: 17150773]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
445 hsa-miR-30a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001946 BDNF brain-derived neurotrophic factor 2 1
MIRT002876 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 3 1
MIRT004509 BECN1 beclin 1, autophagy related 2 1
MIRT004785 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT005120 HNRNPM heterogeneous nuclear ribonucleoprotein M 2 1
MIRT005121 ELMOD2 ELMO/CED-12 domain containing 2 2 1
MIRT005122 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT005123 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 2 1
MIRT005124 TMEM87A transmembrane protein 87A 2 1
MIRT005125 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 2 1
MIRT005126 SEC62 SEC62 homolog (S. cerevisiae) 2 1
MIRT005127 CHD1 chromodomain helicase DNA binding protein 1 2 1
MIRT005128 JUN jun oncogene 2 1
MIRT005129 SLC4A10 solute carrier family 4, sodium bicarbonate transporter, member 10 2 1
MIRT005130 NT5E 5'-nucleotidase, ecto (CD73) 2 1
MIRT005131 LMNB2 lamin B2 2 1
MIRT005132 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 2 1
MIRT005133 TMEM41B transmembrane protein 41B 2 1
MIRT005134 CPNE8 copine VIII 2 1
MIRT005135 MBNL1 muscleblind-like (Drosophila) 2 1
MIRT005136 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 2 1
MIRT005137 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 2 1
MIRT005138 TMEM59 transmembrane protein 59 2 1
MIRT005139 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 2 1
MIRT005140 TMED3 transmembrane emp24 protein transport domain containing 3 2 1
MIRT005141 SLC38A1 solute carrier family 38, member 1 2 1
MIRT005142 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 2 1
MIRT005143 IFRD1 interferon-related developmental regulator 1 2 1
MIRT005144 PEX11B peroxisomal biogenesis factor 11 beta 2 1
MIRT005145 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 2 1
MIRT005146 SLC9A3R2 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2 2 1
MIRT005147 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 2 1
MIRT005148 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 2 1
MIRT005149 PTGFRN prostaglandin F2 receptor negative regulator 2 1
MIRT005150 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 2 1
MIRT005151 NCEH1 neutral cholesterol ester hydrolase 1 2 1
MIRT005152 SEC23A Sec23 homolog A (S. cerevisiae) 2 1
MIRT005153 PBRM1 polybromo 1 2 1
MIRT005154 MLLT11 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 2 1
MIRT005155 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 2 1
MIRT005156 DPY19L1 dpy-19-like 1 (C. elegans) 2 1
MIRT005157 C1D C1D nuclear receptor corepressor 2 1
MIRT005158 LTN1 ring finger protein 160 2 1
MIRT005159 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 2 1
MIRT005160 SLC38A2 solute carrier family 38, member 2 2 1
MIRT005161 PTPRK protein tyrosine phosphatase, receptor type, K 2 1
MIRT005162 WNT5A wingless-type MMTV integration site family, member 5A 2 1
MIRT005163 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 2 1
MIRT005164 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 2 1
MIRT005165 ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 2 1
MIRT005166 STMN1 stathmin 1 2 1
MIRT005167 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT005168 P4HA2 prolyl 4-hydroxylase, alpha polypeptide II 2 1
MIRT005169 LRRC8C leucine rich repeat containing 8 family, member C 2 1
MIRT005170 MPDU1 mannose-P-dolichol utilization defect 1 2 1
MIRT005171 THEM4 thioesterase superfamily member 4 2 1
MIRT005172 RAD23B RAD23 homolog B (S. cerevisiae) 2 1
MIRT005173 CNPY4 canopy 4 homolog (zebrafish) 2 1
MIRT005174 KRT85 keratin 85 2 1
MIRT005175 PGM1 phosphoglucomutase 1 2 1
MIRT005176 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 2 1
MIRT005177 PTRH1 peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) 2 1
MIRT005178 CDCP1 CUB domain containing protein 1 2 1
MIRT005179 ADPGK ADP-dependent glucokinase 2 1
MIRT005180 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 2 1
MIRT005181 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 2 1
MIRT005182 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 2 1
MIRT005183 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 2 1
MIRT005184 NT5C3 5'-nucleotidase, cytosolic III 2 1
MIRT005185 TMCO1 transmembrane and coiled-coil domains 1 2 1
MIRT005186 TMED7 transmembrane emp24 protein transport domain containing 7 2 1
MIRT005187 TMED2 transmembrane emp24 domain trafficking protein 2 2 1
MIRT005188 PPP2R4 protein phosphatase 2A activator, regulatory subunit 4 2 1
MIRT005189 CEP72 centrosomal protein 72kDa 2 1
MIRT005190 MTX3 metaxin 3 2 1
MIRT005191 STRN striatin, calmodulin binding protein 2 1
MIRT005192 SEC11C SEC11 homolog C (S. cerevisiae) 2 1
MIRT005193 RRP36 chromosome 6 open reading frame 153 2 1
MIRT005194 RBMS1 RNA binding motif, single stranded interacting protein 1 2 1
MIRT005195 TBCB tubulin folding cofactor B 2 1
MIRT005196 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 2 1
MIRT005197 RAB27B RAB27B, member RAS oncogene family 2 1
MIRT005198 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 2 1
MIRT005199 STX7 syntaxin 7 2 1
MIRT005200 UAP1 UDP-N-acteylglucosamine pyrophosphorylase 1 2 1
MIRT005201 LIMCH1 LIM and calponin homology domains 1 2 1
MIRT005202 DOCK7 dedicator of cytokinesis 7 2 1
MIRT005203 SYPL1 synaptophysin-like 1 2 1
MIRT005204 NCL nucleolin 2 1
MIRT005205 NUCB1 nucleobindin 1 2 1
MIRT005206 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 2 1
MIRT005207 FXR2 fragile X mental retardation, autosomal homolog 2 2 1
MIRT005208 C5orf15 chromosome 5 open reading frame 15 2 1
MIRT005209 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 2 1
MIRT005210 PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 2 1
MIRT005211 ANPEP alanyl (membrane) aminopeptidase 2 1
MIRT005212 MYO10 myosin X 2 1
MIRT005213 MAT2A methionine adenosyltransferase II, alpha 2 1
MIRT005214 CTSL1 cathepsin L1 2 1
MIRT005215 FRG1 FSHD region gene 1 2 1
MIRT005216 WDR82 WD repeat domain 82 2 1
MIRT005217 CBFB core-binding factor, beta subunit 2 1
MIRT006319 SMAD1 SMAD family member 1 2 1
MIRT006563 DTL denticleless homolog (Drosophila) 3 1
MIRT006606 Snai1 snail homolog 1 (Drosophila) 2 1
MIRT006760 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT007097 PIK3CD phosphoinositide-3-kinase, catalytic, delta polypeptide 3 1
MIRT007218 PRDM1 PR domain containing 1, with ZNF domain 1 1
MIRT007238 SEPT7 septin 7 1 1
MIRT007276 AVEN apoptosis, caspase activation inhibitor 1 1
MIRT007277 FOXD1 forkhead box D1 1 1
MIRT007296 TUBB4B tubulin, beta 2C 1 1
MIRT007297 NEUROD1 neurogenic differentiation 1 1 1
MIRT007359 ABL1 c-abl oncogene 1, receptor tyrosine kinase 2 1
MIRT028389 CD44 CD44 molecule (Indian blood group) 1 1
MIRT028390 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT028391 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 1 1
MIRT028392 SARS seryl-tRNA synthetase 1 1
MIRT028393 RAB34 RAB34, member RAS oncogene family 1 1
MIRT028394 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT028395 PPID peptidylprolyl isomerase D 1 1
MIRT028396 SEC11A SEC11 homolog A (S. cerevisiae) 1 1
MIRT028397 UTP11L UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) 1 1
MIRT028398 MOSPD2 motile sperm domain containing 2 1 1
MIRT028399 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT028400 KIF5B kinesin family member 5B 1 1
MIRT028401 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT028402 YBX3 cold shock domain protein A 1 1
MIRT028403 NDEL1 nudE nuclear distribution gene E homolog (A. nidulans)-like 1 1 1
MIRT028404 UBE2H ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) 1 1
MIRT028405 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT028406 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT028407 TOM1 target of myb1 (chicken) 1 1
MIRT028408 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 1 1
MIRT028409 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT028410 ESRRA estrogen-related receptor alpha 1 1
MIRT028411 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT028412 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT028413 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT028414 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT028415 SMN2 survival of motor neuron 2, centromeric 1 1
MIRT028416 EFTUD1 elongation factor Tu GTP binding domain containing 1 1 1
MIRT028417 KRT7 keratin 7 1 1
MIRT028418 PHLDA2 pleckstrin homology-like domain, family A, member 2 1 1
MIRT028419 RHOF ras homolog gene family, member F (in filopodia) 1 1
MIRT028420 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT028421 ARF6 ADP-ribosylation factor 6 1 1
MIRT028422 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT028423 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 1 1
MIRT028424 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT028425 NXT1 NTF2-like export factor 1 1 1
MIRT028426 SCYL1 SCY1-like 1 (S. cerevisiae) 1 1
MIRT028427 HK1 hexokinase 1 1 1
MIRT028428 PCNT pericentrin 1 1
MIRT028429 TRRAP transformation/transcription domain-associated protein 1 1
MIRT028430 AK1 adenylate kinase 1 1 1
MIRT028431 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT028432 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT028433 C16orf62 chromosome 16 open reading frame 62 1 1
MIRT028434 CIRBP cold inducible RNA binding protein 1 1
MIRT028435 EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa 1 1
MIRT028436 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT028437 HEATR2 HEAT repeat containing 2 1 1
MIRT028438 TLDC1 KIAA1609 1 1
MIRT028439 TNPO3 transportin 3 1 1
MIRT028440 MGST2 microsomal glutathione S-transferase 2 1 1
MIRT028441 JUP junction plakoglobin 1 1
MIRT028442 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT028443 CPSF3 cleavage and polyadenylation specific factor 3, 73kDa 1 1
MIRT028444 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT028445 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT028446 AP2S1 adaptor-related protein complex 2, sigma 1 subunit 1 1
MIRT028447 SDCBP syndecan binding protein (syntenin) 1 1
MIRT028448 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT028449 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT028450 CAST calpastatin 1 1
MIRT028451 FDX1 ferredoxin 1 1 1
MIRT028452 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT028453 NOL8 nucleolar protein 8 1 1
MIRT028454 TMEM192 transmembrane protein 192 1 1
MIRT028455 DYNC1LI1 dynein, cytoplasmic 1, light intermediate chain 1 2 2
MIRT028456 RETSAT retinol saturase (all-trans-retinol 13,14-reductase) 1 1
MIRT028457 BCL2L1 BCL2-like 1 1 1
MIRT028458 NCKAP1 NCK-associated protein 1 1 1
MIRT028459 LDLR low density lipoprotein receptor 1 1
MIRT028460 REEP5 receptor accessory protein 5 1 1
MIRT028461 CPOX coproporphyrinogen oxidase 1 1
MIRT028462 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT028463 GLIPR1 GLI pathogenesis-related 1 1 1
MIRT028464 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT028465 CCPG1 cell cycle progression 1 1 1
MIRT028466 MARCH5 membrane-associated ring finger (C3HC4) 5 1 1
MIRT028467 RND3 Rho family GTPase 3 1 1
MIRT028468 DERL1 Der1-like domain family, member 1 1 1
MIRT028469 RAB14 RAB14, member RAS oncogene family 1 1
MIRT028470 ACP2 acid phosphatase 2, lysosomal 1 1
MIRT028471 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT028472 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT028473 RRM2 ribonucleotide reductase M2 1 1
MIRT028474 ITGA6 integrin, alpha 6 1 1
MIRT028475 DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 1 1
MIRT028476 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT028477 RHOB ras homolog gene family, member B 1 1
MIRT028478 MTDH metadherin 1 1
MIRT028479 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 1
MIRT028480 MAN2B1 mannosidase, alpha, class 2B, member 1 1 1
MIRT028481 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT028482 TUBB3 tubulin, beta 3 1 1
MIRT028483 TM9SF1 transmembrane 9 superfamily member 1 1 1
MIRT028484 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT028485 KRT77 keratin 77 1 1
MIRT028486 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT028487 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT028488 SON SON DNA binding protein 1 1
MIRT028489 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT028490 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT028491 GLRX glutaredoxin (thioltransferase) 1 1
MIRT028492 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT028493 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT028494 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT028495 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT028496 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT028497 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT028498 GNG2 guanine nucleotide binding protein (G protein), gamma 2 1 1
MIRT028499 KRT6B keratin 6B 1 1
MIRT028500 RRP15 ribosomal RNA processing 15 homolog (S. cerevisiae) 1 1
MIRT028501 PPOX protoporphyrinogen oxidase 1 1
MIRT028502 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT028503 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT028504 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 1 1
MIRT028505 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT028506 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT028507 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT028508 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT028509 SLC12A2 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 1 1
MIRT028510 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT028511 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT028512 PRMT1 protein arginine methyltransferase 1 1 1
MIRT028513 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT028514 TRIO triple functional domain (PTPRF interacting) 1 1
MIRT028515 YRDC yrdC domain containing (E. coli) 1 1
MIRT028516 TICAM2 toll-like receptor adaptor molecule 2 1 1
MIRT028517 NFU1 NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) 1 1
MIRT028518 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT028519 MKI67IP MKI67 (FHA domain) interacting nucleolar phosphoprotein 1 1
MIRT028520 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT028521 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT028522 HINT3 histidine triad nucleotide binding protein 3 1 1
MIRT028523 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT028524 RBMS3 RNA binding motif, single stranded interacting protein 3 1 1
MIRT028525 EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa 1 1
MIRT028526 PLIN3 perilipin 3 1 1
MIRT028527 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT028528 IFRD2 interferon-related developmental regulator 2 1 1
MIRT028529 INTS6 integrator complex subunit 6 1 1
MIRT028530 URM1 ubiquitin related modifier 1 homolog (S. cerevisiae) 1 1
MIRT028531 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT028532 CSNK1G1 casein kinase 1, gamma 1 1 1
MIRT028533 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT028534 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT028535 KIF11 kinesin family member 11 1 1
MIRT028536 LARP4 La ribonucleoprotein domain family, member 4 1 1
MIRT028537 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT028538 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT028539 KIDINS220 kinase D-interacting substrate, 220kDa 1 1
MIRT028540 ATL2 atlastin GTPase 2 1 1
MIRT028541 DSG2 desmoglein 2 1 1
MIRT028542 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT028543 VIM vimentin 1 1
MIRT028544 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT028545 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT028546 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT028547 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT028548 SAMD9 sterile alpha motif domain containing 9 1 1
MIRT028549 RBM34 RNA binding motif protein 34 1 1
MIRT028550 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT028551 EXOSC10 exosome component 10 1 1
MIRT028552 LSS lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 1 1
MIRT028553 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT028554 ITGB4 integrin, beta 4 1 1
MIRT028555 TPBG trophoblast glycoprotein 1 1
MIRT028556 UBL3 ubiquitin-like 3 1 1
MIRT028557 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT028558 RPP40 ribonuclease P/MRP 40kDa subunit 1 1
MIRT028559 PTMS parathymosin 1 1
MIRT028560 SERPINE2 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 1 1
MIRT028561 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 1
MIRT028562 PES1 pescadillo homolog 1, containing BRCT domain (zebrafish) 1 1
MIRT028563 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT028564 SLC38A5 solute carrier family 38, member 5 1 1
MIRT028565 CORO1C coronin, actin binding protein, 1C 1 1
MIRT028566 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT028567 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT028568 FAM96A family with sequence similarity 96, member A 1 1
MIRT028569 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT028570 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT028571 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT028572 MAP1LC3B2 microtubule-associated protein 1 light chain 3 beta 2 1 1
MIRT028573 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT028574 STUB1 STIP1 homology and U-box containing protein 1 1 1
MIRT028575 SNX3 sorting nexin 3 1 1
MIRT028576 HECTD1 HECT domain containing 1 1 1
MIRT028577 WDR74 WD repeat domain 74 1 1
MIRT028578 MRPS5 mitochondrial ribosomal protein S5 1 1
MIRT028579 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT028580 ZFPL1 zinc finger protein-like 1 1 1
MIRT028581 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT028582 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT028583 RBM5 RNA binding motif protein 5 1 1
MIRT028584 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT028585 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT028586 OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT028587 TBC1D4 TBC1 domain family, member 4 1 1
MIRT028588 TMED1 transmembrane emp24 protein transport domain containing 1 1 1
MIRT028589 GATC glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) 1 1
MIRT028590 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 1 1
MIRT028591 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT028592 ATXN10 ataxin 10 1 1
MIRT028593 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT028594 NDUFAF1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 1 1
MIRT028595 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT028596 UFM1 ubiquitin-fold modifier 1 1 1
MIRT028597 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT028598 KPNA4 karyopherin alpha 4 (importin alpha 3) 1 1
MIRT028599 REXO4 REX4, RNA exonuclease 4 homolog (S. cerevisiae) 1 1
MIRT028600 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 1 1
MIRT028601 PDCD10 programmed cell death 10 1 1
MIRT028602 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT028603 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT028604 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT028605 FAF2 Fas associated factor family member 2 1 1
MIRT028606 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT028607 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT028608 FBN1 fibrillin 1 1 1
MIRT028609 VAMP3 vesicle-associated membrane protein 3 (cellubrevin) 1 1
MIRT028610 RBFOX1 ataxin 2-binding protein 1 1 1
MIRT028611 PPP1R12A protein phosphatase 1, regulatory (inhibitor) subunit 12A 1 1
MIRT028612 RAB21 RAB21, member RAS oncogene family 1 1
MIRT028613 STX16 syntaxin 16 1 1
MIRT028614 CAT catalase 1 1
MIRT028615 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT028616 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT028617 POLR2B polymerase (RNA) II (DNA directed) polypeptide B, 140kDa 1 1
MIRT028618 RUNX2 runt-related transcription factor 2 2 1
MIRT028619 PAK1IP1 PAK1 interacting protein 1 1 1
MIRT028620 HIST1H1A histone cluster 1, H1a 1 1
MIRT028621 AK2 adenylate kinase 2 1 1
MIRT028622 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT028623 USE1 unconventional SNARE in the ER 1 homolog (S. cerevisiae) 1 1
MIRT028624 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein 1 1
MIRT028625 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT028626 ZNF638 zinc finger protein 638 1 1
MIRT028627 CPSF4 cleavage and polyadenylation specific factor 4, 30kDa 1 1
MIRT028628 TELO2 TEL2, telomere maintenance 2, homolog (S. cerevisiae) 1 1
MIRT028629 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 1
MIRT028630 GGCT gamma-glutamylcyclotransferase 1 1
MIRT028631 TAPBP TAP binding protein (tapasin) 1 1
MIRT028632 TIMM9 translocase of inner mitochondrial membrane 9 homolog (yeast) 1 1
MIRT028633 ARG1 arginase, liver 1 1
MIRT028634 CSNK1G2 casein kinase 1, gamma 2 1 1
MIRT028635 WDR12 WD repeat domain 12 1 1
MIRT028636 LIG3 ligase III, DNA, ATP-dependent 1 1
MIRT028637 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1 1
MIRT028638 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT028639 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa 1 1
MIRT028640 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 2 2
MIRT028641 PHB2 prohibitin 2 1 1
MIRT028642 DNAJC3 DnaJ (Hsp40) homolog, subfamily C, member 3 1 1
MIRT028643 SAMHD1 SAM domain and HD domain 1 1 1
MIRT028644 GABARAPL2 GABA(A) receptor-associated protein-like 2 1 1
MIRT028645 THBS1 thrombospondin 1 1 1
MIRT028646 PYCR2 pyrroline-5-carboxylate reductase family, member 2 1 1
MIRT028647 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT028648 ME3 malic enzyme 3, NADP(+)-dependent, mitochondrial 1 1
MIRT028649 PRKCDBP protein kinase C, delta binding protein 1 1
MIRT028650 ANXA1 annexin A1 1 1
MIRT028651 BAX BCL2-associated X protein 1 1
MIRT028652 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT028653 PKM pyruvate kinase, muscle 1 1
MIRT028654 GLRX3 glutaredoxin 3 1 1
MIRT028655 VWA8 KIAA0564 1 1
MIRT028656 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT028657 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT028658 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT028659 CAPN2 calpain 2, (m/II) large subunit 1 1
MIRT028660 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT028661 RBFOX2 RNA binding motif protein 9 1 1
MIRT028662 LSM1 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT028663 CSNK1G3 casein kinase 1, gamma 3 1 1
MIRT028664 PRPF4B PRP4 pre-mRNA processing factor 4 homolog B (yeast) 1 1
MIRT028665 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT028666 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT028667 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT028668 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT028669 ATP8A2 ATPase, aminophospholipid transporter, class I, type 8A, member 2 1 1
MIRT028670 IKBIP IKBKB interacting protein 1 1
MIRT028671 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT028672 GMFB glia maturation factor, beta 1 1
MIRT028673 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT028674 WDR75 WD repeat domain 75 1 1
MIRT028675 UHRF2 ubiquitin-like with PHD and ring finger domains 2 1 1
MIRT028676 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT028677 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT028678 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT028679 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT028680 AP3S1 adaptor-related protein complex 3, sigma 1 subunit 1 1
MIRT028681 PICALM phosphatidylinositol binding clathrin assembly protein 1 1
MIRT028682 ERLIN1 ER lipid raft associated 1 1 1
MIRT049927 PRPF19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 1 1
MIRT049928 EXOC2 exocyst complex component 2 1 1
MIRT049929 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT049930 HDGF hepatoma-derived growth factor 1 1
MIRT049931 THUMPD1 THUMP domain containing 1 1 1
MIRT049932 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT049933 ITPRIPL2 inositol 1,4,5-triphosphate receptor interacting protein-like 2 1 1
MIRT049934 CLEC4D C-type lectin domain family 4, member D 1 1
MIRT049935 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT049936 NOL9 nucleolar protein 9 1 1
MIRT049937 TUBA1B tubulin, alpha 1b 1 1
MIRT049938 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT049939 ANKRD26 ankyrin repeat domain 26 1 1
MIRT049940 CARS cysteinyl-tRNA synthetase 1 1
MIRT049941 ZNF324 zinc finger protein 324 1 1
MIRT049942 XPO7 exportin 7 1 1
MIRT049943 TPI1 triosephosphate isomerase 1 1 1
MIRT049944 RPN2 ribophorin II 1 1
MIRT049945 RPS17 ribosomal protein S17 1 1
MIRT049946 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT049947 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT049948 HDAC1 histone deacetylase 1 1 1
MIRT049949 ERP44 endoplasmic reticulum protein 44 1 1
MIRT049950 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT049951 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 1 1
MIRT049952 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT049953 TRIM28 tripartite motif-containing 28 1 1
MIRT049954 USP16 ubiquitin specific peptidase 16 1 1
MIRT049955 MRPL28 mitochondrial ribosomal protein L28 1 1
MIRT049956 PNMA2 paraneoplastic antigen MA2 1 1
MIRT049957 XPOT exportin, tRNA (nuclear export receptor for tRNAs) 1 1
MIRT049958 DROSHA ribonuclease type III, nuclear 1 1
MIRT049959 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT049960 PCNA proliferating cell nuclear antigen 1 1
MIRT049961 LRRN1 leucine rich repeat neuronal 1 1 1
MIRT049962 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT049963 EEF2 eukaryotic translation elongation factor 2 1 1