Accession ID: MIRT002876 [miRNA, hsa-miR-30a-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30aLinkOut: [miRBase ]
Description Homo sapiens miR-30a stem-loop
Comment The mature sequences miR-30 . Related miRNAs are processed from the 5' arms of other precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736; mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30a-5p
Mature Sequence 6| UGUAAACAUCCUCGACUGGAAG |27
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-30a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaAGG--UCAGCUCCUACAAAUGu 5'
            |||  || :|  ||| ||||| 
Target 5' cgTCCCAAGATGTTGATTTTTACt 3'
1474 - 1497 130.00 -8.20
2
miRNA  3' gaaggUCAGCUCCUACAAAUgu 5'
               :|| ||   ||||||  
Target 5' ttaaaGGTGGATTTTGTTTAaa 3'
1264 - 1285 129.00 -6.50
3
miRNA  3' gaaggucagcuccUACAAAUGu 5'
                       :||||||: 
Target 5' aaaagattcttctGTGTTTATa 3'
290 - 311 125.00 -7.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , Other
Conditions SH-SY5Y
Location of target site 3'UTR
Original Description (Extracted from the article) ... overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. ...

- Fukuda, Y. Kawasaki, H. Taira, K., 2005, Nucleic Acids Symp Ser (Oxf).

Article - Fukuda, Y. Kawasaki, H. Taira, K.
- Nucleic Acids Symp Ser (Oxf), 2005
MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that inhibit protein translation in a sequence specific manner. We carried out microarray analyses of 180 human pre-miRNAs in neuroblastoma cell, SH-SY5Y, following stimulation by TPA. Twelve of the pre-miRNAs were up-regulated by the TPA stimulation. We also explored miRNA target genes associated with neuronal differentiation. Some miRNAs have complementarity with 3'UTR of the Notch1 gene, a regulator of neuronal differentiation, and luciferase assay showed that overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. Our results suggest that miRNAs can be associated with TPA induced signalling pathways and expression of Notch1 gene.
LinkOut: [PMID: 17150773]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30a-5p :: NOTCH1    [ Functional MTI ]
Validation Method
Article - Wu, J. Zheng, C. Fan, Y. Zeng, C. Chen, Z. et al.
- J Am Soc Nephrol, 2013
MicroRNAs (miRNAs) are essential for podocyte homeostasis, and the miR-30 family may be responsible for this action. However, the exact roles and clinical relevance of miR-30s remain unknown. In this study, we examined the expression of the miR-30 family in the podocytes of patients with FSGS and found that all members are downregulated. Treating cultured human podocytes with TGF-beta, LPS, or puromycin aminonucleoside (PAN) also downregulated the miR-30 family. Podocyte cytoskeletal damage and apoptosis caused by treatment with TGF-beta or PAN were ameliorated by exogenous miR-30 expression and aggravated by miR-30 knockdown. Moreover, we found that miR-30s exert their protective roles by direct inhibition of Notch1 and p53, which mediate podocyte injury. In rats, treatment with PAN substantially downregulated podocyte miR-30s and induced proteinuria and podocyte injury; however, transfer of exogenous miR-30a to podocytes of PAN-treated rats ameliorated proteinuria and podocyte injury and reduced Notch1 activation. Finally, we demonstrated that glucocorticoid treatment maintains miR-30 expression in cultured podocytes treated with TGF-beta, LPS, or PAN and in the podocytes of PAN-treated rats. Glucocorticoid-sustained miR-30 expression associated with reduced Notch1 activation and alleviated podocyte damage. Taken together, these findings demonstrate that miR-30s protect podocytes by targeting Notch1 and p53 and that the loss of miR-30s facilitates podocyte injury. In addition, sustained miR-30 expression may be a novel mechanism underlying the therapeutic effectiveness of glucocorticoids in treating podocytopathy.
LinkOut: [PMID: 24029422]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
703 hsa-miR-30a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001946 BDNF brain-derived neurotrophic factor 2 1
MIRT002876 NOTCH1 notch 1 5 2
MIRT004509 BECN1 beclin 1, autophagy related 3 2
MIRT004785 TNRC6A trinucleotide repeat containing 6A 3 3
MIRT005120 HNRNPM heterogeneous nuclear ribonucleoprotein M 2 1
MIRT005121 ELMOD2 ELMO/CED-12 domain containing 2 2 1
MIRT005122 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 3 2
MIRT005123 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 2 1
MIRT005124 TMEM87A transmembrane protein 87A 2 1
MIRT005125 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 2 1
MIRT005126 SEC62 SEC62 homolog (S. cerevisiae) 2 1
MIRT005127 CHD1 chromodomain helicase DNA binding protein 1 3 2
MIRT005128 JUN jun proto-oncogene 2 1
MIRT005129 SLC4A10 solute carrier family 4, sodium bicarbonate transporter, member 10 2 1
MIRT005130 NT5E 5'-nucleotidase, ecto (CD73) 2 1
MIRT005131 LMNB2 lamin B2 2 1
MIRT005132 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 3 2
MIRT005133 TMEM41B transmembrane protein 41B 2 1
MIRT005134 CPNE8 copine VIII 2 1
MIRT005135 MBNL1 muscleblind-like splicing regulator 1 2 1
MIRT005136 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 2 1
MIRT005137 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 3 2
MIRT005138 TMEM59 transmembrane protein 59 2 1
MIRT005139 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 2 1
MIRT005140 TMED3 transmembrane emp24 protein transport domain containing 3 2 1
MIRT005141 SLC38A1 solute carrier family 38, member 1 2 1
MIRT005142 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 2 1
MIRT005143 IFRD1 interferon-related developmental regulator 1 2 1
MIRT005144 PEX11B peroxisomal biogenesis factor 11 beta 2 1
MIRT005145 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 2 1
MIRT005146 SLC9A3R2 solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2 2 1
MIRT005147 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 2 1
MIRT005148 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 3 2
MIRT005149 PTGFRN prostaglandin F2 receptor negative regulator 2 1
MIRT005150 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 2 1
MIRT005151 NCEH1 neutral cholesterol ester hydrolase 1 2 1
MIRT005152 SEC23A Sec23 homolog A (S. cerevisiae) 2 1
MIRT005153 PBRM1 polybromo 1 3 2
MIRT005154 MLLT11 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 2 1
MIRT005155 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 3 2
MIRT005156 DPY19L1 dpy-19-like 1 (C. elegans) 2 1
MIRT005157 C1D C1D nuclear receptor corepressor 2 1
MIRT005158 LTN1 listerin E3 ubiquitin protein ligase 1 2 1
MIRT005159 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 2 1
MIRT005160 SLC38A2 solute carrier family 38, member 2 2 1
MIRT005161 PTPRK protein tyrosine phosphatase, receptor type, K 2 1
MIRT005162 WNT5A wingless-type MMTV integration site family, member 5A 2 1
MIRT005163 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 2 1
MIRT005164 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 3 2
MIRT005165 ATRX alpha thalassemia/mental retardation syndrome X-linked 2 1
MIRT005166 STMN1 stathmin 1 2 1
MIRT005167 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT005168 P4HA2 prolyl 4-hydroxylase, alpha polypeptide II 2 1
MIRT005169 LRRC8C leucine rich repeat containing 8 family, member C 2 1
MIRT005170 MPDU1 mannose-P-dolichol utilization defect 1 2 1
MIRT005171 THEM4 thioesterase superfamily member 4 2 1
MIRT005172 RAD23B RAD23 homolog B (S. cerevisiae) 3 2
MIRT005173 CNPY4 canopy 4 homolog (zebrafish) 2 1
MIRT005174 KRT85 keratin 85 2 1
MIRT005175 PGM1 phosphoglucomutase 1 2 1
MIRT005176 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 2 1
MIRT005177 PTRH1 peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) 2 1
MIRT005178 CDCP1 CUB domain containing protein 1 2 1
MIRT005179 ADPGK ADP-dependent glucokinase 2 1
MIRT005180 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 2 1
MIRT005181 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 3 2
MIRT005182 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 2 1
MIRT005183 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 2 1
MIRT005184 NT5C3 5'-nucleotidase, cytosolic III 2 1
MIRT005185 TMCO1 transmembrane and coiled-coil domains 1 2 1
MIRT005186 TMED7 transmembrane emp24 protein transport domain containing 7 2 1
MIRT005187 TMED2 transmembrane emp24 domain trafficking protein 2 3 2
MIRT005188 PPP2R4 protein phosphatase 2A activator, regulatory subunit 4 2 1
MIRT005189 CEP72 centrosomal protein 72kDa 2 1
MIRT005190 MTX3 metaxin 3 2 1
MIRT005191 STRN striatin, calmodulin binding protein 3 2
MIRT005192 SEC11C SEC11 homolog C (S. cerevisiae) 2 1
MIRT005193 RRP36 ribosomal RNA processing 36 homolog (S. cerevisiae) 2 1
MIRT005194 RBMS1 RNA binding motif, single stranded interacting protein 1 2 1
MIRT005195 TBCB tubulin folding cofactor B 2 1
MIRT005196 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 2 1
MIRT005197 RAB27B RAB27B, member RAS oncogene family 2 1
MIRT005198 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 2 1
MIRT005199 STX7 syntaxin 7 2 1
MIRT005200 UAP1 UDP-N-acteylglucosamine pyrophosphorylase 1 2 1
MIRT005201 LIMCH1 LIM and calponin homology domains 1 2 1
MIRT005202 DOCK7 dedicator of cytokinesis 7 2 1
MIRT005203 SYPL1 synaptophysin-like 1 2 1
MIRT005204 NCL nucleolin 2 1
MIRT005205 NUCB1 nucleobindin 1 2 1
MIRT005206 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 2 1
MIRT005207 FXR2 fragile X mental retardation, autosomal homolog 2 2 1
MIRT005208 C5orf15 chromosome 5 open reading frame 15 2 1
MIRT005209 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 2 1
MIRT005210 PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 2 1
MIRT005211 ANPEP alanyl (membrane) aminopeptidase 2 1
MIRT005212 MYO10 myosin X 2 1
MIRT005213 MAT2A methionine adenosyltransferase II, alpha 2 1
MIRT005214 CTSL1 cathepsin L1 2 1
MIRT005215 FRG1 FSHD region gene 1 2 1
MIRT005216 WDR82 WD repeat domain 82 2 1
MIRT005217 CBFB core-binding factor, beta subunit 2 1
MIRT006319 SMAD1 SMAD family member 1 2 1
MIRT006563 DTL denticleless E3 ubiquitin protein ligase homolog (Drosophila) 3 1
MIRT006606 Snai1 snail homolog 1 (Drosophila) 2 1
MIRT006760 SNAI1 snail homolog 1 (Drosophila) 4 3
MIRT007097 PIK3CD phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta 3 1
MIRT007218 PRDM1 PR domain containing 1, with ZNF domain 2 2
MIRT007238 SEPT7 septin 7 1 1
MIRT007276 AVEN apoptosis, caspase activation inhibitor 1 1
MIRT007277 FOXD1 forkhead box D1 1 1
MIRT007296 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT007297 NEUROD1 neuronal differentiation 1 1 1
MIRT007359 ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 2 1
MIRT028389 CD44 CD44 molecule (Indian blood group) 1 1
MIRT028390 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT028391 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 1 1
MIRT028392 SARS seryl-tRNA synthetase 1 1
MIRT028393 RAB34 RAB34, member RAS oncogene family 1 1
MIRT028394 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT028395 PPID peptidylprolyl isomerase D 1 1
MIRT028396 SEC11A SEC11 homolog A (S. cerevisiae) 1 1
MIRT028397 UTP11L UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) 1 1
MIRT028398 MOSPD2 motile sperm domain containing 2 1 1
MIRT028399 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT028400 KIF5B kinesin family member 5B 2 4
MIRT028401 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT028402 YBX3 cold shock domain protein A 1 1
MIRT028403 NDEL1 nudE nuclear distribution E homolog (A. nidulans)-like 1 2 2
MIRT028404 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT028405 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT028406 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT028407 TOM1 target of myb1 (chicken) 1 1
MIRT028408 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 1 1
MIRT028409 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT028410 ESRRA estrogen-related receptor alpha 1 1
MIRT028411 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT028412 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT028413 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT028414 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT028415 SMN2 survival of motor neuron 2, centromeric 1 1
MIRT028416 EFTUD1 elongation factor Tu GTP binding domain containing 1 1 1
MIRT028417 KRT7 keratin 7 1 1
MIRT028418 PHLDA2 pleckstrin homology-like domain, family A, member 2 1 1
MIRT028419 RHOF ras homolog family member F (in filopodia) 1 1
MIRT028420 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT028421 ARF6 ADP-ribosylation factor 6 1 1
MIRT028422 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT028423 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 1 1
MIRT028424 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT028425 NXT1 NTF2-like export factor 1 1 1
MIRT028426 SCYL1 SCY1-like 1 (S. cerevisiae) 1 1
MIRT028427 HK1 hexokinase 1 1 1
MIRT028428 PCNT pericentrin 1 1
MIRT028429 TRRAP transformation/transcription domain-associated protein 1 1
MIRT028430 AK1 adenylate kinase 1 1 1
MIRT028431 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT028432 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT028433 C16orf62 chromosome 16 open reading frame 62 1 1
MIRT028434 CIRBP cold inducible RNA binding protein 1 1
MIRT028435 EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa 1 1
MIRT028436 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT028437 HEATR2 HEAT repeat containing 2 1 1
MIRT028438 TLDC1 KIAA1609 1 1
MIRT028439 TNPO3 transportin 3 1 1
MIRT028440 MGST2 microsomal glutathione S-transferase 2 1 1
MIRT028441 JUP junction plakoglobin 1 1
MIRT028442 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT028443 CPSF3 cleavage and polyadenylation specific factor 3, 73kDa 1 1
MIRT028444 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT028445 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT028446 AP2S1 adaptor-related protein complex 2, sigma 1 subunit 1 1
MIRT028447 SDCBP syndecan binding protein (syntenin) 1 1
MIRT028448 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT028449 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT028450 CAST calpastatin 1 1
MIRT028451 FDX1 ferredoxin 1 1 1
MIRT028452 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT028453 NOL8 nucleolar protein 8 1 1
MIRT028454 TMEM192 transmembrane protein 192 1 1
MIRT028455 DYNC1LI1 dynein, cytoplasmic 1, light intermediate chain 1 2 2
MIRT028456 RETSAT retinol saturase (all-trans-retinol 13,14-reductase) 1 1
MIRT028457 BCL2L1 BCL2-like 1 1 1
MIRT028458 NCKAP1 NCK-associated protein 1 1 1
MIRT028459 LDLR low density lipoprotein receptor 2 2
MIRT028460 REEP5 receptor accessory protein 5 1 1
MIRT028461 CPOX coproporphyrinogen oxidase 1 1
MIRT028462 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT028463 GLIPR1 GLI pathogenesis-related 1 1 1
MIRT028464 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT028465 CCPG1 cell cycle progression 1 1 1
MIRT028466 MARCH5 membrane-associated ring finger (C3HC4) 5 1 1
MIRT028467 RND3 Rho family GTPase 3 1 1
MIRT028468 DERL1 derlin 1 1 1
MIRT028469 RAB14 RAB14, member RAS oncogene family 1 1
MIRT028470 ACP2 acid phosphatase 2, lysosomal 1 1
MIRT028471 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT028472 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT028473 RRM2 ribonucleotide reductase M2 2 3
MIRT028474 ITGA6 integrin, alpha 6 1 1
MIRT028475 DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 1 1
MIRT028476 XPO1 exportin 1 (CRM1 homolog, yeast) 2 2
MIRT028477 RHOB ras homolog family member B 1 1
MIRT028478 MTDH metadherin 4 3
MIRT028479 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 1
MIRT028480 MAN2B1 mannosidase, alpha, class 2B, member 1 1 1
MIRT028481 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT028482 TUBB3 tubulin, beta 3 class III 1 1
MIRT028483 TM9SF1 transmembrane 9 superfamily member 1 1 1
MIRT028484 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT028485 KRT77 keratin 77 1 1
MIRT028486 PPP1R10 protein phosphatase 1, regulatory subunit 10 1 1
MIRT028487 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT028488 SON SON DNA binding protein 1 1
MIRT028489 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT028490 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT028491 GLRX glutaredoxin (thioltransferase) 1 1
MIRT028492 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT028493 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT028494 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT028495 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT028496 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT028497 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT028498 GNG2 guanine nucleotide binding protein (G protein), gamma 2 1 1
MIRT028499 KRT6B keratin 6B 1 1
MIRT028500 RRP15 ribosomal RNA processing 15 homolog (S. cerevisiae) 1 1
MIRT028501 PPOX protoporphyrinogen oxidase 1 1
MIRT028502 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT028503 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT028504 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 1 1
MIRT028505 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT028506 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT028507 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT028508 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT028509 SLC12A2 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 1 1
MIRT028510 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT028511 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT028512 PRMT1 protein arginine methyltransferase 1 1 1
MIRT028513 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT028514 TRIO trio Rho guanine nucleotide exchange factor 1 1
MIRT028515 YRDC yrdC domain containing (E. coli) 1 1
MIRT028516 TICAM2 toll-like receptor adaptor molecule 2 1 1
MIRT028517 NFU1 NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) 1 1
MIRT028518 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT028519 MKI67IP MKI67 (FHA domain) interacting nucleolar phosphoprotein 1 1
MIRT028520 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT028521 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT028522 HINT3 histidine triad nucleotide binding protein 3 1 1
MIRT028523 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT028524 RBMS3 RNA binding motif, single stranded interacting protein 3 1 1
MIRT028525 EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa 1 1
MIRT028526 PLIN3 perilipin 3 1 1
MIRT028527 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT028528 IFRD2 interferon-related developmental regulator 2 1 1
MIRT028529 INTS6 integrator complex subunit 6 1 1
MIRT028530 URM1 ubiquitin related modifier 1 1 1
MIRT028531 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT028532 CSNK1G1 casein kinase 1, gamma 1 2 4
MIRT028533 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT028534 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT028535 KIF11 kinesin family member 11 2 3
MIRT028536 LARP4 La ribonucleoprotein domain family, member 4 1 1
MIRT028537 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT028538 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT028539 KIDINS220 kinase D-interacting substrate, 220kDa 1 1
MIRT028540 ATL2 atlastin GTPase 2 1 1
MIRT028541 DSG2 desmoglein 2 1 1
MIRT028542 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT028543 VIM vimentin 5 2
MIRT028544 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 4
MIRT028545 SEC24A SEC24 family, member A (S. cerevisiae) 2 2
MIRT028546 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT028547 ELOVL5 ELOVL fatty acid elongase 5 2 2
MIRT028548 SAMD9 sterile alpha motif domain containing 9 1 1
MIRT028549 RBM34 RNA binding motif protein 34 1 1
MIRT028550 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT028551 EXOSC10 exosome component 10 1 1
MIRT028552 LSS lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 1 1
MIRT028553 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT028554 ITGB4 integrin, beta 4 1 1
MIRT028555 TPBG trophoblast glycoprotein 1 1
MIRT028556 UBL3 ubiquitin-like 3 1 1
MIRT028557 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT028558 RPP40 ribonuclease P/MRP 40kDa subunit 1 1
MIRT028559 PTMS parathymosin 1 1
MIRT028560 SERPINE2 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 1 1
MIRT028561 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 1
MIRT028562 PES1 pescadillo ribosomal biogenesis factor 1 1 1
MIRT028563 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT028564 SLC38A5 solute carrier family 38, member 5 1 1
MIRT028565 CORO1C coronin, actin binding protein, 1C 1 1
MIRT028566 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT028567 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT028568 FAM96A family with sequence similarity 96, member A 1 1
MIRT028569 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT028570 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT028571 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT028572 MAP1LC3B2 microtubule-associated protein 1 light chain 3 beta 2 1 1
MIRT028573 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT028574 STUB1 STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase 1 1
MIRT028575 SNX3 sorting nexin 3 1 1
MIRT028576 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 1 1
MIRT028577 WDR74 WD repeat domain 74 1 1
MIRT028578 MRPS5 mitochondrial ribosomal protein S5 1 1
MIRT028579 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT028580 ZFPL1 zinc finger protein-like 1 1 1
MIRT028581 NDE1 nudE nuclear distribution E homolog 1 (A. nidulans) 1 1
MIRT028582 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT028583 RBM5 RNA binding motif protein 5 1 1
MIRT028584 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT028585 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT028586 OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT028587 TBC1D4 TBC1 domain family, member 4 1 1
MIRT028588 TMED1 transmembrane emp24 protein transport domain containing 1 1 1
MIRT028589 GATC glutamyl-tRNA(Gln) amidotransferase, subunit C 1 1
MIRT028590 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 1 1
MIRT028591 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT028592 ATXN10 ataxin 10 1 1
MIRT028593 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT028594 NDUFAF1 NADH dehydrogenase (ubiquinone) complex I, assembly factor 1 1 1
MIRT028595 SH3GL1 SH3-domain GRB2-like 1 2 2
MIRT028596 UFM1 ubiquitin-fold modifier 1 1 1
MIRT028597 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT028598 KPNA4 karyopherin alpha 4 (importin alpha 3) 1 1
MIRT028599 REXO4 REX4, RNA exonuclease 4 homolog (S. cerevisiae) 1 1
MIRT028600 EGFR epidermal growth factor receptor 1 1
MIRT028601 PDCD10 programmed cell death 10 2 2
MIRT028602 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT028603 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT028604 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT028605 FAF2 Fas associated factor family member 2 1 1
MIRT028606 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT028607 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT028608 FBN1 fibrillin 1 1 1
MIRT028609 VAMP3 vesicle-associated membrane protein 3 1 1
MIRT028610 RBFOX1 RNA binding protein, fox-1 homolog (C. elegans) 1 1 1
MIRT028611 PPP1R12A protein phosphatase 1, regulatory subunit 12A 2 2
MIRT028612 RAB21 RAB21, member RAS oncogene family 1 1
MIRT028613 STX16 syntaxin 16 2 2
MIRT028614 CAT catalase 1 1
MIRT028615 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT028616 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT028617 POLR2B polymerase (RNA) II (DNA directed) polypeptide B, 140kDa 1 1
MIRT028618 RUNX2 runt-related transcription factor 2 3 2
MIRT028619 PAK1IP1 PAK1 interacting protein 1 1 1
MIRT028620 HIST1H1A histone cluster 1, H1a 1 1
MIRT028621 AK2 adenylate kinase 2 1 1
MIRT028622 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT028623 USE1 unconventional SNARE in the ER 1 homolog (S. cerevisiae) 1 1
MIRT028624 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 1 1
MIRT028625 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT028626 ZNF638 zinc finger protein 638 1 1
MIRT028627 CPSF4 cleavage and polyadenylation specific factor 4, 30kDa 1 1
MIRT028628 TELO2 TEL2, telomere maintenance 2, homolog (S. cerevisiae) 1 1
MIRT028629 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 1
MIRT028630 GGCT gamma-glutamylcyclotransferase 1 1
MIRT028631 TAPBP TAP binding protein (tapasin) 1 1
MIRT028632 TIMM9 translocase of inner mitochondrial membrane 9 homolog (yeast) 1 1
MIRT028633 ARG1 arginase, liver 1 1
MIRT028634 CSNK1G2 casein kinase 1, gamma 2 1 1
MIRT028635 WDR12 WD repeat domain 12 1 1
MIRT028636 LIG3 ligase III, DNA, ATP-dependent 1 1
MIRT028637 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1 1
MIRT028638 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT028639 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa 1 1
MIRT028640 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 2 2
MIRT028641 PHB2 prohibitin 2 1 1
MIRT028642 DNAJC3 DnaJ (Hsp40) homolog, subfamily C, member 3 1 1
MIRT028643 SAMHD1 SAM domain and HD domain 1 1 1
MIRT028644 GABARAPL2 GABA(A) receptor-associated protein-like 2 1 1
MIRT028645 THBS1 thrombospondin 1 1 1
MIRT028646 PYCR2 pyrroline-5-carboxylate reductase family, member 2 1 1
MIRT028647 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT028648 ME3 malic enzyme 3, NADP(+)-dependent, mitochondrial 1 1
MIRT028649 PRKCDBP protein kinase C, delta binding protein 1 1
MIRT028650 ANXA1 annexin A1 1 1
MIRT028651 BAX BCL2-associated X protein 1 1
MIRT028652 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT028653 PKM pyruvate kinase, muscle 1 1
MIRT028654 GLRX3 glutaredoxin 3 1 1
MIRT028655 VWA8 von Willebrand factor A domain containing 8 1 1
MIRT028656 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT028657 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT028658 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT028659 CAPN2 calpain 2, (m/II) large subunit 1 1
MIRT028660 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT028661 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 1
MIRT028662 LSM1 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT028663 CSNK1G3 casein kinase 1, gamma 3 1 1
MIRT028664 PRPF4B PRP4 pre-mRNA processing factor 4 homolog B (yeast) 1 1
MIRT028665 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT028666 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT028667 NAP1L1 nucleosome assembly protein 1-like 1 2 5
MIRT028668 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT028669 ATP8A2 ATPase, aminophospholipid transporter, class I, type 8A, member 2 1 1
MIRT028670 IKBIP IKBKB interacting protein 1 1
MIRT028671 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT028672 GMFB glia maturation factor, beta 1 1
MIRT028673 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT028674 WDR75 WD repeat domain 75 1 1
MIRT028675 UHRF2 ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase 1 1
MIRT028676 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT028677 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT028678 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT028679 GNA13 guanine nucleotide binding protein (G protein), alpha 13 2 3
MIRT028680 AP3S1 adaptor-related protein complex 3, sigma 1 subunit 1 1
MIRT028681 PICALM phosphatidylinositol binding clathrin assembly protein 2 3
MIRT028682 ERLIN1 ER lipid raft associated 1 2 2
MIRT049927 PRPF19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 1 1
MIRT049928 EXOC2 exocyst complex component 2 1 1
MIRT049929 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT049930 HDGF hepatoma-derived growth factor 1 1
MIRT049931 THUMPD1 THUMP domain containing 1 1 1
MIRT049932 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT049933 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein-like 2 1 1
MIRT049934 CLEC4D C-type lectin domain family 4, member D 1 1
MIRT049935 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT049936 NOL9 nucleolar protein 9 1 1
MIRT049937 TUBA1B tubulin, alpha 1b 1 1
MIRT049938 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT049939 ANKRD26 ankyrin repeat domain 26 1 1
MIRT049940 CARS cysteinyl-tRNA synthetase 1 1
MIRT049941 ZNF324 zinc finger protein 324 1 1
MIRT049942 XPO7 exportin 7 1 1
MIRT049943 TPI1 triosephosphate isomerase 1 1 1
MIRT049944 RPN2 ribophorin II 1 1
MIRT049945 RPS17 ribosomal protein S17 1 1
MIRT049946 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT049947 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 2
MIRT049948 HDAC1 histone deacetylase 1 1 1
MIRT049949 ERP44 endoplasmic reticulum protein 44 1 1
MIRT049950 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT049951 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 1 1
MIRT049952 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT049953 TRIM28 tripartite motif containing 28 1 1
MIRT049954 USP16 ubiquitin specific peptidase 16 1 1
MIRT049955 MRPL28 mitochondrial ribosomal protein L28 1 1
MIRT049956 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT049957 XPOT exportin, tRNA 1 1
MIRT049958 DROSHA drosha, ribonuclease type III 1 1
MIRT049959 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT049960 PCNA proliferating cell nuclear antigen 1 1
MIRT049961 LRRN1 leucine rich repeat neuronal 1 1 1
MIRT049962 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT049963 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT053131 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 2 1
MIRT053340 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 4 1
MIRT054508 ESR2 estrogen receptor 2 (ER beta) 4 1
MIRT054585 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 2 1
MIRT054614 BCL9 B-cell CLL/lymphoma 9 3 1
MIRT054632 HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 3 1
MIRT054651 EYA2 eyes absent homolog 2 (Drosophila) 3 1
MIRT057355 PCGF5 polycomb group ring finger 5 1 1
MIRT057672 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT059171 SLC35C1 solute carrier family 35, member C1 1 1
MIRT067975 TFDP1 transcription factor Dp-1 1 3
MIRT068113 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT068385 S100PBP S100P binding protein 1 1
MIRT069731 FOXG1 forkhead box G1 1 2
MIRT075438 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 3
MIRT079941 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 2
MIRT080956 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT081711 ZNF507 zinc finger protein 507 1 2
MIRT082851 ZNF543 zinc finger protein 543 1 2
MIRT084232 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT087145 HIC2 hypermethylated in cancer 2 1 4
MIRT088679 EML4 echinoderm microtubule associated protein like 4 1 2
MIRT088933 ASB3 ankyrin repeat and SOCS box containing 3 1 1
MIRT090501 SLC35G2 solute carrier family 35, member G2 1 1
MIRT091575 FBXO45 F-box protein 45 1 1
MIRT096077 SFXN1 sideroflexin 1 1 1
MIRT098035 SOBP sine oculis binding protein homolog (Drosophila) 1 1
MIRT099796 SOX4 SRY (sex determining region Y)-box 4 4 3
MIRT100762 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 2
MIRT100907 CD2AP CD2-associated protein 1 1
MIRT103190 SP4 Sp4 transcription factor 1 4
MIRT104519 PEG10 paternally expressed 10 1 1
MIRT105029 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT115920 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT118141 ZNF264 zinc finger protein 264 1 1
MIRT128241 STRIP1 striatin interacting protein 1 1 1
MIRT131793 CEP350 centrosomal protein 350kDa 1 1
MIRT131850 IER5 immediate early response 5 1 1
MIRT134329 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT135674 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT136211 STX12 syntaxin 12 1 1
MIRT137016 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT137121 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT138278 RNF220 ring finger protein 220 1 1
MIRT139246 JDP2 Jun dimerization protein 2 1 1
MIRT140628 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT140877 GLCE glucuronic acid epimerase 1 1
MIRT142585 IL21R interleukin 21 receptor 1 2
MIRT143347 PAPD5 PAP associated domain containing 5 1 1
MIRT144534 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT145446 RNF135 ring finger protein 135 1 1
MIRT149112 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT150758 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT152409 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT155233 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT159107 NRBP1 nuclear receptor binding protein 1 1 1
MIRT159242 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT160841 PLXNA1 plexin A1 1 1
MIRT164233 GAB1 GRB2-associated binding protein 1 1 1
MIRT165594 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT170140 KLHDC10 kelch domain containing 10 1 1
MIRT171348 PHTF2 putative homeodomain transcription factor 2 1 2
MIRT171548 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT176032 JADE3 PHD finger protein 16 1 1
MIRT177709 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT185097 LYPLAL1 lysophospholipase-like 1 1 1
MIRT188271 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT192224 MKRN3 makorin ring finger protein 3 1 1
MIRT194169 IREB2 iron-responsive element binding protein 2 1 1
MIRT197645 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT206178 RAB10 RAB10, member RAS oncogene family 1 1
MIRT210815 SETD5 SET domain containing 5 1 1
MIRT212858 N4BP2 NEDD4 binding protein 2 1 1
MIRT215129 MFAP3 microfibrillar-associated protein 3 1 1
MIRT218370 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT244292 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT257168 TBPL1 TBP-like 1 1 1
MIRT258124 UBE3C ubiquitin protein ligase E3C 1 1
MIRT258175 CBX3 chromobox homolog 3 1 1
MIRT283400 CCNF cyclin F 1 1
MIRT289627 CBX2 chromobox homolog 2 1 1
MIRT292166 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT292813 MTF2 metal response element binding transcription factor 2 1 1
MIRT293782 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT294574 ZNF460 zinc finger protein 460 1 2
MIRT302900 FOXN2 forkhead box N2 1 1
MIRT306841 FYTTD1 forty-two-three domain containing 1 1 1
MIRT313772 MIER3 mesoderm induction early response 1, family member 3 1 2
MIRT322686 BAG4 BCL2-associated athanogene 4 1 1
MIRT368806 MZT1 mitotic spindle organizing protein 1 1 1
MIRT379726 ZXDB zinc finger, X-linked, duplicated B 1 1
MIRT387952 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT437492 TP53 tumor protein p53 3 1
MIRT438620 CD99 CD99 molecule 3 1
MIRT444599 TGFA transforming growth factor, alpha 1 1
MIRT446452 CHST15 carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 1 1
MIRT448489 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT448514 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 1 1
MIRT448654 NCOA3 nuclear receptor coactivator 3 1 1
MIRT449711 TSPYL1 TSPY-like 1 1 1
MIRT450764 PGGT1B protein geranylgeranyltransferase type I, beta subunit 1 1
MIRT452143 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT463401 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT464290 VASH1 vasohibin 1 1 1
MIRT467410 SOCS3 suppressor of cytokine signaling 3 1 1
MIRT467628 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT470407 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT471081 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 2
MIRT471149 PHF13 PHD finger protein 13 1 3
MIRT472494 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT473658 MARCKSL1 MARCKS-like 1 1 1
MIRT473699 MAPK8 mitogen-activated protein kinase 8 1 2
MIRT474086 LMBR1L limb region 1 homolog (mouse)-like 1 2
MIRT474285 LARP1 La ribonucleoprotein domain family, member 1 1 3
MIRT474325 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT475698 HHIPL1 HHIP-like 1 1 1
MIRT476172 GOLGA8B golgin A8 family, member B 1 2
MIRT481138 AZIN1 antizyme inhibitor 1 1 3
MIRT481467 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT482067 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT482127 AKIRIN1 akirin 1 1 2
MIRT488726 ADPRHL1 ADP-ribosylhydrolase like 1 1 1
MIRT492209 SOCS1 suppressor of cytokine signaling 1 1 3
MIRT492610 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT497128 IFNE interferon, epsilon 1 1
MIRT498613 MTRNR2L10 MT-RNR2-like 10 1 3
MIRT503028 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT507128 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT514181 PGPEP1 pyroglutamyl-peptidase I 1 2
MIRT530622 CXCL11 chemokine (C-X-C motif) ligand 11 1 1
MIRT531358 FAM81B family with sequence similarity 81, member B 1 1
MIRT534308 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT536980 HABP4 hyaluronan binding protein 4 1 2
MIRT538156 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 2
MIRT544268 SIKE1 suppressor of IKBKE 1 1 1
MIRT544515 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT547153 PGM3 phosphoglucomutase 3 1 1
MIRT547750 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT548194 FOXA1 forkhead box A1 1 1
MIRT552928 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT553991 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT554287 SIX4 SIX homeobox 4 1 1
MIRT555306 PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme 1 1
MIRT556573 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT557733 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT557783 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT558469 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT562489 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 1
MIRT562797 NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 1 1
MIRT563235 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT563269 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT565079 UHRF1BP1 UHRF1 binding protein 1 1 2
MIRT565832 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT566682 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT566742 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT567608 FANCF Fanconi anemia, complementation group F 1 1
MIRT568344 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 2
MIRT572871 OPHN1 oligophrenin 1 1 1
MIRT623309 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT626127 PLSCR1 phospholipid scramblase 1 1 2
MIRT653919 SERPINC1 serpin peptidase inhibitor, clade C (antithrombin), member 1 1 1
MIRT653989 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 1
MIRT656335 MED29 mediator complex subunit 29 1 1
MIRT669388 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT687188 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT688639 CREM cAMP responsive element modulator 1 1
MIRT704912 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT705593 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT705913 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT716460 MRO maestro 1 1
MIRT718297 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT718888 SLFN5 schlafen family member 5 1 1
MIRT719020 SHROOM3 shroom family member 3 1 1
MIRT726000 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT726049 ZNF200 zinc finger protein 200 1 1
MIRT726062 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT726072 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT726077 ZCRB1 zinc finger CCHC-type and RNA binding motif 1 1 1
MIRT726124 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT726148 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT726162 USP37 ubiquitin specific peptidase 37 1 1
MIRT726183 UBXN4 UBX domain protein 4 1 1
MIRT726194 UBN1 ubinuclein 1 1 1
MIRT726207 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT726232 TRIM23 tripartite motif containing 23 1 1
MIRT726381 TBC1D10B TBC1 domain family, member 10B 1 1
MIRT726389 TAOK1 TAO kinase 1 1 1
MIRT726394 TANK TRAF family member-associated NFKB activator 1 1
MIRT726400 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 1 1
MIRT726432 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT726469 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT726533 SLC38A7 solute carrier family 38, member 7 1 1
MIRT726589 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT726613 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT726621 SETD3 SET domain containing 3 1 1
MIRT726655 SBF1 SET binding factor 1 1 1
MIRT726666 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT726694 RPA2 replication protein A2, 32kDa 1 1
MIRT726735 RNF122 ring finger protein 122 1 1
MIRT726769 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 1
MIRT726844 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT726862 PREPL prolyl endopeptidase-like 1 1
MIRT726867 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT726888 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT726919 PNMA1 paraneoplastic Ma antigen 1 1 1
MIRT726981 PER2 period homolog 2 (Drosophila) 1 1
MIRT726998 PCDH10 protocadherin 10 1 1
MIRT727012 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT727034 OTUD4 OTU domain containing 4 1 1
MIRT727125 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 1 1
MIRT727169 MLXIP MLX interacting protein 1 1
MIRT727195 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727205 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT727249 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 1
MIRT727280 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727305 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT727310 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT727315 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT727320 LCP1 lymphocyte cytosolic protein 1 (L-plastin) 1 1
MIRT727345 KLF10 Kruppel-like factor 10 1 1
MIRT727355 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT727394 JOSD1 Josephin domain containing 1 1 1
MIRT727399 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT727408 JAK1 Janus kinase 1 1 1
MIRT727435 IQCB1 IQ motif containing B1 1 1
MIRT727440 IP6K3 inositol hexakisphosphate kinase 3 1 1
MIRT727455 IL1A interleukin 1, alpha 1 1
MIRT727467 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT727547 GOLGA1 golgin A1 1 1
MIRT727570 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT727590 GCLC glutamate-cysteine ligase, catalytic subunit 1 1
MIRT727595 GCSAM germinal center-associated, signaling and motility 1 1
MIRT727636 FUCA1 fucosidase, alpha-L- 1, tissue 1 1
MIRT727691 FANCL Fanconi anemia, complementation group L 1 1
MIRT727726 FAM104A family with sequence similarity 104, member A 1 1
MIRT727767 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT727776 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT727798 EED embryonic ectoderm development 1 1
MIRT727811 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727832 DYNLT3 dynein, light chain, Tctex-type 3 1 1
MIRT727902 DCTN4 dynactin 4 (p62) 1 1
MIRT727933 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727958 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727979 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728014 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT728049 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT728066 C8orf76 chromosome 8 open reading frame 76 1 1
MIRT728070 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT728079 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT728163 KIAA0226L KIAA0226-like 1 1
MIRT728180 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT728191 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT728212 CFDP1 craniofacial development protein 1 1 1
MIRT728233 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728244 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT728270 ATM ataxia telangiectasia mutated 1 1
MIRT728346 ANKRA2 ankyrin repeat, family A (RFXANK-like), 2 1 1
MIRT728375 AFF4 AF4/FMR2 family, member 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*