Accession ID: MIRT002939 [miRNA, hsa-miR-125b ::
ERBB2, target gene]
| miRNA name | hsa-miR-125b |
|---|
![]() |
| Gene Symbol | ERBB2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] |
|---|---|
| Synonyms | CD340, HER-2, HER-2/neu, HER2, MLN 19, NEU, NGL, TKR1 |
| Description | v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) |
| Transcript | NM_001005862 LinkOut: [ RefSeq ] |
| Other Transcripts | NM_004448 |
| Expression | LinkOut: [ BioGPS ] |
| KEGG Pathway |
hsa04012 ErbB signaling pathway - Homo sapiens (human) hsa04020 Calcium signaling pathway - Homo sapiens (human) hsa04510 Focal adhesion - Homo sapiens (human) hsa04520 Adherens junction - Homo sapiens (human) hsa05200 Pathways in cancer - Homo sapiens (human) hsa05212 Pancreatic cancer - Homo sapiens (human) hsa05213 Endometrial cancer - Homo sapiens (human) hsa05215 Prostate cancer - Homo sapiens (human) hsa05219 Bladder cancer - Homo sapiens (human) hsa05223 Non-small cell lung cancer - Homo sapiens (human) |
| Putative miRNA Targets on ERBB2 | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] |
| 3'UTR of ERBB2 (miRNA target sites are highlighted) |
>ERBB2|NM_001005862|3'UTR 1 TGAACCAGAAGGCCAAGTCCGCAGAAGCCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGACTTCTGCTGGCATCAAGA 81 GGTGGGAGGGCCCTCCGACCACTTCCAGGGGAACCTGCCATGCCAGGAACCTGTCCTAAGGAACCTTCCTTCCTGCTTGA 161 GTTCCCAGATGGCTGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAGCACTGGGGAGTCTTTGTGGATTCTGAGGCCCTG 241 CCCAATGAGACTCTAGGGTCCAGTGGATGCCACAGCCCAGCTTGGCCCTTTCCTTCCAGATCCTGGGTACTGAAAGCCTT 321 AGGGAAGCTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTCTAAGAACAAAAGCGACCCATTCAGAGACTGTCCCTGA 401 AACCTAGTACTGCCCCCCATGAGGAAGGAACAGCAATGGTGTCAGTATCCAGGCTTTGTACAGAGTGCTTTTCTGTTTAG 481 TTTTTACTTTTTTTGTTTTGTTTTTTTAAAGATGAAATAAAGACCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGT 561 GTGGGGGGTCCTTCTCCACACCCACTTTGTCCATTTGCAAATATATTTTGGAAAACAGCTA Target sites Provided by authors Predicted by miRanda |
| miRNA:Target | hsa-miR-125b :: ERBB2 [ Functional MTI ] | ||||||
|---|---|---|---|---|---|---|---|
| Validation Method | Luciferase reporter assay , Northern blot , qRT-PCR , Western blot | ||||||
| Conditions | SKBR3, MCF10A | ||||||
| Location of target site | 3'UTR | ||||||
| Original Description (Extracted from the article) | ... Using the human breast cancer cell line SKBR3 as a model for ERBB2 and ERBB3 dependence, infection of these cells with retroviral constructs expressing either miR-125a or miR-125b resulted in suppression of ERBB2 and ERBB3 at both the transcript and protein level. Luciferase constructs containing the 3' 3'-untranslated regions of ERBB2 and ERBB3 demonstrated 35% less activity in miR-125a- and miR-125b-expressing cells relative to controls. ... - Scott, G. K. Goga, A. Bhaumik, D. Berger, et al., 2007, J Biol Chem. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Scott, G. K.
Goga, A.
Bhaumik, D.
Berger, et al. - J Biol Chem, 2007
Deregulation of micro-RNAs (miRNAs) is emerging as a major aspect of cancer etiology because their capacity to direct the translation and stability of targeted transcripts can dramatically influence cellular physiology. To explore the potential of exogenously applied miRNAs to suppress oncogenic proteins, the ERBB oncogene family was chosen with a bioinformatics search identifying targeting seed sequences for miR-125a and miR-125b within the 3'-untranslated regions of both ERBB2 and ERBB3. Using the human breast cancer cell line SKBR3 as a model for ERBB2 and ERBB3 dependence, infection of these cells with retroviral constructs expressing either miR-125a or miR-125b resulted in suppression of ERBB2 and ERBB3 at both the transcript and protein level. Luciferase constructs containing the 3' 3'-untranslated regions of ERBB2 and ERBB3 demonstrated approximately 35% less activity in miR-125a- and miR-125b-expressing cells relative to controls. Additionally, phosphorylation of ERK1/2 and AKT was suppressed in SKBR3 cells overexpressing either miR-125a or miR-125b. Consistent with suppression of both ERBB2 and ERBB3 signaling, miR-125a-or miR-125b-overexpressing SKBR3 cells were impaired in their anchorage-dependent growth and exhibited reduced migration and invasion capacities. Parallel studies performed on MCF10A cells demonstrated that miR-125a or miR-125b overexpression produced only marginal influences on the growth and migration of these non-transformed human mammary epithelial cells. These results illustrate the feasibility of using miRNAs as a therapeutic strategy to suppress oncogene expression and function.
LinkOut: [PMID: 17110380]
|
| miRNA:Target | hsa-miR-125b :: ERBB2 [ Functional MTI ] |
|---|---|
| Validation Method | Western blot |
| Conditions | MDA-MB-453 |
| Location of target site | 3'UTR |
| Tools used in this research | Literature survey, miRBase Target Database |
| Original Description (Extracted from the article) | ... This indicates that miR-125b can target the 3`UTR region of c-raf-1 mRNA as predicted from our in silico analysis. ... - Hofmann, M. H. Heinrich, J. Radziwill, G. et al., 2009, Mol Cancer Res. |
| Article |
- Hofmann, M. H.
Heinrich, J.
Radziwill, G. et al. - Mol Cancer Res, 2009
The noncoding RNA miR-125b has been described to reduce ErbB2 protein expression as well as proliferation and migration of cancer cell lines. As additional target of miR-125b, we identified the c-raf-1 mRNA by sequence analysis. We designed a short hairpin-looped oligodeoxynucleotide (ODN) targeted to the same 3' untranslated region of c-raf-1 mRNA as miR-125b. The fully complementary ODN antisense strand is linked to a second strand constituting a partially double-stranded structure of the ODN. Transfection of the c-raf-1-specific ODN (ODN-Raf) in a breast cancer cell line reduced the protein levels of C-Raf, ErbB2, and their downstream effector cyclin D1 similar to miR-125b. MiR-125b as well as ODN-Raf showed no effect on the c-raf-1 mRNA level in contrast to small interfering RNA. Unlike miR-125b, ODN-Raf induced a cytopathic effect. This may be explained by the structural properties of ODN-Raf, which can form G-tetrads. Thus, the short hairpin-looped ODN-Raf, targeting the same region of c-raf-1 as miR-125b, is a multifunctional molecule reducing the expression of oncoproteins and stimulating cell death. Both features may be useful to interfere with tumor growth.
LinkOut: [PMID: 19825990]
|
| miRNA:Target | hsa-miR-125b :: ERBB2 [ Functional MTI ] |
|---|---|
| Validation Method | Luciferase reporter assay , Microarray , Western blot |
| Conditions | SKBB3, Raf1, A549 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan |
| Original Description (Extracted from the article) | ... The importance of miRNAs not only as regulators but also as effectors of ErbB signalling is emphasized by miR-21, a key mediator of cancer cell growth and invasion whose expression is stimulated by EGFR/ErbB2. Studies are underway to modulate miRNA expression and activity in vivo with a view to developing therapeutics that can effectively block signalling pathways critical to tumour development and progression, although technical hurdles relating to delivery and tissue specificity are still to be overcome. As high-throughput miRNA profiling becomes feasible, a major goal is the identification of miRNA signatures that are predictive of treatment response, clinical outcome, or that can stratify tumour phenotypes. Should recent advances in understanding the basic science of miRNAs in cancer be translated to the clinic then there is the potential that they will transform cancer diagnosis and treatment. ... - Barker, A. Giles, K. M. Epis, M. R. Zhang, et al., 2010, Curr Opin Pharmacol. |
| Article |
- Barker, A.
Giles, K. M.
Epis, M. R.
Zhang, et al. - Curr Opin Pharmacol, 2010
Recent years have seen a massive expansion in our understanding of the biology of microRNAs (miRNAs) in cancer, through the identification of miRNAs with aberrant expression in specific cancers and the functional validation of their critical target molecules and cellular effects. In parallel, targeted therapeutic agents to block signalling pathways critical to tumour growth and progression have been developed but have yielded disappointing clinical results. The discovery of miRNAs that regulate ErbB signalling in cancer cells brings new hope that in the future these oncogenic pathways can be more effectively inhibited to improve patient outcomes.
LinkOut: [PMID: 20864407]
|
