Accession ID: MIRT002939 [miRNA, hsa-miR-125b :: ERBB2, target gene]
miRNA Infomation
miRNA namehsa-miR-125b
miRNA-target interaction network
Gene Information
Gene Symbol ERBB2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD340, HER-2, HER-2/neu, HER2, MLN 19, NEU, NGL, TKR1
Description v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
Transcript NM_001005862   LinkOut: [ RefSeq ]
Other Transcripts NM_004448   
Expression LinkOut: [ BioGPS ]
KEGG Pathway hsa04012    ErbB signaling pathway - Homo sapiens (human)
hsa04020    Calcium signaling pathway - Homo sapiens (human)
hsa04510    Focal adhesion - Homo sapiens (human)
hsa04520    Adherens junction - Homo sapiens (human)
hsa05200    Pathways in cancer - Homo sapiens (human)
hsa05212    Pancreatic cancer - Homo sapiens (human)
hsa05213    Endometrial cancer - Homo sapiens (human)
hsa05215    Prostate cancer - Homo sapiens (human)
hsa05219    Bladder cancer - Homo sapiens (human)
hsa05223    Non-small cell lung cancer - Homo sapiens (human)
Putative miRNA Targets on ERBB2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ERBB2
(miRNA target sites are highlighted)
>ERBB2|NM_001005862|3'UTR
   1 TGAACCAGAAGGCCAAGTCCGCAGAAGCCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGACTTCTGCTGGCATCAAGA
  81 GGTGGGAGGGCCCTCCGACCACTTCCAGGGGAACCTGCCATGCCAGGAACCTGTCCTAAGGAACCTTCCTTCCTGCTTGA
 161 GTTCCCAGATGGCTGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAGCACTGGGGAGTCTTTGTGGATTCTGAGGCCCTG
 241 CCCAATGAGACTCTAGGGTCCAGTGGATGCCACAGCCCAGCTTGGCCCTTTCCTTCCAGATCCTGGGTACTGAAAGCCTT
 321 AGGGAAGCTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTCTAAGAACAAAAGCGACCCATTCAGAGACTGTCCCTGA
 401 AACCTAGTACTGCCCCCCATGAGGAAGGAACAGCAATGGTGTCAGTATCCAGGCTTTGTACAGAGTGCTTTTCTGTTTAG
 481 TTTTTACTTTTTTTGTTTTGTTTTTTTAAAGATGAAATAAAGACCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGT
 561 GTGGGGGGTCCTTCTCCACACCCACTTTGTCCATTTGCAAATATATTTTGGAAAACAGCTA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-125b :: ERBB2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Northern blot , qRT-PCR , Western blot
Conditions SKBR3, MCF10A
Location of target site 3'UTR
Original Description (Extracted from the article) ... Using the human breast cancer cell line SKBR3 as a model for ERBB2 and ERBB3 dependence, infection of these cells with retroviral constructs expressing either miR-125a or miR-125b resulted in suppression of ERBB2 and ERBB3 at both the transcript and protein level. Luciferase constructs containing the 3' 3'-untranslated regions of ERBB2 and ERBB3 demonstrated 35% less activity in miR-125a- and miR-125b-expressing cells relative to controls. ...

- Scott, G. K. Goga, A. Bhaumik, D. Berger, et al., 2007, J Biol Chem.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' agUGUUC---AAU-CCCA-GAGUCCCu 5'
            | |||   | | | || ||||||| 
Target 5' -cAGAAGCCCUGAUGUGUCCUCAGGGa 3'
1 - 26
Article - Scott, G. K. Goga, A. Bhaumik, D. Berger, et al.
- J Biol Chem, 2007
Deregulation of micro-RNAs (miRNAs) is emerging as a major aspect of cancer etiology because their capacity to direct the translation and stability of targeted transcripts can dramatically influence cellular physiology. To explore the potential of exogenously applied miRNAs to suppress oncogenic proteins, the ERBB oncogene family was chosen with a bioinformatics search identifying targeting seed sequences for miR-125a and miR-125b within the 3'-untranslated regions of both ERBB2 and ERBB3. Using the human breast cancer cell line SKBR3 as a model for ERBB2 and ERBB3 dependence, infection of these cells with retroviral constructs expressing either miR-125a or miR-125b resulted in suppression of ERBB2 and ERBB3 at both the transcript and protein level. Luciferase constructs containing the 3' 3'-untranslated regions of ERBB2 and ERBB3 demonstrated approximately 35% less activity in miR-125a- and miR-125b-expressing cells relative to controls. Additionally, phosphorylation of ERK1/2 and AKT was suppressed in SKBR3 cells overexpressing either miR-125a or miR-125b. Consistent with suppression of both ERBB2 and ERBB3 signaling, miR-125a-or miR-125b-overexpressing SKBR3 cells were impaired in their anchorage-dependent growth and exhibited reduced migration and invasion capacities. Parallel studies performed on MCF10A cells demonstrated that miR-125a or miR-125b overexpression produced only marginal influences on the growth and migration of these non-transformed human mammary epithelial cells. These results illustrate the feasibility of using miRNAs as a therapeutic strategy to suppress oncogene expression and function.
LinkOut: [PMID: 17110380]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-125b :: ERBB2    [ Functional MTI ]
Validation Method Western blot
Conditions MDA-MB-453
Location of target site 3'UTR
Tools used in this research Literature survey, miRBase Target Database
Original Description (Extracted from the article) ... This indicates that miR-125b can target the 3`UTR region of c-raf-1 mRNA as predicted from our in silico analysis. ...

- Hofmann, M. H. Heinrich, J. Radziwill, G. et al., 2009, Mol Cancer Res.

Article - Hofmann, M. H. Heinrich, J. Radziwill, G. et al.
- Mol Cancer Res, 2009
The noncoding RNA miR-125b has been described to reduce ErbB2 protein expression as well as proliferation and migration of cancer cell lines. As additional target of miR-125b, we identified the c-raf-1 mRNA by sequence analysis. We designed a short hairpin-looped oligodeoxynucleotide (ODN) targeted to the same 3' untranslated region of c-raf-1 mRNA as miR-125b. The fully complementary ODN antisense strand is linked to a second strand constituting a partially double-stranded structure of the ODN. Transfection of the c-raf-1-specific ODN (ODN-Raf) in a breast cancer cell line reduced the protein levels of C-Raf, ErbB2, and their downstream effector cyclin D1 similar to miR-125b. MiR-125b as well as ODN-Raf showed no effect on the c-raf-1 mRNA level in contrast to small interfering RNA. Unlike miR-125b, ODN-Raf induced a cytopathic effect. This may be explained by the structural properties of ODN-Raf, which can form G-tetrads. Thus, the short hairpin-looped ODN-Raf, targeting the same region of c-raf-1 as miR-125b, is a multifunctional molecule reducing the expression of oncoproteins and stimulating cell death. Both features may be useful to interfere with tumor growth.
LinkOut: [PMID: 19825990]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-125b :: ERBB2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , Western blot
Conditions SKBB3, Raf1, A549
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... The importance of miRNAs not only as regulators but also as effectors of ErbB signalling is emphasized by miR-21, a key mediator of cancer cell growth and invasion whose expression is stimulated by EGFR/ErbB2. Studies are underway to modulate miRNA expression and activity in vivo with a view to developing therapeutics that can effectively block signalling pathways critical to tumour development and progression, although technical hurdles relating to delivery and tissue specificity are still to be overcome. As high-throughput miRNA profiling becomes feasible, a major goal is the identification of miRNA signatures that are predictive of treatment response, clinical outcome, or that can stratify tumour phenotypes. Should recent advances in understanding the basic science of miRNAs in cancer be translated to the clinic then there is the potential that they will transform cancer diagnosis and treatment. ...

- Barker, A. Giles, K. M. Epis, M. R. Zhang, et al., 2010, Curr Opin Pharmacol.

Article - Barker, A. Giles, K. M. Epis, M. R. Zhang, et al.
- Curr Opin Pharmacol, 2010
Recent years have seen a massive expansion in our understanding of the biology of microRNAs (miRNAs) in cancer, through the identification of miRNAs with aberrant expression in specific cancers and the functional validation of their critical target molecules and cellular effects. In parallel, targeted therapeutic agents to block signalling pathways critical to tumour growth and progression have been developed but have yielded disappointing clinical results. The discovery of miRNAs that regulate ErbB signalling in cancer cells brings new hope that in the future these oncogenic pathways can be more effectively inhibited to improve patient outcomes.
LinkOut: [PMID: 20864407]