Accession ID: MIRT003112 [miRNA, hsa-miR-122-5p :: ADAM17, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-122LinkOut: [miRBase ]
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Mature Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-122-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ADAM17 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ADAM18, CD156B, CSVP, MGC71942, TACE
Description ADAM metallopeptidase domain 17
Transcript NM_0031    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ADAM17 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ADAM17
(miRNA target sites are highlighted)
>ADAM17|NM_0031|3'UTR
   1 TAATTTAGTTCTCAGCTCTTCTGACTTAAGTGTGCAAAATATTTTTATAGATTTGACCTACAAATCAATCACAGCTTGTA
  81 TTTTGTGAAGACTGGGAAGTGACTTAGCAGATGCTGGTCATGTGTTTGAACTTCCTGCAGGTAAACAGTTCTTGTGTGGT
 161 TTGGCCCTTCTCCTTTTGAAAAGGTAAGGTGAAGGTGAATCTAGCTTATTTTGAGGCTTTCAGGTTTTAGTTTTTAAAAT
 241 ATCTTTTGACCTGTGGTGCAAAAGCAGAAAATACAGCTGGATTGGGTTATGAATATTTACGTTTTTGTAAATTAATCTTT
 321 TATATTGATAACAGCACTGACTAGGGAAATGATCAGTTTTTTTTTATACACTGTAATGAACCGCTGAATATGAGGCATTT
 401 GGCATTTATTTGTGATGACAACTGGAATAGTTTTTTTTTTTTTTTTTTTTTTTTGCCTTCAACTAAAAACAAAGGAGATA
 481 AATCTAGTATACATTGTCTCTAAATTGTGGGTCTATTTCTAGTTATTACCCAGAGTTTTTATGTAGCAGGGAAAATATAT
 561 ATCTAAATTTAGAAATCATTTGGGTTAATATGGCTCTTCATAATTCTAAGACTAATGCTCTCTAGAAACCTAACCACCTA
 641 CCTTACAGTGAGGGCTATACATGGTAGCCAGTTGAATTTATGGAATCTACCAACTGTTTAGGGCCCTGATTTGCTGGGCA
 721 GTTTTTCTGTATTTTATAAGTATCTTCATGTATCCCTGTTACTGATAGGGATACATGCTCTTAGAAAATTCACTATTGGC
 801 TGGGAGTGGTGGCTCATGCCTGTAATCCCAGCACTTGGAGAGGCTGAGGTTGCGCCACTACACTCCAGCCTGGGTGACAG
 881 AGTGAGACTCTGCCTCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :|:||| |   ||||||| 
Target 5' gttGCGCCACT---ACACTCCa 3'
849 - 867 152.00 -19.00
2
miRNA  3' guUUGUGGUAACA-GUGUGAggu 5'
            |:: :: || | :|||||   
Target 5' tcAGTTTTTTTTTATACACTgta 3'
353 - 375 108.00 -7.55
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :::: ||  || | ||||: 
Target 5' tgGGTGACAGAGTGAGACTCTg 3'
871 - 892 104.00 -8.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-122-5p :: ADAM17    [ Functional MTI ]
Validation Method Other
Article - Grimson, A. Farh, K. K. Johnston, W. K. et al.
- Mol Cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-122-5p :: ADAM17    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR ,
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai, W. C. Hsu, P. W. Lai, T. C. Chau, G. et al., 2009, Hepatology.

Article - Tsai, W. C. Hsu, P. W. Lai, T. C. Chau, G. et al.
- Hepatology, 2009
MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. Conclusion: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-122-5p :: ADAM17    [ Functional MTI ]
Validation Method qRT-PCR
Conditions Hep G2 , Hep 3B , SK-HEP-1
Location of target site 3'UTR
Original Description (Extracted from the article) ... Notably, the RNA level of ADAM10 and ADAM17, another validated target of miR-122, was also suppressed by miR-122 (supplemental Fig. S5). ...

- Bai, S. Nasser, M. W. Wang, B. Hsu, S. H. et al., 2009, J Biol Chem.

Article - Bai, S. Nasser, M. W. Wang, B. Hsu, S. H. et al.
- J Biol Chem, 2009
MicroRNAs are negative regulators of protein coding genes. The liver-specific microRNA-122 (miR-122) is frequently suppressed in primary hepatocellular carcinomas (HCCs). In situ hybridization demonstrated that miR-122 is abundantly expressed in hepatocytes but barely detectable in primary human HCCs. Ectopic expression of miR-122 in nonexpressing HepG2, Hep3B, and SK-Hep-1 cells reversed their tumorigenic properties such as growth, replication potential, clonogenic survival, anchorage-independent growth, migration, invasion, and tumor formation in nude mice. Further, miR-122-expressing HCC cells retained an epithelial phenotype that correlated with reduced Vimentin expression. ADAM10 (a distintegrin and metalloprotease family 10), serum response factor (SRF), and insulin-like growth factor 1 receptor (Igf1R) that promote tumorigenesis were validated as targets of miR-122 and were repressed by the microRNA. Conversely, depletion of the endogenous miR-122 in Huh-7 cells facilitated their tumorigenic properties with concomitant up-regulation of these targets. Expression of SRF or Igf1R partially reversed tumor suppressor function of miR-122. Further, miR-122 impeded angiogenic properties of endothelial cells in vitro. Notably, ADAM10, SRF, and Igf1R were up-regulated in primary human HCCs compared with the matching liver tissue. Co-labeling studies demonstrated exclusive localization of miR-122 in the benign livers, whereas SRF predominantly expressed in HCC. More importantly, growth and clonogenic survival of miR-122-expressing HCC cells were significantly reduced upon treatment with sorafenib, a multi-kinase inhibitor clinically effective against HCC. Collectively, these results suggest that the loss of multifunctional miR-122 contributes to the malignant phenotype of HCC cells, and miR-122 mimetic alone or in combination with anticancer drugs can be a promising therapeutic regimen against liver cancer.
LinkOut: [PMID: 19726678]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-122-5p :: ADAM17    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Zhang, H. Li, Y. Lai, M.
- Oncogene, 2010
Metastasis is the most significant process affecting the clinical management of cancer patients and occurs in multiple sequential steps. However, the molecular pathways underlying each step still remain obscure. Recent research has shown that there is a microRNA (miRNA) network that functions as a regulator of tumor metastasis. In this paper, we review the role of miRNAs in tumor metastasis, including control of epithelial-mesenchymal transition, regulation of metastasis-associated genes and epigenetic alterations. More information on miRNAs will promote a better understanding of the molecular mechanism of metastasis.
LinkOut: [PMID: 19935707]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
238 hsa-miR-122-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450, family 7, subfamily A, polypeptide 1 3 1
MIRT000364 IGF1R insulin-like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor (c-fos serum response element-binding transcription factor) 4 1
MIRT000663 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 2 1
MIRT000717 RHOA ras homolog gene family, member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 (muscle) 4 2
MIRT003081 ANK2 ankyrin 2, neuronal 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase A, fructose-bisphosphate 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 (class I) 3 1
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl CpG binding protein 2 (Rett syndrome) 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 3 2
MIRT003100 TPD52L2 tumor protein D52-like 2 4 3
MIRT003102 GALNT10 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) 3 1
MIRT003103 G6PC3 glucose 6 phosphatase, catalytic, 3 4 2
MIRT003104 AP3M2 adaptor-related protein complex 3, mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 3 1
MIRT003109 TRIB1 tribbles homolog 1 (Drosophila) 3 1
MIRT003110 EGLN3 egl nine homolog 3 (C. elegans) 3 1
MIRT003111 NUMBL numb homolog (Drosophila)-like 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117, member B 3 1
MIRT004364 BCL2L2 BCL2-like 2 4 1
MIRT004527 PRKAB1 protein kinase, AMP-activated, beta 1 non-catalytic subunit 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor, type IC 1 1
MIRT006123 PRKRA protein kinase, interferon-inducible double stranded RNA dependent activator 4 1
MIRT006421 WNT1 wingless-type MMTV integration site family, member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic III 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase, alpha polypeptide I 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT023218 PHOX2A paired-like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting protein 1-like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 (muscle) 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR-related lipid transfer (START) domain containing 13 1 1
MIRT023223 CNN3 calponin 3, acidic 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus homolog 1 (Drosophila) 1 1
MIRT023230 CDY2B chromodomain protein, Y-linked, 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 1 1
MIRT023232 CS citrate synthase 1 1
MIRT023233 RNF170 ring finger protein 170 1 1
MIRT023234 GTF3C6 general transcription factor IIIC, polypeptide 6, alpha 35kDa 1 1
MIRT023235 ZNF321P zinc finger protein 321 1 1
MIRT023236 LAMP1 lysosomal-associated membrane protein 1 1 1
MIRT023237 SLC52A2 G protein-coupled receptor 172A 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase type 13A3 1 1
MIRT023240 CPNE5 copine V 1 1
MIRT023241 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase, class VI, type 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT023249 BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 chromosome 3 open reading frame 39 1 1
MIRT023253 CTPS1 CTP synthase 1 1
MIRT023254 SLC44A1 solute carrier family 44, member 1 1 1
MIRT023255 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor (GEF) 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY (sex determining region Y)-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin-conjugating enzyme E2L 3 1 1
MIRT023268 DNAJC18 DnaJ (Hsp40) homolog, subfamily C, member 18 1 1
MIRT023269 FAM102A family with sequence similarity 102, member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN/MADD domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase (decycling) 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25, member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 1 1
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA-damage-inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif-containing 65 1 1
MIRT023282 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT023285 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain family 11, member A 1 1
MIRT023287 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen-related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT023295 MYCBP c-myc binding protein 1 1
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen, RNA binding protein, homolog 2 (Drosophila) 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A, alpha (PABA peptide hydrolase) 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) 1 1
MIRT023305 PPP1R9B protein phosphatase 1, regulatory (inhibitor) subunit 9B 1 1
MIRT023306 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety homolog 3 (Drosophila) 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium channel, voltage-gated, type IV, beta 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT023314 DMXL1 Dmx-like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine-rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT023318 RBBP5 retinoblastoma binding protein 5 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog (S. cerevisiae) 1 1
MIRT023324 MOB3B MOB1, Mps One Binder kinase activator-like 2B (yeast) 1 1
MIRT023325 FAM118A family with sequence similarity 118, member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain containing 3 1 1
MIRT023328 BATF2 basic leucine zipper transcription factor, ATF-like 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT023330 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family, member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 (sodium/hydrogen exchanger), member 1 1 1
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2-like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP chromosome 20 open reading frame 3 1 1
MIRT023340 WASF1 WAS protein family, member 1 1 1
MIRT023341 LCA5 Leber congenital amaurosis 5 1 1
MIRT023342 NODAL nodal homolog (mouse) 1 1
MIRT023343 CASP7 caspase 7, apoptosis-related cysteine peptidase 1 1
MIRT023344 CPA3 carboxypeptidase A3 (mast cell) 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 homolog (mouse) 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 1 1
MIRT023350 PARP11 poly (ADP-ribose) polymerase family, member 11 1 1
MIRT023351 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT023352 CPNE4 copine IV 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT023356 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 breast cancer 2, early onset 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 (H+/peptide transporter), member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 KIAA0101 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon, alpha 1 1 1
MIRT023374 FSTL3 follistatin-like 3 (secreted glycoprotein) 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 (brain) 1 1
MIRT023378 DCTN5 dynactin 5 (p25) 1 1
MIRT023379 CHST3 carbohydrate (chondroitin 6) sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT023382 POMZP3 POM (POM121 homolog, rat) and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate (chondroitin 4) sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor, beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex, subunit 2-like (yeast) 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 1 1
MIRT023392 LRP11 low density lipoprotein receptor-related protein 11 1 1
MIRT023393 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif-containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 1 1
MIRT023397 FOXK2 forkhead box K2 1 1
MIRT023398 CLIC4 chloride intracellular channel 4 1 1
MIRT023399 ST6GALNAC4 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 1 1
MIRT023402 BAX BCL2-associated X protein 2 2
MIRT023403 CDK4 cyclin-dependent kinase 4 1 1