Accession ID: MIRT003153 [miRNA, hsa-miR-210-3p :: BDNF, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-210LinkOut: [miRBase ]
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Mature Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-210-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BDNF LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ANON2, BULN2
Description brain-derived neurotrophic factor
Transcript NM_001143805    LinkOut: [ RefSeq ]
Other Transcripts NM_001143806 , NM_001143807 , NM_001143808 , NM_001143809 , NM_001143810 , NM_001143811 , NM_001143812 , NM_001143813 , NM_001143814 , NM_001143816 , NM_001709 , NM_170731 , NM_170732 , NM_170733 , NM_170734 , NM_170735   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BDNF LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BDNF
(miRNA target sites are highlighted)
>BDNF|NM_001143805|3'UTR
   1 TGGATTTATGTTGTATAGATTAGATTATATTGAGACAAAAATTATCTATTTGTATATATACATAACAGGGTAAATTATTC
  81 AGTTAAGAAAAAAATAATTTTATGAACTGCATGTATAAATGAAGTTTATACAGTACAGTGGTTCTACAATCTATTTATTG
 161 GACATGTCCATGACCAGAAGGGAAACAGTCATTTGCGCACAACTTAAAAAGTCTGCATTACATTCCTTGATAATGTTGTG
 241 GTTTGTTGCCGTTGCCAAGAACTGAAAACATAAAAAGTTAAAAAAAATAATAAATTGCATGCTGCTTTAATTGTGAATTG
 321 ATAATAAACTGTCCTCTTTCAGAAAACAGAAAAAAACACACACACACACAACAAAAATTTGAACCAAAACATTCCGTTTA
 401 CATTTTAGACAGTAAGTATCTTCGTTCTTGTTAGTACTATATCTGTTTTACTGCTTTTAACTTCTGATAGCGTTGGAATT
 481 AAAACAATGTCAAGGTGCTGTTGTCATTGCTTTACTGGCTTAGGGGATGGGGGATGGGGGGTATATTTTTGTTTGTTTTG
 561 TGTTTTTTTTTCGTTTGTTTGTTTTGTTTTTTAGTTCCCACAGGGAGTAGAGATGGGGAAAGAATTCCTACAATATATAT
 641 TCTGGCTGATAAAAGATACATTTGTATGTTGTGAAGATGTTTGCAATATCGATCAGATGACTAGAAAGTGAATAAAAATT
 721 AAGGCAACTGAACAAAAAAATGCTCACACTCCACATCCCGTGATGCACCTCCCAGGCCCCGCTCATTCTTTGGGCGTTGG
 801 TCAGAGTAAGCTGCTTTTGACGGAAGGACCTATGTTTGCTCAGAACACATTCTTTCCCCCCCTCCCCCTCTGGTCTCCTC
 881 TTTGTTTTGTTTTAAGGAAGAAAAATCAGTTGCGCGTTCTGAAATATTTTACCACTGCTGTGAACAAGTGAACACATTGT
 961 GTCACATCATGACACTCGTATAAGCATGGAGAACAGTGATTTTTTTTTAGAACAGAAAACAACAAAAAATAACCCCAAAA
1041 TGAAGATTATTTTTTATGAGGAGTGAACATTTGGGTAAATCATGGCTAAGCTTAAAAAAAACTCATGGTGAGGCTTAACA
1121 ATGTCTTGTAAGCAAAAGGTAGAGCCCTGTATCAACCCAGAAACACCTAGATCAGAACAGGAATCCACATTGCCAGTGAC
1201 ATGAGACTGAACAGCCAAATGGAGGCTATGTGGAGTTGGCATTGCATTTACCGGCAGTGCGGGAGGAATTTCTGAGTGGC
1281 CATCCCAAGGTCTAGGTGGAGGTGGGGCATGGTATTTGAGACATTCCAAAACGAAGGCCTCTGAAGGACCCTTCAGAGGT
1361 GGCTCTGGAATGACATGTGTCAAGCTGCTTGGACCTCGTGCTTTAAGTGCCTACATTATCTAACTGTGCTCAAGAGGTTC
1441 TCGACTGGAGGACCACACTCAAGCCGACTTATGCCCACCATCCCACCTCTGGATAATTTTGCATAAAATTGGATTAGCCT
1521 GGAGCAGGTTGGGAGCCAAATGTGGCATTTGTGATCATGAGATTGATGCAATGAGATAGAAGATGTTTGCTACCTGAACA
1601 CTTATTGCTTTGAAACTAGACTTGAGGAAACCAGGGTTTATCTTTTGAGAACTTTTGGTAAGGGAAAAGGGAACAGGAAA
1681 AGAAACCCCAAACTCAGGCCGAATGATCAAGGGGACCCATAGGAAATCTTGTCCAGAGACAAGACTTCGGGAAGGTGTCT
1761 GGACATTCAGAACACCAAGACTTGAAGGTGCCTTGCTCAATGGAAGAGGCCAGGACAGAGCTGACAAAATTTTGCTCCCC
1841 AGTGAAGGCCACAGCAACCTTCTGCCCATCCTGTCTGTTCATGGAGAGGGTCCCTGCCTCACCTCTGCCATTTTGGGTTA
1921 GGAGAAGTCAAGTTGGGAGCCTGAAATAGTGGTTCTTGGAAAAATGGATCCCCAGTGAAAACTAGAGCTCTAAGCCCATT
2001 CAGCCCATTTCACACCTGAAAATGTTAGTGATCACCACTTGGACCAGCATCCTTAAGTATCAGAAAGCCCCAAGCAATTG
2081 CTGCATCTTAGTAGGGTGAGGGATAAGCAAAAGAGGATGTTCACCATAACCCAGGAATGAAGATACCATCAGCAAAGAAT
2161 TTCAATTTGTTCAGTCTTTCATTTAGAGCTAGTCTTTCACAGTACCATCTGAATACCTCTTTGAAAGAAGGAAGACTTTA
2241 CGTAGTGTAGATTTGTTTTGTGTTGTTTGAAAATATTATCTTTGTAATTATTTTTAATATGTAAGGAATGCTTGGAATAT
2321 CTGCTATATGTCAACTTTATGCAGCTTCCTTTTGAGGGACAAATTTAAAACAAACAACCCCCCATCACAAACTTAAAGGA
2401 TTGCAAGGGCCAGATCTGTTAAGTGGTTTCATAGGAGACACATCCAGCAATTGTGTGGTCAGTGGCTCTTTTACCCAATA
2481 AGATACATCACAGTCACATGCTTGATGGTTTATGTTGACCTAAGATTTATTTTGTTAAAATCTCTCTCTGTTGTGTTCGT
2561 TCTTGTTCTGTTTTGTTTTGTTTTTTAAAGTCTTGCTGTGGTCTCTTTGTGGCAGAAGTGTTTCATGCATGGCAGCAGGC
2641 CTGTTGCTTTTTTATGGCGATTCCCATTGAAAATGTAAGTAAATGTCTGTGGCCTTGTTCTCTCTATGGTAAAGATATTA
2721 TTCACCATGTAAAACAAAAAACAATATTTATTGTATTTTAGTATATTTATATAATTATGTTATTGAAAAAAATTGGCATT
2801 AAAACTTAACCGCATCAGAACCTATTGTAAATACAAGTTCTATTTAAGTGTACTAATTAACATATAATATATGTTTTAAA
2881 TATAGAATTTTTAATGTTTTTAAATATATTTTCAAAGTACATAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agucggcGACAGU--GUGCGUGUc 5'
                 | ||||  ::|||||| 
Target 5' agggaaaCAGTCATTTGCGCACAa 3'
179 - 202 137.00 -13.00
2
miRNA  3' agucggcgacaGUGUGCGUGUc 5'
                     ||||| |||| 
Target 5' acagaaaaaaaCACACACACAc 3'
346 - 367 123.00 -13.94
3
miRNA  3' agUCGGCGACAGUGUGCGUGUc 5'
            ||  | |||: ||:|||:: 
Target 5' gcAGAAG-TGTTTCATGCATGg 3'
2612 - 2632 111.00 -17.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-210-3p :: BDNF    [ Functional MTI ]
Validation Method 2DGE , immunoprecipitaion , Luciferase reporter assay , Mass spectrometry , Microarray , qRT-PCR , Western blot , Other
Conditions HEK293 , HUVEC , MCF7
Tools used in this research DIANA-microT , EIMMO , miRanda , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... BDNF, PTPN1, and P4HB were down-modulated following miR-210 overexpression and induced when miR-210 was inhibited.//miR-210 inhibited the reporter constructs containing an intact miR-210 binding site (pLUC-210-seed), whereas this effect was prevented by the deletion of the seed complementary nucleotides (pLUC-210-seed del). These data confirm that miR-210 directly inhibits the tested targets. ...

- Fasanaro, P. Greco, S. Lorenzi, M. et al., 2009, J Biol Chem.

Article - Fasanaro, P. Greco, S. Lorenzi, M. et al.
- J Biol Chem, 2009
miR-210 is a key player of cell response to hypoxia, modulating cell survival, VEGF-driven endothelial cell migration and the ability of endothelial cells to form capillary-like structures. A crucial step in understanding miRNA function is the identification of their targets. However, only few miR-210 targets have been identified to date. Here we describe an integrated strategy for large-scale identification of new miR-210 targets, by combining transcriptomics and proteomics with bioinformatic approaches. To experimentally validate candidate targets, the RNA-Induced Silencing Complex (RISC) loaded with miR-210 was purified by immuno-precipitation along with its mRNA targets. The complex was significantly enriched in mRNAs of 31 candidate targets, such as BDNF, GPD1L, ISCU, NCAM and the non-coding RNA Xist. A sub-set of the newly identified targets was further confirmed by 3'UTR-reporter assays, and hypoxia induced down-modulation of their expression was rescued blocking miR-210, providing support for the approach validity. In the case of 9 targets, such as PTPN1 and P4HB, miR-210-seed-pairing sequences localized in the coding-sequence or in the 5'UTR, in line with recent data extending miRNA targeting beyond the ''classic'' 3'UTR recognition. Finally, Gene Ontology analysis of the targets highlights known miR-210 impact on cell cycle regulation and differentiation, and predicts a new role of this miRNA in RNA processing, DNA binding, development, membrane trafficking and aminoacid catabolism. Given the complexity of miRNA actions, we view such multiprong approach as useful to adequately describe the multiple pathways regulated by miR-210 during physio-pathological processes.
LinkOut: [PMID: 19826008]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
111 hsa-miR-210-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 2 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 pim-1 oncogene 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor-like 1 6 3
MIRT000156 RAD52 RAD52 homolog (S. cerevisiae) 4 3
MIRT001930 NPTX1 neuronal pentraxin I 3 2
MIRT002024 EFNA3 ephrin-A3 5 7
MIRT003153 BDNF brain-derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase, beta polypeptide 4 1
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1-like (S. cerevisiae) 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 KIAA1161 3 1
MIRT003163 ISCU iron-sulfur cluster scaffold homolog (E. coli) 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1-like 4 1
MIRT003166 DENND6A DENN/MADD domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 4 1
MIRT003168 CDK10 cyclin-dependent kinase 10 3 1
MIRT003169 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 3 1
MIRT003170 CBX1 chromobox homolog 1 3 1
MIRT003171 XIST X (inactive)-specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL Nipped-B homolog (Drosophila) 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS-domain protein (SRF accessory protein 2) 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase, class VI, type 11C 3 1
MIRT003183 APC adenomatous polyposis coli 3 1
MIRT003184 E2F3 E2F transcription factor 3 5 4
MIRT003185 ACVR1B activin A receptor, type IB 2 1
MIRT003916 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 2 1
MIRT003917 XPA xeroderma pigmentosum, complementation group A 2 1
MIRT004672 MNT MAX binding protein 4 2
MIRT006326 AIFM3 apoptosis-inducing factor, mitochondrion-associated, 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 2 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor (p90, CD71) 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT047006 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT047007 SCN1B sodium channel, voltage-gated, type I, beta subunit 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid (17-beta) dehydrogenase 1 2 1
MIRT054098 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 4 2
MIRT054099 SDHD succinate dehydrogenase complex, subunit D, integral membrane protein 5 3
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae) 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 4 1
MIRT054204 FOXN3 forkhead box N3 4 1
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin-like growth factor binding protein 3 4 1
MIRT054207 COL4A2 collagen, type IV, alpha 2 4 1
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase, 40kDa 4 1
MIRT054209 EHD2 EH-domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamic acid-rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 2 1
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3, alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1, E3 ubiquitin protein ligase 1 2
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 3 1
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator homolog A (yeast) 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 1 2
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 2
MIRT440570 GIT2 G protein-coupled receptor kinase interacting ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT440866 CSNK1E casein kinase 1, epsilon 1 1
MIRT472232 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT473190 MITF microphthalmia-associated transcription factor 1 1
MIRT477856 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT497528 ZNF607 zinc finger protein 607 1 1
MIRT509770 SERTM1 serine-rich and transmembrane domain containing 1 1 3
MIRT524407 CNTNAP5 contactin associated protein-like 5 1 2
MIRT535209 PKIA protein kinase (cAMP-dependent, catalytic) inhibitor alpha 1 2
MIRT554511 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 2
MIRT558069 ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) 1 1
MIRT572273 KCNJ6 potassium inwardly-rectifying channel, subfamily J, member 6 1 1
MIRT574255 DOCK7 dedicator of cytokinesis 7 1 2
MIRT575621 Foxn3 forkhead box N3 1 1
MIRT575742 Zfp618 zinc fingerprotein 618 1 1
MIRT609050 VAMP4 vesicle-associated membrane protein 4 1 1
MIRT611143 TNRC6B trinucleotide repeat containing 6B 1 2
MIRT699226 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT703060 GTDC1 glycosyltransferase-like domain containing 1 1 1
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*