Accession ID: MIRT003153 [miRNA, hsa-miR-210-3p :: BDNF, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-210LinkOut: [miRBase ]
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Mature Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-210-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BDNF LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MGC34632
Description brain-derived neurotrophic factor
Transcript NM_0011438    LinkOut: [ RefSeq ]
Other Transcripts NM_0011438 , NM_0011438 , NM_0011438 , NM_0011438 , NM_0011438 , NM_0011438 , NM_0011438 , NM_0011438 , NM_0011438 , NM_0011438 , NM_0017 , NM_1707 , NM_1707 , NM_1707 , NM_1707 , NM_1707   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BDNF LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BDNF
(miRNA target sites are highlighted)
>BDNF|NM_0011438|3'UTR
   1 TAGTGGATTTATGTTGTATAGATTAGATTATATTGAGACAAAAATTATCTATTTGTATATATACATAACAGGGTAAATTA
  81 TTCAGTTAAGAAAAAAATAATTTTATGAACTGCATGTATAAATGAAGTTTATACAGTACAGTGGTTCTACAATCTATTTA
 161 TTGGACATGTCCATGACCAGAAGGGAAACAGTCATTTGCGCACAACTTAAAAAGTCTGCATTACATTCCTTGATAATGTT
 241 GTGGTTTGTTGCCGTTGCCAAGAACTGAAAACATAAAAAGTTAAAAAAAATAATAAATTGCATGCTGCTTTAATTGTGAA
 321 TTGATAATAAACTGTCCTCTTTCAGAAAACAGAAAAAAACACACACACACACAACAAAAATTTGAACCAAAACATTCCGT
 401 TTACATTTTAGACAGTAAGTATCTTCGTTCTTGTTAGTACTATATCTGTTTTACTGCTTTTAACTTCTGATAGCGTTGGA
 481 ATTAAAACAATGTCAAGGTGCTGTTGTCATTGCTTTACTGGCTTAGGGGATGGGGGATGGGGGGTATATTTTTGTTTGTT
 561 TTGTGTTTTTTTTTCGTTTGTTTGTTTTGTTTTTTAGTTCCCACAGGGAGTAGAGATGGGGAAAGAATTCCTACAATATA
 641 TATTCTGGCTGATAAAAGATACATTTGTATGTTGTGAAGATGTTTGCAATATCGATCAGATGACTAGAAAGTGAATAAAA
 721 ATTAAGGCAACTGAACAAAAAAATGCTCACACTCCACATCCCGTGATGCACCTCCCAGGCCCCGCTCATTCTTTGGGCGT
 801 TGGTCAGAGTAAGCTGCTTTTGACGGAAGGACCTATGTTTGCTCAGAACACATTCTTTCCCCCCCTCCCCCTCTGGTCTC
 881 CTCTTTGTTTTGTTTTAAGGAAGAAAAATCAGTTGCGCGTTCTGAAATATTTTACCACTGCTGTGAACAAGTGAACACAT
 961 TGTGTCACATCATGACACTCGTATAAGCATGGAGAACAGTGATTTTTTTTTAGAACAGAAAACAACAAAAAATAACCCCA
1041 AAATGAAGATTATTTTTTATGAGGAGTGAACATTTGGGTAAATCATGGCTAAGCTTAAAAAAAACTCATGGTGAGGCTTA
1121 ACAATGTCTTGTAAGCAAAAGGTAGAGCCCTGTATCAACCCAGAAACACCTAGATCAGAACAGGAATCCACATTGCCAGT
1201 GACATGAGACTGAACAGCCAAATGGAGGCTATGTGGAGTTGGCATTGCATTTACCGGCAGTGCGGGAGGAATTTCTGAGT
1281 GGCCATCCCAAGGTCTAGGTGGAGGTGGGGCATGGTATTTGAGACATTCCAAAACGAAGGCCTCTGAAGGACCCTTCAGA
1361 GGTGGCTCTGGAATGACATGTGTCAAGCTGCTTGGACCTCGTGCTTTAAGTGCCTACATTATCTAACTGTGCTCAAGAGG
1441 TTCTCGACTGGAGGACCACACTCAAGCCGACTTATGCCCACCATCCCACCTCTGGATAATTTTGCATAAAATTGGATTAG
1521 CCTGGAGCAGGTTGGGAGCCAAATGTGGCATTTGTGATCATGAGATTGATGCAATGAGATAGAAGATGTTTGCTACCTGA
1601 ACACTTATTGCTTTGAAACTAGACTTGAGGAAACCAGGGTTTATCTTTTGAGAACTTTTGGTAAGGGAAAAGGGAACAGG
1681 AAAAGAAACCCCAAACTCAGGCCGAATGATCAAGGGGACCCATAGGAAATCTTGTCCAGAGACAAGACTTCGGGAAGGTG
1761 TCTGGACATTCAGAACACCAAGACTTGAAGGTGCCTTGCTCAATGGAAGAGGCCAGGACAGAGCTGACAAAATTTTGCTC
1841 CCCAGTGAAGGCCACAGCAACCTTCTGCCCATCCTGTCTGTTCATGGAGAGGGTCCCTGCCTCACCTCTGCCATTTTGGG
1921 TTAGGAGAAGTCAAGTTGGGAGCCTGAAATAGTGGTTCTTGGAAAAATGGATCCCCAGTGAAAACTAGAGCTCTAAGCCC
2001 ATTCAGCCCATTTCACACCTGAAAATGTTAGTGATCACCACTTGGACCAGCATCCTTAAGTATCAGAAAGCCCCAAGCAA
2081 TTGCTGCATCTTAGTAGGGTGAGGGATAAGCAAAAGAGGATGTTCACCATAACCCAGGAATGAAGATACCATCAGCAAAG
2161 AATTTCAATTTGTTCAGTCTTTCATTTAGAGCTAGTCTTTCACAGTACCATCTGAATACCTCTTTGAAAGAAGGAAGACT
2241 TTACGTAGTGTAGATTTGTTTTGTGTTGTTTGAAAATATTATCTTTGTAATTATTTTTAATATGTAAGGAATGCTTGGAA
2321 TATCTGCTATATGTCAACTTTATGCAGCTTCCTTTTGAGGGACAAATTTAAAACAAACAACCCCCCATCACAAACTTAAA
2401 GGATTGCAAGGGCCAGATCTGTTAAGTGGTTTCATAGGAGACACATCCAGCAATTGTGTGGTCAGTGGCTCTTTTACCCA
2481 ATAAGATACATCACAGTCACATGCTTGATGGTTTATGTTGACCTAAGATTTATTTTGTTAAAATCTCTCTCTGTTGTGTT
2561 CGTTCTTGTTCTGTTTTGTTTTGTTTTTTAAAGTCTTGCTGTGGTCTCTTTGTGGCAGAAGTGTTTCATGCATGGCAGCA
2641 GGCCTGTTGCTTTTTTATGGCGATTCCCATTGAAAATGTAAGTAAATGTCTGTGGCCTTGTTCTCTCTATGGTAAAGATA
2721 TTATTCACCATGTAAAACAAAAAACAATATTTATTGTATTTTAGTATATTTATATAATTATGTTATTGAAAAAAATTGGC
2801 ATTAAAACTTAACCGCATCAGAACCTATTGTAAATACAAGTTCTATTTAAGTGTACTAATTAACATATAATATATGTTTT
2881 AAATATAGAATTTTTAATGTTTTTAAATATATTTTCAAAGTACATAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agucggcGACAGU--GUGCGUGUc 5'
                 | ||||  ::|||||| 
Target 5' agggaaaCAGTCATTTGCGCACAa 3'
182 - 205 137.00 -13.00
2
miRNA  3' agucggcgacaGUGUGCGUGUc 5'
                     ||||| |||| 
Target 5' acagaaaaaaaCACACACACAc 3'
349 - 370 123.00 -13.94
3
miRNA  3' agUCGGCGACAGUGUGCGUGUc 5'
            ||  | |||: ||:|||:: 
Target 5' gcAGAAG-TGTTTCATGCATGg 3'
2615 - 2635 111.00 -17.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-210-3p :: BDNF    [ Functional MTI ]
Validation Method 2DGE , immunoprecipitaion , Luciferase reporter assay , Mass spectrometry , Microarray , qRT-PCR , Western blot , Other
Conditions HEK293 , HUVEC , MCF7
Tools used in this research DIANA-microT , EIMMO , miRanda , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... BDNF, PTPN1, and P4HB were down-modulated following miR-210 overexpression and induced when miR-210 was inhibited.//miR-210 inhibited the reporter constructs containing an intact miR-210 binding site (pLUC-210-seed), whereas this effect was prevented by the deletion of the seed complementary nucleotides (pLUC-210-seed del). These data confirm that miR-210 directly inhibits the tested targets. ...

- Fasanaro, P. Greco, S. Lorenzi, M. et al., 2009, J Biol Chem.

Article - Fasanaro, P. Greco, S. Lorenzi, M. et al.
- J Biol Chem, 2009
miR-210 is a key player of cell response to hypoxia, modulating cell survival, VEGF-driven endothelial cell migration and the ability of endothelial cells to form capillary-like structures. A crucial step in understanding miRNA function is the identification of their targets. However, only few miR-210 targets have been identified to date. Here we describe an integrated strategy for large-scale identification of new miR-210 targets, by combining transcriptomics and proteomics with bioinformatic approaches. To experimentally validate candidate targets, the RNA-Induced Silencing Complex (RISC) loaded with miR-210 was purified by immuno-precipitation along with its mRNA targets. The complex was significantly enriched in mRNAs of 31 candidate targets, such as BDNF, GPD1L, ISCU, NCAM and the non-coding RNA Xist. A sub-set of the newly identified targets was further confirmed by 3'UTR-reporter assays, and hypoxia induced down-modulation of their expression was rescued blocking miR-210, providing support for the approach validity. In the case of 9 targets, such as PTPN1 and P4HB, miR-210-seed-pairing sequences localized in the coding-sequence or in the 5'UTR, in line with recent data extending miRNA targeting beyond the ''classic'' 3'UTR recognition. Finally, Gene Ontology analysis of the targets highlights known miR-210 impact on cell cycle regulation and differentiation, and predicts a new role of this miRNA in RNA processing, DNA binding, development, membrane trafficking and aminoacid catabolism. Given the complexity of miRNA actions, we view such multiprong approach as useful to adequately describe the multiple pathways regulated by miR-210 during physio-pathological processes.
LinkOut: [PMID: 19826008]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
55 hsa-miR-210-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 2 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 pim-1 oncogene 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor-like 1 5 2
MIRT000156 RAD52 RAD52 homolog (S. cerevisiae) 4 3
MIRT001930 NPTX1 neuronal pentraxin I 3 2
MIRT002024 EFNA3 ephrin-A3 4 5
MIRT003153 BDNF brain-derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase, beta polypeptide 4 1
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1-like (S. cerevisiae) 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 KIAA1161 3 1
MIRT003163 ISCU iron-sulfur cluster scaffold homolog (E. coli) 6 5
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1-like 4 1
MIRT003166 DENND6A family with sequence similarity 116, member A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 4 1
MIRT003168 CDK10 cyclin-dependent kinase 10 3 1
MIRT003169 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 3 1
MIRT003170 CBX1 chromobox homolog 1 (HP1 beta homolog Drosophila ) 3 1
MIRT003171 XIST X (inactive)-specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL Nipped-B homolog (Drosophila) 3 1
MIRT003176 MIB1 mindbomb homolog 1 (Drosophila) 3 1
MIRT003177 HECTD1 HECT domain containing 1 3 1
MIRT003178 ELK3 ELK3, ETS-domain protein (SRF accessory protein 2) 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase, class VI, type 11C 3 1
MIRT003183 APC adenomatous polyposis coli 3 1
MIRT003184 E2F3 E2F transcription factor 3 4 3
MIRT003185 ACVR1B activin A receptor, type IB 2 1
MIRT003916 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 2 1
MIRT003917 XPA xeroderma pigmentosum, complementation group A 2 1
MIRT004672 MNT MAX binding protein 4 1
MIRT006326 AIFM3 apoptosis-inducing factor, mitochondrion-associated, 3 1 1
MIRT006519 CASP8AP2 caspase 8 associated protein 2 2 1
MIRT006663 VMP1 transmembrane protein 49 3 1
MIRT006830 TFRC transferrin receptor (p90, CD71) 2 1
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT047006 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT047007 SCN1B sodium channel, voltage-gated, type I, beta 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1