Accession ID: MIRT003202 [miRNA, kshv-miR-K12-1-5p :: NFKBIA, target gene]
miRNA Infomation
miRNA namekshv-miR-K12-1-5p
Gene Information
Gene Symbol NFKBIA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms IKBA, MAD-3, NFKBI
Description nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Transcript NM_0205    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NFKBIA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NFKBIA
(miRNA target sites are highlighted)
>NFKBIA|NM_0205|3'UTR
   1 GCGCAAAGGGGCTGAAAGAACATGGACTTGTATATTTGTACAAAAAAAAAGTTTTATTTTTCTAAAAAAAGAAAAAAGAA
  81 GAAAAAATTTAAAGGGTGTACTTATATCCACACTGCACACTGCCTGGCCCAAAACGTCTTATTGTGGTAGGATCAGCCCT
 161 CATTTTGTTGCTTTTGTGAACTTTTTGTAGGGGACGAGAAAGATCATTGAAATTCTGAGAAAACTTCTTTTAAACCTCAC
 241 CTTTGTGGGGTTTTTGGAGAAGGTTATCAAAAATTTCATGGAAGGACCACATTTTATATTTATTGTGCTTCGAGTGACTG
 321 ACCCCAGTGGTATCCTGTGACATGTAACAGCCAGGAGTGTTAAGCGTTCAGTGATGTGGGGTGAAAAGTTACTACCTGTC
 401 AAGGTTTGTGTTACCCTCCTGTAAATGGTGTACATAATGTATTGTTGGTAATTATTTTGGTACTTTTATGATGTATATTT
 481 ATTAAACAGATTTTTACAAATGA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target kshv-miR-K12-1-5p :: NFKBIA    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot ,
Conditions 293T
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-K1, which directly regulates the IIoBI± protein level by targeting the 3A’UTR of its transcript ...

- Lei, X. Bai, Z. Ye, F. Xie, J. Kim, C. G. et al., 2010, Nat Cell Biol.

Article - Lei, X. Bai, Z. Ye, F. Xie, J. Kim, C. G. et al.
- Nat Cell Biol, 2010
Kaposi's sarcoma-associated herpesvirus (KSHV) is causally linked to several acquired immune deficiency syndrome-related malignancies, including Kaposi's sarcoma, primary effusion lymphoma (PEL) and a subset of multicentric Castleman's disease. Control of viral lytic replication is essential for KSHV latency, evasion of the host immune system and induction of tumours. Here, we show that deletion of a 14 microRNA (miRNA) cluster from the KSHV genome significantly enhances viral lytic replication as a result of reduced NF-kappaB activity. The miRNA cluster regulates the NF-kappaB pathway by reducing expression of IkappaBalpha protein, an inhibitor of NF-kappaB complexes. Computational and miRNA seed mutagenesis analyses were used to identify KSHV miR-K1, which directly regulates the IkappaBalpha protein level by targeting the 3'UTR of its transcript. Expression of miR-K1 is sufficient to rescue NF-kappaB activity and inhibit viral lytic replication, whereas inhibition of miR-K1 in KSHV-infected PEL cells has the opposite effect. Thus, KSHV encodes an miRNA to control viral replication by activating the NF-kappaB pathway. These results demonstrate an important role for KSHV miRNAs in regulating viral latency and lytic replication by manipulating the host survival pathway.
LinkOut: [PMID: 20081837]
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
2 kshv-miR-K12-1-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003202 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 3 1
MIRT003208 MAF v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) 3 1