Accession ID: MIRT003207 [miRNA, kshv-miR-K12-11-3p :: MAF, target gene]
pre-miRNA Information
pre-miRNA ID kshv-mir-K12-11LinkOut: [miRBase ]
Description Kaposi sarcoma-associated herpesvirus miR-K12-11 stem-loop
Comment Samols et al. incorrectly named this sequence miR-6 .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA kshv-miR-K12-11-3p
Mature Sequence 46| UUAAUGCUUAGCCUGUGUCCGA |67
Evidence Experimental
Experiments Cloned
Putative kshv-miR-K12-11-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MAF LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MGC71685, c-MAF
Description v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)
Transcript NM_0010318    LinkOut: [ RefSeq ]
Other Transcripts NM_0053   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MAF LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MAF
(miRNA target sites are highlighted)
>MAF|NM_0010318|3'UTR
   1 TGAGTCTGACACGCGATTCCAGCTAGCCACCCTGATAAGTGCTCCGCGGGGGTCCGGCTCGGGTGTGGGCTTGCTAGTTC
  81 TAGAGCCATGCTCGCCACCACCTCACCACCCCCACCCCCACCGAGTTTGGCCCCCTTGGCCCCCTACACACACACAAACC
 161 CGCACGCACACACCACACACACACACACACACACACACACACCCCACACCCTGCTCGAGTTTGTGGTGGTGGTGGCTGTT
 241 TTAAACTGGGGAGGGAATGGGTGTCTGGCTCATGGATTGCCAATCTGAAATTCTCCATAACTTGCTAGCTTGTTTTTTTT
 321 TTTTTTTTACACCCCCCCGCCCCACCCCCGGACTTGCACAATGTTCAATGATCTCAGCAGAGTTCTTCATGTGAAACGTT
 401 GATCACCTTTGAAGCCTGCATCATTCACATATTTTTTCTTCTTCTTCCCCTTCAGTTCATGAACTGGTGTTCATTTTCTG
 481 TGTGTGTGTGTGTTTTATTTTGTTTGGATTTTTTTTTTTAATTTTACTTTTAGAGCTTGCTGTGTTGCCCACCTTTTTTC
 561 CAACCTCCACCCTCACTCCTTCTCAACCCATCTCTTCCGAGATGAAAGAAAAAAAAAAGCAAAGTTTTTTTTTCTTCTCC
 641 TGAGTTCTTCATGTGAGATTGAGCTTGCAAAGGAAAAAAAAATGTGAAATGTTATAGACTTGCAGCGTGCCGAGTTCCAT
 721 CGGGTTTTTTTTTTAGCATTGTTATGCTAAAATAGAGAAAAAAATCCTCATGAACCTTCCACAATCAAGCCTGCATCAAC
 801 CTTCTGGGTGTGACTTGTGAGTTTTGGCCTTGTGATGCCAAATCTGAGAGTTTAGTCTGCCATTAAAAAAACTCATTCTC
 881 ATCTCATGCATTATTATGCTTGCTACTTTGTCTTAGCAACAATGAACTATAACTGTTTCAAAGACTTTATGGAAAAGAGA
 961 CATTATATTAATAAAAAAAAAAAGCCTGCATGCTGGACATGTATGGTATAATTATTTTTTCCTTTTTTTTTCCTTTTGGC
1041 TTGGAAATGGACGTTCGAAGACTTATAGCATGGCATTCATACTTTTGTTTTATTGCCTCATGACTTTTTTGAGTTTAGAA
1121 CAAAACAGTGCAACCGTAGAGCCTTCTTCCCATGAAATTTTGCATCTGCTCCAAAACTGCTTTGAGTTACTCAGAACTTC
1201 AACCTCCCAATGCACTGAAGGCATTCCTTGTCAAAGATACCAGAATGGGTTACACATTTAACCTGGCAAACATTGAAGAA
1281 CTCTTAATGTTTTCTTTTTAATAAGAATGACGCCCCACTTTGGGGACTAAAATTGTGCTATTGCCGAGAAGCAGTCTAAA
1361 ATTTATTTTTTAAAAAGAGAAACTGCCCCATTATTTTTGGTTTGTTTTATTTTTATTTTATATTTTTTGGCTTTTGGTCA
1441 TTGTCAAATGTGGAATGCTCTGGGTTTCTAGTATATAATTTAATTCTAGTTTTTATAATCTGTTAGCCCAGTTAAAATGT
1521 ATGCTACAGATAAAGGAATGTTATAGATAAATTTGAAAGAGTTAGGTCTGTTTAGCTGTAGATTTTTTAAACGATTGATG
1601 CACTAAATTGTTTACTATTGTGATGTTAAGGGGGGTAGAGTTTGCAAGGGGACTGTTTAAAAAAAGTAGCTTATACAGCA
1681 TGTGCTTGCAACTTAAATATAAGTTGGGTATGTGTAGTCTTTGCTATACCACTGACTGTATTGAAAACCAAAGTATTAAG
1761 AGGGGAAACGCCCCTGTTTATATCTGTAGGGGTATTTTACATTCAAAAATGTATGTTTTTTTTTCTTTTCAAAATTAAAG
1841 TATTTGGGACTGAATTGCACTAAGATATAACCTGCAAGCATATAATACAAAAAAAAATTGCAAAACTGTTTAGAACGCTA
1921 ATAAAATTTATGCAGTTATAAAAATGGCATTACTGCACAGTTTTAAGATGATGCAGATTTTTTTACAGTTGTATTGTGGT
2001 GCAGAACTGGATTTTCTGTAACTTAAAAAAAAATCCACAGTTTTAAAGGCAATAATCAGTAAATGTTATTTTCAGGGACT
2081 GACATCCTGTCTTTAAAAAGAAATGAAAAGTAAATCTTACCACAATAAATATAAAAAAATCTTGTCAGTTACTTTTCTTT
2161 TACATATTTTGCTGTGCAAAATTGTTTTATATCTTGAGTTACTAACTAACCACGCGTGTTGTTCCTATGTGCTTTTCTTT
2241 CATTTTCAATTCTGGTTATATCAAGAAAAGAATAATCTACAATAATAAACGGCATTTTTTTTTGATTCTGTACTCAGTTT
2321 CTTAGTGTACAGTTTAACTGGGCCCAACAACCTCGTTAAAAGTGTAAAATGCATCCTTTTCTCCAGTGGAAGGATTCCTG
2401 GAGGAATAGGGAGACAGTAATTCAGGGTGAAATTATAGGCTGTTTTTTGAAGTGAGGAGGCTGGCCCCATATACTGATTA
2481 GCAATATTTAATATAGATGTAAATTATGACCTCATTTTTTTCTCCCCAAAGTTTTCAGTTTTCAAATGAGTTGAGCCATA
2561 ATTGCCCTTGGTAGGAAAAACAAAACAAAACAGTGGAACTAGGCTTCCTGAGCATGGCCCTACACTTCTGATCAGGAGCA
2641 AAGCCATCCATAGACAGAGGAGCCGGACAAATATGGCGCATCAGAGGTGGCTTGCGCACATATGCATTGAACGGTAAAGA
2721 GAAACAGCGCTTGCCTTTTCACTAAAGTTGACTATTTTTCCTTCTTCTCTTACACACCGAGATTTTCTTGTTAGCAAGGC
2801 CTGACAAGATTTAACATAAACATGACAAATCATAGTTGTTTGTTTTGTTTTGCTTTTCTCTTTAACACTGAAGATCATTT
2881 GTCTTAAATAGGAAAAAGAAAATCCACTCCTTACTTCCATATTTCCAAGTACATATCTGGTTTAAACTATGTTATCAAAT
2961 CATATTTCACCGTGAATATTCAGTGGAGAACTTCTCTACCTGGATGAGCTAGTAATGATTTCAGATCATGCTATCCCCAG
3041 AAATAAAAGCAAAAAATAATACCTGTGTGGAATATAGGCTGTGCTTTGATTTACTGGTATTTACCCCAAAATAGGCTGTG
3121 TATGGGGGCTGACTTAAAGATCCCTTGGAAAGACTCAAAACTACCTTCACTAGTAGGACTCCTAAGCGCTGACCTATTTT
3201 TAAATGACACAAATTCATGAAACTAATGTTACAAATTCATGCAGTTTGCACTCTTAGTCATCTTCCCCTAGCACACCAAT
3281 AGAATGTTAGACAAAGCCAGCACTGTTTTGAAAATACAGCCAAACACGATGACTTTTGTTTTGTTTTCTGCCGTTCTTAA
3361 AAGAAAAAAAGATAATATTGCAACTCTGACTGAAAGACTTATTTTTAAGAAAACAGGTTGTGTTTGGTGCTGCTAAGTTC
3441 TGGCCAGTTTATCATCTGGCCTTCCTGCCTATTTTTTACAAAACACGAAGACAGTGTGTAACCTCGACATTTTGACCTTC
3521 CTTTATGTGCTAGTTTAGACAGGCTCCTGAATCCACACTTAATTTTGCTTAACAAAAGTCTTAATAGTAAACCTCCCCTC
3601 ATGAGCTTGAAGTCAAGTGTTCTTGACTTCAGATATTTCTTTCCTTTTTTTTTTTTTTTCCTCATCACAACTAAGAGATA
3681 CACAAACTCTGAAGAAGCAGAAATGGAGAGAATGCTTTTAACAAAAAAGCATCTGATGAAAGATTTTAGGCAAACATTCT
3761 CAAAATAAGAGTGATATTCTGGATGTAGTTATTGCAGTTATCTCATGACAAATGAGGCCTGGATTGGAAGGAAAATATAG
3841 TTGTGTAGAATTAAGCATTTTGATAGGAATCTACAAGGTAGTTGAATATAATAAGCAGGTTTGGGCCCCCAAACTTTAGA
3921 AAATCAAATGCAAAGGTGCTGGCAAAAATGAGGTTTGAGTGGCTGGCTGTAAGAGAAGGTTAACTCCTAGTAAAAGGCAT
4001 TTTTAGAAATAACAATTACTGAAAACTTTGAAGTATAGTGGGAGTAGCAAACAAATACATGTTTTTTTTTTCTTACAAAG
4081 AACTCCTAAATCCTGAGTAAGTGCCATTCATTACAATAAGTCTCTAAATTTAAAAAAAAAAAAATCATATGAGGAAATCT
4161 AGCTTTCCCCTTTACGCTGCGTTTGATCTTTGTCTAAATAGTGTTAAAATTCCTTTCATTCCAATTACAGAACTGAGCCC
4241 ACTCGCAAGTTGGAGCCATCAGTGGGATACGCCACATTTTGGAAGCCCCAGCATCGTGTACTTACCAGTGTGTTCACAAA
4321 ATGAAATTTGTGTGAGAGCTGTACATTAAAAAAAATCATCATTATTATTATTATTTGCAGTCATGGAGAACCACCTACCC
4401 CTGACTTCTGTTTAGTCTCCTTTTTAAATAAAAATTACTGTGTTAGAGAAGAAGGCTATTAAATGTAGTAGTTAACTATG
4481 CCTCTTGTCTGGGGGTTTCATAGAGACCGGTAGGAAAGCGCACTCCTGCTTTTCGATTTATGGTGTGTGCAAGTAAACAG
4561 GTGCATTGCTTTCAACCTGCCATACTAGTTTTAAAAATTCACTGAAATTACAAAGATACATATATATGCATATATATAAT
4641 GGAAAGTTTCCCGGAATGCAACAATTAGCATTTTAAAATCATATATAGGCATGCACATTCTAAATAGTACTTTTTCATGC
4721 TTCATTGTTTCTCTGGCAGATAATTTTACTAAGAAGAAAAATAGATATTCGACTCCCCTTCCCTAAACAAATCCACGGGC
4801 AGAGGCTCCAGCGGAGCCGAGCCCCCTGGTTTTCTCGTAGGCCCTAGACGGTGTTGCATTTATCAGTGATGTCAAACGTG
4881 CTCATTTGTCAGACATAGCTGTAAATGAAAACAATGTGTGGCAAAATACAAAGTTAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agccUGUGUC-CGAUUCGUAAuu 5'
              ::::||  :||||||||  
Target 5' agttGTGTAGAATTAAGCATTtt 3'
3839 - 3861 134.00 -8.80
2
miRNA  3' agCCUGUGUCCGAUUCGUAAUu 5'
            | | ||   | |||:|||| 
Target 5' ttGAAAAC---CAAAGTATTAa 3'
1741 - 1759 133.00 -5.70
3
miRNA  3' agcCUGUGUCCGA--UUCGUA-AUu 5'
             ||:|:|  ||  |||||| || 
Target 5' taaGATATAACCTGCAAGCATATAa 3'
1861 - 1885 129.00 -8.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target kshv-miR-K12-11-3p :: MAF    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Other
Conditions HEK293
Location of target site 3'UTR
Tools used in this research PITA
Original Description (Extracted from the article) ... Site-directed mutagenesis of KSHV miRNA predicted target sites in the MAF 3`UTR abolished silencing (Fig. 3D; Supplemental Fig. 2D), confirming that miR-K12-1, miR-K12-6-5p, and miR-K12-11 regulate MAF by interacting with the 3`UTR ...

- Hansen, A. Henderson, S. Lagos, D. et al., 2010, Genes Dev.

Article - Hansen, A. Henderson, S. Lagos, D. et al.
- Genes Dev, 2010
Kaposi sarcoma herpesvirus (KSHV) induces transcriptional reprogramming of endothelial cells. In particular, KSHV-infected lymphatic endothelial cells (LECs) show an up-regulation of genes associated with blood vessel endothelial cells (BECs). Consequently, KSHV-infected tumor cells in Kaposi sarcoma are poorly differentiated endothelial cells, expressing markers of both LECs and BECs. MicroRNAs (miRNAs) are short noncoding RNA molecules that act post-transcriptionally to negatively regulate gene expression. Here we validate expression of the KSHV-encoded miRNAs in Kaposi sarcoma lesions and demonstrate that these miRNAs contribute to viral-induced reprogramming by silencing the cellular transcription factor MAF (musculoaponeurotic fibrosarcoma oncogene homolog). MAF is expressed in LECs but not in BECs. We identify a novel role for MAF as a transcriptional repressor, preventing expression of BEC-specific genes, thereby maintaining the differentiation status of LECs. These findings demonstrate that viral miRNAs could influence the differentiation status of infected cells, and thereby contribute to KSHV-induced oncogenesis.
LinkOut: [PMID: 20080955]
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
8 kshv-miR-K12-11-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002349 TM6SF1 transmembrane 6 superfamily member 1 2 1
MIRT002350 MATR3 matrin 3 2 1
MIRT002351 LDOC1 leucine zipper, down-regulated in cancer 1 2 1
MIRT003207 MAF v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) 3 1
MIRT003981 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 4 2
MIRT006133 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 2 1
MIRT006637 SMAD5 SMAD family member 5 2 1
MIRT007168 JARID2 jumonji, AT rich interactive domain 2 1 1