Accession ID: MIRT003210 [miRNA, hsa-miR-181c-5p :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181cLinkOut: [miRBase ]
Synonyms MIRN181C, mir-181c, MIR181C
Description Homo sapiens miR-181c stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181c-5p
Mature Sequence 27| AACAUUCAACCUGUCGGUGAGU |48
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_0333    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_0333|3'UTR
   1 TCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAA
  81 AGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTACAA
 161 GTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAGACT
 241 GTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGAGTT
 321 TTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATGCAG
 401 TTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTATTC
 481 TGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACATTGA
 561 GGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAATGTA
 641 AAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATTTTT
 721 TCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGATAA
 801 ATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATTTTG
 881 GGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAATTAA
 961 ATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATAGTT
1041 TTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAAGGC
1121 CAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTGTCA
1201 TGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGGTCC
1281 TGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAACTCA
1361 AAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAATCT
1441 CTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAATAAT
1521 GCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATGGCA
1601 TGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTTTGA
1681 GGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATGTAA
1761 TTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACACCAT
1841 CTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCTTCT
1921 TCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCCCTA
2001 ACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTTATT
2081 TCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGATGCT
2161 TTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTATCCA
2241 GTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACAGTA
2321 ATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTTTTT
2401 GGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCCAGG
2481 TTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTGTAT
2561 TTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTGGCC
2641 TCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAAGGC
2721 ACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTACTA
2801 AGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCAGCT
2881 CTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAGGAA
2961 TAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTATGT
3041 CAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAATAG
3121 TTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGATTTC
3201 TGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTCTAC
3281 ACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGTAGA
3361 TGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAGAGA
3441 TTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTTTTT
3521 TTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATTTGA
3601 GTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTATAG
3681 GTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTACAG
3761 TTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAACTT
3841 TTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATAATT
3921 GTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGGATA
4001 GCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAGTTC
4081 TTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAGGTA
4161 ATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAGAGC
4241 TAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCATTTT
4321 TCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTTGTA
4401 TAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTTTCC
4481 ATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAACTTT
4561 TAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAATTA
4641 TTGTAATGTAATAAAAATAGTTACAGTGAC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugAGUGGCUGUCCAACUUACAa 5'
            |:||| |: |  ||||||| 
Target 5' tcTTACCAATTG--TGAATGTt 3'
419 - 438 156.00 -14.30
2
miRNA  3' ugAGUGGCUGUCCAACUUACAa 5'
            |||:|  |  | ||||||| 
Target 5' tgTCATC--CCTGATGAATGTa 3'
621 - 640 152.00 -9.80
3
miRNA  3' ugAGUGGCUGUCCAACUUACAa 5'
            |||:: : ||  ||||||| 
Target 5' taTCATTTG-AG--TGAATGTt 3'
3591 - 3609 147.00 -8.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181c-5p :: KRAS    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions 293T
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar
Original Description (Extracted from the article) ... Statistically significant repression of luciferase activity was observed in 293T cells co-transfected with the miR-181c precursor molecule and a reporter vector containing the NOTCH4 or KRAS 3`-UTR target site (Figure 5E). On the other hand, no notable alteration of luciferase activity was detected between the Pre-miR-181c transfectant and the control counterpart in the case of NOTCH2. ...

- Hashimoto, Y. Akiyama, Y. Otsubo, T. et al., 2010, Carcinogenesis.

Article - Hashimoto, Y. Akiyama, Y. Otsubo, T. et al.
- Carcinogenesis, 2010
Aberrant expression of microRNA (miRNA) has been reported in various cancers. To clarify the role of miRNA in gastric carcinogenesis, we performed miRNA microarray analysis and investigated expression changes of miRNAs in a 5-aza-2'-deoxycytidine (5-aza-CdR)-treated gastric cancer cell line, KATO-III. On microarray analysis, 5 miRNAs were found to be up-regulated (>3-fold) after 5-aza-CdR treatment compared with untreated cells. Among them, miR-181c and miR-432AS exhibited CpG islands in their upstream sequences on computational analysis, and their up-regulation was verified by reverse transcription-PCR analyses. In particular, miR-181c up-regulation was found not only in KATO-III but also in two other gastric and one colorectal cancer cell line with 5-aza-CdR treatment. Decreased expression of miR-181c was observed in 9 of 16 primary gastric carcinoma cases compared with in the corresponding non-cancerous stomach tissues. Hypermethylation signals in the upstream region of miR-181c were observed in some cultured and primary gastric carcinoma cells with negative or low miR-181c expression. Transfection of the precursor miR-181c molecule induced decreased growth of two gastric cancer cell lines, KATO-III and MKN45. As for targets of miR-181c, oncogenic NOTCH4 and KRAS were identified by cDNA microarray analysis after precursor miR-181c molecule transfection, computational searches of miRNA target databases, and reporter assaying using the 3'-UTR regions of the two genes. These results indicate that miR-181c may be silenced through methylation and play important roles in gastric carcinogenesis through its target genes, such as NOTCH4 and KRAS.
LinkOut: [PMID: 20080834]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
18 hsa-miR-181c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000233 NLK nemo-like kinase 2 1
MIRT000234 GATA6 GATA binding protein 6 2 1
MIRT000235 CDX2 caudal type homeobox 2 2 1
MIRT003209 NOTCH2 notch 2 4 1
MIRT003210 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 1
MIRT003211 NOTCH4 notch 4 4 1
MIRT003499 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT006845 Tnf tumor necrosis factor 3 1
MIRT006877 TRIM2 tripartite motif containing 2 1 1
MIRT006878 SIRT1 sirtuin 1 1 1
MIRT006896 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT007221 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT025034 IL2 interleukin 2 3 1
MIRT047219 TUB tubby homolog (mouse) 1 1
MIRT047220 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT047221 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT047222 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 1 1
MIRT047223 ISCA1 iron-sulfur cluster assembly 1 homolog (S. cerevisiae) 1 1