Accession ID: MIRT003225 [miRNA, hsa-miR-424-5p :: ITPR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-424LinkOut: [miRBase ]
Synonyms MIR322, MIRN424, hsa-mir-424, miRNA424, MIR424
Description Homo sapiens miR-424 stem-loop
Comment This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells . The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-424-5p
Mature Sequence 11| CAGCAGCAAUUCAUGUUUUGAA |32
Evidence Experimental
Experiments Cloned
Putative hsa-miR-424-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ITPR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DKFZp313E1334, DKFZp313N1434, INSP3R1, IP3R, IP3R1, SCA15, SCA16
Description inositol 1,4,5-triphosphate receptor, type 1
Transcript NM_0010999    LinkOut: [ RefSeq ]
Other Transcripts NM_0011682 , NM_0022   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ITPR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ITPR1
(miRNA target sites are highlighted)
>ITPR1|NM_0010999|3'UTR
   1 TAAGCAAATGAAAGAAAGGAATTGTATTTACCTTTTATAATTATTATTAGTGTGGGTATGGCTAATGAGTTCTGATTCAC
  81 CCACGAAGGTTACATTTATGCTGAATACATTTGTAAATACTCAGTTTTATACTGTATGTATATGATTGCTACTCTAAAGG
 161 TTTGGATATATGTATTGTAATTAGAATTGTTGGCATGATGACATTTCATTTGTGCCAAAAATATTAAAAATGCCTTTTTT
 241 GGAAGGACTAACAGAAAGCACCTGATTTGCACTTGAACCAGATTATAGATTTAAAAGTATATGACATGTATTTTGTATTT
 321 AAAACTAGAATAGCCAGTATTTATGTTTTTTATAAAACTGTGCAATACGAATTATGCAATCACAATACATTTGTAGCTCC
 401 CGAGTGTCCTAAAGGGAGTGCACTTCTTTGAAGCTGGTGTGTTAATACTATGTAATAAATGGTTAACTTTCAAATGATGC
 481 TGCTGCCAAAATTATATTAATAGTGAGTTTCAGGCCCCTGGGCATTTTGTACCATGTAATTATCCTCTGGTGATGCTGTT
 561 TCTCGTTAGTGGCAGTAGTGCCTCCGTCTCCTAGTGATAATGCTCCAAGTCTATGAACTGTTAAATCAGCATTCATTTTA
 641 AGAAAAGCAACTTTAGTTTCAAAGATACTTTTAAGCTTCTAAATTGATCATTTAAACTATTTCTTTAAATAAGAGAGCCA
 721 AATTAGAGGCTCATACTTTAGCTTGTGAAGAAGATAATGAATTTTTTAAAGGGAACTTTCTATGCAATGTTCAGGATAAA
 801 TGCATACTGCTGGCCAATCAGTGTCATCTCCTGGGTAAATTTTGATGTCGCATTATAAAGACATGCATAATTGATGGTTT
 881 CTAGATTATCTAGTCCAAACAATAGAGTTTATTTTTTCTTCATCTGAACCAACATGCTACAGTAGCTAAGAAGTATTAAA
 961 ACTATATACATCCATATAAAGATGAAATATGAACTATCTCATTAGAAGTCATAGTTGACCACAGACATGTTATTCTTCTG
1041 AAAGAGCCACATTTTGGTTTTATTTCTTGTCACATGATTTCTTTTCTTGATGGATGAAAAATATGAAAGGAAACTTTTAT
1121 ATCTGTTGCCTAGTTTTGTACATGGATCTCATTTTACAAGAGAATCTCTCTGCAAAAAAAAAAAAAACAGTTTAAAAATG
1201 CATTGAAAGCAGAGTTCTGAAATGAGTAAAGTTTGTAAATGCATATATAAAAATATTTAATAAATGATGCAGAATATACA
1281 GTGACTGGTTGGTGGCTTTCATTTGGCATTTGTGACTTAACTGCTATTCCATTTATGTACTTTCTTTAGGATCAGTTTGA
1361 AGTACAGTCGGTTTGATTACCAGGTTAATTCAGAAAATGTTTACCTGATTATTTAAAAAAACACTTGCTGTTGTTATGAC
1441 AGCTCTGAGGAGAATTATTAGAACAAACATTGGGGAGTATTTAGTACAACATTCATTCATTCTTCTGGATTAGTGACTGC
1521 CAGCCAGGCTGTCGGGAGCGCCCTACTAAATCTCCTGTCTCTTCTGCTTTTACTGGGGGATCTTTAATTTGCTGTGTGCC
1601 ATGTGGAAGTATCGGGAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-424-5p :: ITPR1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HTR-8/SVneo cells
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... we found that MED1 was silenced 2-fold by miR-205. Likewise, FGFR1 and MAP2K1 were silenced 2-fold by miR-424 These include ERBB3, which was slightly inhibited by miR-205, as shown by others (72, 74, 75), and AP2M1 and DMN1, which were repressed by miR-224 ...

- Mouillet, J. F. Chu, T. Nelson, D. M. et al., 2010, FASEB J.

Article - Mouillet, J. F. Chu, T. Nelson, D. M. et al.
- FASEB J, 2010
Acting through degradation of target mRNA or inhibition of translation, microRNAs (miRNAs) regulate development, differentiation, and cellular response to diverse cues. We analyzed changes in miRNA expression in human placental trophoblasts exposed to hypoxia, which may result from hypoperfusion and placental injury. Using an miRNA microarray screen, confirmed by Northern blot analysis, we defined a set of seven miRNAs (miR-93, miR-205, miR-224, miR-335, miR-424, miR-451, and miR-491) that are differentially regulated in primary trophoblasts exposed to hypoxia. We combined in silico prediction of miRNA targets with gene expression profiling data to identify a series of potential targets for the miRNAs, which were further analyzed using luciferase reporter assays. Among experimentally confirmed targets, we found that the transcriptional coactivator MED1, which plays an important role in placental development, is a target for miR-205. Using gain- and loss-of-function assays, we confirmed that miR-205 interacts with a specific target in the 3;-UTR sequence of MED1 and silences MED1 expression in human trophoblasts exposed to hypoxia, suggesting that miR-205 plays a role in trophoblast injury.-Mouillet, J.-F., Chu, T., Nelson, D. M., Mishima, T., Sadovsky, Y. MiR-205 silences MED1 in hypoxic primary human trophoblasts.
LinkOut: [PMID: 20065103]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
48 hsa-miR-424-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000653 CCNF cyclin F 2 1
MIRT000654 CDC14A CDC14 cell division cycle 14 homolog A (S. cerevisiae) 2 1
MIRT000655 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT000656 CHEK1 CHK1 checkpoint homolog (S. pombe) 2 1
MIRT000657 KIF23 kinesin family member 23 2 1
MIRT000658 ATF6 activating transcription factor 6 2 1
MIRT000659 WEE1 WEE1 homolog (S. pombe) 3 2
MIRT000660 ANLN anillin, actin binding protein 2 1
MIRT000696 PLAG1 pleiomorphic adenoma gene 1 4 1
MIRT000936 CCNE1 cyclin E1 4 3
MIRT000937 CCND3 cyclin D3 4 1
MIRT000938 CDK6 cyclin-dependent kinase 6 4 1
MIRT000941 CCND1 cyclin D1 4 2
MIRT003225 ITPR1 inositol 1,4,5-triphosphate receptor, type 1 2 1
MIRT003226 MAP2K1 mitogen-activated protein kinase kinase 1 4 2
MIRT003227 PIAS1 protein inhibitor of activated STAT, 1 2 1
MIRT003228 FGFR1 fibroblast growth factor receptor 1 2 1
MIRT003928 NFIA nuclear factor I/A 3 2
MIRT005886 MYB v-myb myeloblastosis viral oncogene homolog (avian) 3 1
MIRT005887 SIAH1 seven in absentia homolog 1 (Drosophila) 3 1
MIRT005926 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 5 1
MIRT005927 CUL2 cullin 2 5 1
MIRT005928 SPI1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 5 1
MIRT042434 CCIN calicin 1 1
MIRT042435 TTC39A tetratricopeptide repeat domain 39A 1 1
MIRT042436 TMF1 TATA element modulatory factor 1 1 1
MIRT042437 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT042438 PNISR splicing factor, arginine/serine-rich 18 1 1
MIRT042439 IARS isoleucyl-tRNA synthetase 1 1
MIRT042440 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT042441 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT042442 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT042443 MAGED1 melanoma antigen family D, 1 1 1
MIRT042444 CNIH4 cornichon homolog 4 (Drosophila) 1 1
MIRT042445 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT042446 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT042447 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT042448 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT042449 ANKRD17 ankyrin repeat domain 17 1 1
MIRT042450 RBM4B RNA binding motif protein 4B 1 1
MIRT042451 LAMTOR4 chromosome 7 open reading frame 59 1 1
MIRT042452 TRAP1 TNF receptor-associated protein 1 1 1
MIRT042453 SCOC short coiled-coil protein 1 1
MIRT042454 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT042455 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT042456 TBPL1 TBP-like 1 1 1
MIRT042457 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT042458 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 1