Accession ID: MIRT003228 [miRNA, hsa-miR-424-5p :: FGFR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-424LinkOut: [miRBase ]
Synonyms MIR322, MIRN424, hsa-mir-424, miRNA424, MIR424
Description Homo sapiens miR-424 stem-loop
Comment This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells . The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-424-5p
Mature Sequence 11| CAGCAGCAAUUCAUGUUUUGAA |32
Evidence Experimental
Experiments Cloned
Putative hsa-miR-424-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGFR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BFGFR, CD331, CEK, FGFBR, FGFR-1, FLG, FLT-2, FLT2, HBGFR, HH2, KAL2, N-SAM, OGD, bFGF-R-1
Description fibroblast growth factor receptor 1
Transcript NM_001174063    LinkOut: [ RefSeq ]
Other Transcripts NM_001174064 , NM_001174065 , NM_001174066 , NM_001174067 , NM_015850 , NM_023105 , NM_023106 , NM_023110   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGFR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGFR1
(miRNA target sites are highlighted)
>FGFR1|NM_001174063|3'UTR
   1 CGCCGCTGACTGCCACCCACACGCCCTCCCCAGACTCCACCGTCAGCTGTAACCCTCACCCACAGCCCCTGCTGGGCCCA
  81 CCACCTGTCCGTCCCTGTCCCCTTTCCTGCTGGCAGGAGCCGGCTGCCTACCAGGGGCCTTCCTGTGTGGCCTGCCTTCA
 161 CCCCACTCAGCTCACCTCTCCCTCCACCTCCTCTCCACCTGCTGGTGAGAGGTGCAAAGAGGCAGATCTTTGCTGCCAGC
 241 CACTTCATCCCCTCCCAGATGTTGGACCAACACCCCTCCCTGCCACCAGGCACTGCCTGGAGGGCAGGGAGTGGGAGCCA
 321 ATGAACAGGCATGCAAGTGAGAGCTTCCTGAGCTTTCTCCTGTCGGTTTGGTCTGTTTTGCCTTCACCCATAAGCCCCTC
 401 GCACTCTGGTGGCAGGTGCCTTGTCCTCAGGGCTACAGCAGTAGGGAGGTCAGTGCTTCGTGCCTCGATTGAAGGTGACC
 481 TCTGCCCCAGATAGGTGGTGCCAGTGGCTTATTAATTCCGATACTAGTTTGCTTTGCTGACCAAATGCCTGGTACCAGAG
 561 GATGGTGAGGCGAAGGCCAGGTTGGGGGCAGTGTTGTGGCCCTGGGGCCCAGCCCCAAACTGGGGGCTCTGTATATAGCT
 641 ATGAAGAAAACACAAAGTGTATAAATCTGAGTATATATTTACATGTCTTTTTAAAAGGGTCGTTACCAGAGATTTACCCA
 721 TCGGGTAAGATGCTCCTGGTGGCTGGGAGGCATCAGTTGCTATATATTAAAAACAAAAAAGAAAAAAAAGGAAAATGTTT
 801 TTAAAAAGGTCATATATTTTTTGCTACTTTTGCTGTTTTATTTTTTTAAATTATGTTCTAAACCTATTTTCAGTTTAGGT
 881 CCCTCAATAAAAATTGCTGCTGCTTCATTTATCTATGGGCTGTATGAAAAGGGTGGGAATGTCCACTGGAAAGAAGGGAC
 961 ACCCACGGGCCCTGGGGCTAGGTCTGTCCCGAGGGCACCGCATGCTCCCGGCGCAGGTTCCTTGTAACCTCTTCTTCCTA
1041 GGTCCTGCACCCAGACCTCACGACGCACCTCCTGCCTCTCCGCTGCTTTTGGAAAGTCAGAAAAAGAAGATGTCTGCTTC
1121 GAGGGCAGGAACCCCATCCATGCAGTAGAGGCGCTGGGCAGAGAGTCAAGGCCCAGCAGCCATCGACCATGGATGGTTTC
1201 CTCCAAGGAAACCGGTGGGGTTGGGCTGGGGAGGGGGCACCTACCTAGGAATAGCCACGGGGTAGAGCTACAGTGATTAA
1281 GAGGAAAGCAAGGGCGCGGTTGCTCACGCCTGTAATCCCAGCACTTTGGGACACCGAGGTGGGCAGATCACTTCAGGTCA
1361 GGAGTTTGAGACCAGCCTGGCCAACTTAGTGAAACCCCATCTCTACTAAAAATGCAAAAATTATCCAGGCATGGTGGCAC
1441 ACGCCTGTAATCCCAGCTCCACAGGAGGCTGAGGCAGAATCCCTTGAAGCTGGGAGGCGGAGGTTGCAGTGAGCCGAGAT
1521 TGCGCCATTGCACTCCAGCCTGGGCAACAGAGAAAACAAAAAGGAAAACAAATGATGAAGGTCTGCAGAAACTGAAACCC
1601 AGACATGTGTCTGCCCCCTCTATGTGGGCATGGTTTTGCCAGTGCTTCTAAGTGCAGGAGAACATGTCACCTGAGGCTAG
1681 TTTTGCATTCAGGTCCCTGGCTTCGTTTCTTGTTGGTATGCCTCCCCAGATCGTCCTTCCTGTATCCATGTGACCAGACT
1761 GTATTTGTTGGGACTGTCGCAGATCTTGGCTTCTTACAGTTCTTCCTGTCCAAACTCCATCCTGTCCCTCAGGAACGGGG
1841 GGAAAATTCTCCGAATGTTTTTGGTTTTTTGGCTGCTTGGAATTTACTTCTGCCACCTGCTGGTCATCACTGTCCTCACT
1921 AAGTGGATTCTGGCTCCCCCGTACCTCATGGCTCAAACTACCACTCCTCAGTCGCTATATTAAAGCTTATATTTTGCTGG
2001 ATTACTGCTAAATACAAAAGAAAGTTCAATATGTTTTCATTTCTGTAGGGAAAATGGGATTGCTGCTTTAAATTTCTGAG
2081 CTAGGGATTTTTTGGCAGCTGCAGTGTTGGCGACTATTGTAAAATTCTCTTTGTTTCTCTCTGTAAATAGCACCTGCTAA
2161 CATTACAATTTGTATTTATGTTTAAAGAAGGCATCATTTGGTGAACAGAACTAGGAAATGAATTTTTAGCTCTTAAAAGC
2241 ATTTGCTTTGAGACCGCACAGGAGTGTCTTTCCTTGTAAAACAGTGATGATAATTTCTGCCTTGGCCCTACCTTGAAGCA
2321 ATGTTGTGTGAAGGGATGAAGAATCTAAAAGTCTTCATAAGTCCTTGGGAGAGGTGCTAGAAAAATATAAGGCACTATCA
2401 TAATTACAGTGATGTCCTTGCTGTTACTACTCAAATCACCCACAAATTTCCCCAAAGACTGCGCTAGCTGTCAAATAAAA
2481 GACAGTGAAATTGACCTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aagUUUUGUACUUAACGACGAc 5'
             ||||:: |:||||||||| 
Target 5' gggAAAATG-GGATTGCTGCTt 3'
2048 - 2068 170.00 -15.10
2
miRNA  3' aaguuUUGUACUUAACGACGAc 5'
               ||:|  |||||||||| 
Target 5' ccctcAATAAAAATTGCTGCTg 3'
881 - 902 165.00 -15.90
3
miRNA  3' aaGU-UU--UGU-ACU----UAACGACGAc 5'
            || ||  ||| |||     ||||||:| 
Target 5' atCATAATTACAGTGATGTCCTTGCTGTTa 3'
2397 - 2426 136.00 -10.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-424-5p :: FGFR1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HTR-8/SVneo cells
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... FGFR1 is a member of the fibroblast growth factor receptor family that is expressed in the placenta, but its function in this tissue remains unclear.//We found that MED1 was silenced 2-fold by miR-205. Likewise, FGFR1 and MAP2K1 were silenced 2-fold by miR-424. ...

- Mouillet, J. F. Chu, T. Nelson, D. M. et al., 2010, FASEB J.

Article - Mouillet, J. F. Chu, T. Nelson, D. M. et al.
- FASEB J, 2010
Acting through degradation of target mRNA or inhibition of translation, microRNAs (miRNAs) regulate development, differentiation, and cellular response to diverse cues. We analyzed changes in miRNA expression in human placental trophoblasts exposed to hypoxia, which may result from hypoperfusion and placental injury. Using an miRNA microarray screen, confirmed by Northern blot analysis, we defined a set of seven miRNAs (miR-93, miR-205, miR-224, miR-335, miR-424, miR-451, and miR-491) that are differentially regulated in primary trophoblasts exposed to hypoxia. We combined in silico prediction of miRNA targets with gene expression profiling data to identify a series of potential targets for the miRNAs, which were further analyzed using luciferase reporter assays. Among experimentally confirmed targets, we found that the transcriptional coactivator MED1, which plays an important role in placental development, is a target for miR-205. Using gain- and loss-of-function assays, we confirmed that miR-205 interacts with a specific target in the 3;-UTR sequence of MED1 and silences MED1 expression in human trophoblasts exposed to hypoxia, suggesting that miR-205 plays a role in trophoblast injury.-Mouillet, J.-F., Chu, T., Nelson, D. M., Mishima, T., Sadovsky, Y. MiR-205 silences MED1 in hypoxic primary human trophoblasts.
LinkOut: [PMID: 20065103]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-424-5p :: FGFR1    [ Functional MTI ]
Validation Method
Article - Kim, J. Kang, Y. Kojima, Y. Lighthouse, J. et al.
- Nat Med, 2013
Pulmonary arterial hypertension (PAH) is characterized by vascular remodeling associated with obliteration of pulmonary arterioles and formation of plexiform lesions composed of hyperproliferative endothelial and vascular smooth-muscle cells. Here we describe a microRNA (miRNA)-dependent association between apelin (APLN) and fibroblast growth factor 2 (FGF2) signaling in pulmonary artery endothelial cells (PAECs). APLN deficiency in these cells led to increased expression of FGF2 and its receptor FGFR1 as a consequence of decreased expression of miR-424 and miR-503, which directly target FGF2 and FGFR1. miR-424 and miR-503 were downregulated in PAH, exerted antiproliferative effects in PAECs and inhibited the capacity of PAEC-conditioned medium to induce the proliferation of pulmonary artery smooth-muscle cells. Reconstitution of miR-424 and miR-503 in vivo ameliorated pulmonary hypertension in experimental models. These studies identify an APLN-dependent miRNA-FGF signaling axis needed for the maintenance of pulmonary vascular homeostasis.
LinkOut: [PMID: 23263626]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-424-5p :: FGFR1    [ Functional MTI ]
Validation Method
Article - Mouillet, J. F. Donker, R. B. Mishima, T. et al.
- Biol Reprod, 2013
Placental hypoperfusion causes cellular hypoxia and is associated with fetal growth restriction and preeclampsia. In response to hypoxia, the repertoire of genes expressed in placental trophoblasts changes, which influences key cellular processes, such as differentiation and fusion. Diverse miRNAs were recently found to modulate the cellular response to hypoxia. Here we show that miR-424, which was previously shown to be upregulated by hypoxia in nontrophoblastic cell types, is uniquely downregulated in primary human trophoblasts by hypoxia or chemicals known to hinder cell differentiation. We also identify FGFR1 as a direct target of miR-424 in human trophoblasts. This effect is unique to miR-424 and is not seen with other members of this miRNA family that are expressed in trophoblasts, such as miR-15 and miR-16. Our findings establish a unique role for miR-424 during differentiation of human trophoblasts.
LinkOut: [PMID: 23803556]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
441 hsa-miR-424-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000653 CCNF cyclin F 2 1
MIRT000654 CDC14A CDC14 cell division cycle 14 homolog A (S. cerevisiae) 2 1
MIRT000655 CDC25A cell division cycle 25 homolog A (S. pombe) 3 2
MIRT000656 CHEK1 checkpoint kinase 1 4 3
MIRT000657 KIF23 kinesin family member 23 3 4
MIRT000658 ATF6 activating transcription factor 6 2 1
MIRT000659 WEE1 WEE1 homolog (S. pombe) 5 5
MIRT000660 ANLN anillin, actin binding protein 2 1
MIRT000696 PLAG1 pleiomorphic adenoma gene 1 5 5
MIRT000936 CCNE1 cyclin E1 5 5
MIRT000937 CCND3 cyclin D3 4 1
MIRT000938 CDK6 cyclin-dependent kinase 6 5 2
MIRT000941 CCND1 cyclin D1 5 3
MIRT003225 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 2 1
MIRT003226 MAP2K1 mitogen-activated protein kinase kinase 1 4 2
MIRT003227 PIAS1 protein inhibitor of activated STAT, 1 2 1
MIRT003228 FGFR1 fibroblast growth factor receptor 1 5 3
MIRT003928 NFIA nuclear factor I/A 3 2
MIRT005886 MYB v-myb myeloblastosis viral oncogene homolog (avian) 3 2
MIRT005887 SIAH1 siah E3 ubiquitin protein ligase 1 3 1
MIRT005926 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 5 1
MIRT005927 CUL2 cullin 2 5 1
MIRT005928 SPI1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 5 1
MIRT042434 CCIN calicin 1 1
MIRT042435 TTC39A tetratricopeptide repeat domain 39A 1 1
MIRT042436 TMF1 TATA element modulatory factor 1 1 1
MIRT042437 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT042438 PNISR PNN-interacting serine/arginine-rich protein 1 2
MIRT042439 IARS isoleucyl-tRNA synthetase 1 1
MIRT042440 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT042441 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 2
MIRT042442 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT042443 MAGED1 melanoma antigen family D, 1 1 1
MIRT042444 CNIH4 cornichon homolog 4 (Drosophila) 1 1
MIRT042445 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT042446 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT042447 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT042448 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT042449 ANKRD17 ankyrin repeat domain 17 1 1
MIRT042450 RBM4B RNA binding motif protein 4B 1 1
MIRT042451 LAMTOR4 late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 1 1
MIRT042452 TRAP1 TNF receptor-associated protein 1 1 1
MIRT042453 SCOC short coiled-coil protein 1 1
MIRT042454 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT042455 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT042456 TBPL1 TBP-like 1 1 2
MIRT042457 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT042458 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 1
MIRT053106 FASN fatty acid synthase 3 3
MIRT053149 SOCS6 suppressor of cytokine signaling 6 2 1
MIRT053379 CDX2 caudal type homeobox 2 3 1
MIRT055427 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 5
MIRT055818 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT057518 CEP55 centrosomal protein 55kDa 1 4
MIRT057737 ZDHHC16 zinc finger, DHHC-type containing 16 1 1
MIRT061008 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061250 AMOTL1 angiomotin like 1 1 6
MIRT064689 CCND2 cyclin D2 1 2
MIRT065719 TARBP2 TAR (HIV-1) RNA binding protein 2 1 2
MIRT066297 MTFR1L family with sequence similarity 54, member B 1 1
MIRT066316 USP15 ubiquitin specific peptidase 15 1 1
MIRT071212 FCF1 FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) 1 1
MIRT072826 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 2
MIRT074534 PAGR1 PAXIP1 associated glutamate-rich protein 1 1 2
MIRT075256 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 2
MIRT075278 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 4
MIRT075897 C16ORF72 chromosome 16 open reading frame 72 1 3
MIRT076796 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT078287 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT079659 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 6
MIRT080016 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 2
MIRT082989 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT083270 ZCCHC3 zinc finger, CCHC domain containing 3 1 3
MIRT084466 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT086013 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087428 ZNRF3 zinc and ring finger 3 1 1
MIRT087559 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT089112 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089212 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 1
MIRT091674 RARB retinoic acid receptor, beta 1 3
MIRT093688 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096239 CANX calnexin 1 1
MIRT100211 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT100369 HSPA1B heat shock 70kDa protein 1B 1 3
MIRT100572 PIM1 pim-1 oncogene 1 1
MIRT100741 VEGFA vascular endothelial growth factor A 1 6
MIRT100900 CD2AP CD2-associated protein 1 1
MIRT102441 CALU calumenin 1 1
MIRT102636 UBN2 ubinuclein 2 1 5
MIRT102974 EN2 engrailed homeobox 2 1 3
MIRT103097 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 2
MIRT103859 FOXK1 forkhead box K1 1 1
MIRT104020 USP42 ubiquitin specific peptidase 42 1 3
MIRT104236 DMTF1 cyclin D binding myb-like transcription factor 1 1 1
MIRT106300 ZFHX4 zinc finger homeobox 4 1 3
MIRT106737 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT107222 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT107689 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT109245 ZNF275 zinc finger protein 275 1 1
MIRT110057 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 3
MIRT112976 LUZP1 leucine zipper protein 1 1 3
MIRT114929 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT117660 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120684 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT127740 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT133776 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT140152 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT142247 DCTN5 dynactin 5 (p25) 1 4
MIRT152287 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT154054 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT156468 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT158533 TNRC6B trinucleotide repeat containing 6B 1 2
MIRT165183 GRAMD3 GRAM domain containing 3 1 1
MIRT165904 CREBRF CREB3 regulatory factor 1 1
MIRT175237 PSAT1 phosphoserine aminotransferase 1 1 3
MIRT179014 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT180914 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186375 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT189764 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189965 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT190188 GPR180 G protein-coupled receptor 180 1 3
MIRT191460 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT191629 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 3
MIRT194242 FAM103A1 family with sequence similarity 103, member A1 1 3
MIRT194909 RBBP6 retinoblastoma binding protein 6 1 4
MIRT196457 TAOK1 TAO kinase 1 1 1
MIRT201460 SNRPB2 small nuclear ribonucleoprotein polypeptide B 1 4
MIRT204597 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204628 MOB4 MOB family member 4, phocein 1 4
MIRT204744 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206023 NUP50 nucleoporin 50kDa 1 3
MIRT211201 FGF2 fibroblast growth factor 2 (basic) 4 3
MIRT211317 HSPA4L heat shock 70kDa protein 4-like 1 2
MIRT212611 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT223695 FZD6 frizzled family receptor 6 1 3
MIRT224969 BAG4 BCL2-associated athanogene 4 1 1
MIRT229350 ZNF449 zinc finger protein 449 1 1
MIRT229864 YIPF6 Yip1 domain family, member 6 1 1
MIRT234346 MSL1 male-specific lethal 1 homolog (Drosophila) 1 4
MIRT247241 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT247371 GABARAPL1 GABA(A) receptor-associated protein like 1 1 3
MIRT248769 ATXN7L3B ataxin 7-like 3B 1 2
MIRT249453 ZNF691 zinc finger protein 691 1 2
MIRT251497 DYNLL2 dynein, light chain, LC8-type 2 1 2
MIRT255339 SRPRB signal recognition particle receptor, B subunit 1 2
MIRT256311 CDC42SE2 CDC42 small effector 2 1 1
MIRT258414 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 1
MIRT265059 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT267532 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270556 SETD1B SET domain containing 1B 1 1
MIRT273669 HOXC8 homeobox C8 1 1
MIRT274745 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT277509 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 2
MIRT282538 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT289635 CBX2 chromobox homolog 2 1 1
MIRT294287 ZFP28 zinc finger protein 28 homolog (mouse) 1 1
MIRT295815 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297782 GABPA GA binding protein transcription factor, alpha subunit 60kDa 1 2
MIRT300110 STRADB STE20-related kinase adaptor beta 1 1
MIRT300998 MTMR3 myotubularin related protein 3 1 1
MIRT302619 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 3
MIRT302829 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307145 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 2
MIRT313679 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT314055 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 4
MIRT317725 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 3
MIRT319335 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT320631 ZNRF2 zinc and ring finger 2 1 1
MIRT326306 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT327967 CHIC1 cysteine-rich hydrophobic domain 1 1 3
MIRT367269 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT438750 PTCH1 patched 1 1 1
MIRT443811 SIDT2 SID1 transmembrane family, member 2 1 1
MIRT446504 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447774 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448443 TLL1 tolloid-like 1 1 1
MIRT449186 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT451835 ALDH3B1 aldehyde dehydrogenase 3 family, member B1 1 1
MIRT453284 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453750 CSNK1E casein kinase 1, epsilon 1 1
MIRT454966 TPM2 tropomyosin 2 (beta) 1 1
MIRT456863 ZNF460 zinc finger protein 460 1 5
MIRT460220 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460434 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461560 ACTR3B ARP3 actin-related protein 3 homolog B (yeast) 1 1
MIRT463168 ZNF367 zinc finger protein 367 1 5
MIRT464666 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 4
MIRT464752 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT465167 TSC22D2 TSC22 domain family, member 2 1 1
MIRT465566 TOB2 transducer of ERBB2, 2 1 1
MIRT465930 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466009 TMEM189 transmembrane protein 189 1 4
MIRT466294 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466433 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 4
MIRT466920 STK38 serine/threonine kinase 38 1 5
MIRT466998 SSRP1 structure specific recognition protein 1 1 2
MIRT468055 SIK1 salt-inducible kinase 1 1 1
MIRT468147 SH3BP4 SH3-domain binding protein 4 1 1
MIRT468673 SEC24A SEC24 family, member A (S. cerevisiae) 1 2
MIRT469086 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT469411 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 3
MIRT471035 PISD phosphatidylserine decarboxylase 1 5
MIRT471492 PDE4D phosphodiesterase 4D, cAMP-specific 1 2
MIRT471952 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472269 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT472661 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474314 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT474829 KIAA0226 KIAA0226 1 1
MIRT475065 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475119 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT475535 HOXA3 homeobox A3 1 4
MIRT475716 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT475841 HDGF hepatoma-derived growth factor 1 2
MIRT476256 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 3
MIRT476273 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 3
MIRT476696 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT477561 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477845 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478908 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 3
MIRT479989 CARD10 caspase recruitment domain family, member 10 1 1
MIRT481185 AVL9 AVL9 homolog (S. cerevisiase) 1 3
MIRT482117 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT482373 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT482553 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 5
MIRT482578 ABHD2 abhydrolase domain containing 2 1 1
MIRT484774 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1 2
MIRT485216 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 4
MIRT487390 C10orf54 chromosome 10 open reading frame 54 1 1
MIRT492711 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494353 CASKIN1 CASK interacting protein 1 1 1
MIRT495143 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT496015 CD180 CD180 molecule 1 1
MIRT497772 KIAA0895 KIAA0895 1 1
MIRT498980 ORC4 origin recognition complex, subunit 4 1 4
MIRT499452 ODF2L outer dense fiber of sperm tails 2-like 1 4
MIRT499616 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 4
MIRT500093 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500324 ZNF622 zinc finger protein 622 1 4
MIRT500422 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT500576 USP53 ubiquitin specific peptidase 53 1 1
MIRT500864 SYPL1 synaptophysin-like 1 1 4
MIRT500935 SRPR signal recognition particle receptor (docking protein) 1 3
MIRT500949 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 4
MIRT501088 SMAD7 SMAD family member 7 1 4
MIRT501502 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT502036 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT502148 KIF5B kinesin family member 5B 1 4
MIRT502498 FAM122B family with sequence similarity 122B 1 4
MIRT502571 E2F7 E2F transcription factor 7 1 5
MIRT502646 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 4
MIRT502919 CDCA4 cell division cycle associated 4 1 4
MIRT502948 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 4
MIRT503143 ATG9A autophagy related 9A 1 3
MIRT504334 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504536 ZNF620 zinc finger protein 620 1 3
MIRT504852 HAUS3 HAUS augmin-like complex, subunit 3 1 3
MIRT505114 YTHDC1 YTH domain containing 1 1 3
MIRT505346 TMEM245 transmembrane protein 245 1 3
MIRT505396 TMEM100 transmembrane protein 100 1 1
MIRT505502 SRSF1 serine/arginine-rich splicing factor 1 1 3
MIRT505546 SNX16 sorting nexin 16 1 3
MIRT505690 SESTD1 SEC14 and spectrin domains 1 1 3
MIRT505908 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505926 RCAN3 RCAN family member 3 1 2
MIRT506108 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 3
MIRT506139 PLRG1 pleiotropic regulator 1 1 2
MIRT506192 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 3
MIRT506486 MYO5A myosin VA (heavy chain 12, myoxin) 1 3
MIRT506999 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 3
MIRT507819 CDK1 cyclin-dependent kinase 1 1 3
MIRT507850 CCNE2 cyclin E2 1 3
MIRT507882 CBX6 chromobox homolog 6 1 1
MIRT508036 AXIN2 axin 2 1 3
MIRT508641 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 2
MIRT509364 DMPK dystrophia myotonica-protein kinase 1 5
MIRT509690 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510043 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 2
MIRT511845 GPATCH8 G patch domain containing 8 1 2
MIRT512285 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 3
MIRT512642 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 2
MIRT513856 JARID2 jumonji, AT rich interactive domain 2 1 4
MIRT514022 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 2
MIRT514043 ATG14 autophagy related 14 1 1
MIRT518091 TRIM35 tripartite motif containing 35 1 1
MIRT518530 FLCN folliculin 1 3
MIRT518994 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521056 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 2
MIRT521203 SBNO1 strawberry notch homolog 1 (Drosophila) 1 3
MIRT521814 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522100 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT522775 LAMP2 lysosomal-associated membrane protein 2 1 3
MIRT537817 EFNB2 ephrin-B2 1 2
MIRT539899 RPL14 ribosomal protein L14 1 2
MIRT540843 GNAT1 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 1 2
MIRT541216 HOXA10 homeobox A10 1 1
MIRT541434 CBX4 chromobox homolog 4 1 1
MIRT542808 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT542836 PDCD1 programmed cell death 1 1 3
MIRT543059 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT543079 APP amyloid beta (A4) precursor protein 1 1
MIRT543306 ZNF585B zinc finger protein 585B 1 1
MIRT543408 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543525 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT543797 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 2
MIRT543835 GSG1 germ cell associated 1 1 1
MIRT544571 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT544589 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544912 CLSPN claspin 1 1
MIRT544965 UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4 1 1
MIRT545186 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545347 CCDC83 coiled-coil domain containing 83 1 1
MIRT545682 DECR1 2,4-dienoyl CoA reductase 1, mitochondrial 1 1
MIRT545959 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT546114 USP48 ubiquitin specific peptidase 48 1 2
MIRT546610 SALL1 sal-like 1 (Drosophila) 1 2
MIRT546623 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT546639 RTN4 reticulon 4 1 1
MIRT547132 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547234 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 2
MIRT547306 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT547411 MKX mohawk homeobox 1 1
MIRT547462 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT547549 LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 1 2
MIRT547663 KPNA3 karyopherin alpha 3 (importin alpha 4) 1 1
MIRT547700 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 2
MIRT547970 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 2
MIRT547996 HCFC2 host cell factor C2 1 2
MIRT548015 GRB2 growth factor receptor-bound protein 2 1 2
MIRT548223 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT548273 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548729 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT548806 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 2
MIRT548949 CDK17 cyclin-dependent kinase 17 1 1
MIRT549074 CACUL1 CDK2-associated, cullin domain 1 1 1
MIRT549121 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549276 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT549390 AMOT angiomotin 1 1
MIRT550402 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 2
MIRT550466 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550615 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT550823 FAM229B chromosome 6 open reading frame 225 1 1
MIRT551379 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT551617 ZNF267 zinc finger protein 267 1 1
MIRT551737 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT552035 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT552344 ZNF704 zinc finger protein 704 1 1
MIRT552749 YRDC yrdC domain containing (E. coli) 1 1
MIRT553439 TPM3 tropomyosin 3 1 1
MIRT553561 TMEM161B transmembrane protein 161B 1 1
MIRT553618 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553772 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 2
MIRT553809 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554700 RNF149 ring finger protein 149 1 1
MIRT554962 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555032 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555142 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT555225 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 2
MIRT555275 PRDM4 PR domain containing 4 1 1
MIRT555432 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT556387 LURAP1L leucine rich adaptor protein 1-like 1 1
MIRT556855 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557281 HIST2H2BE histone cluster 2, H2be 1 1
MIRT557480 GPR27 G protein-coupled receptor 27 1 2
MIRT558037 EXT1 exostosin 1 1 1
MIRT558507 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 2
MIRT558589 CREBL2 cAMP responsive element binding protein-like 2 1 2
MIRT558662 CNKSR3 CNKSR family member 3 1 1
MIRT559011 CA8 carbonic anhydrase VIII 1 1
MIRT559158 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT559531 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT560852 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT561149 KRT33B keratin 33B 1 1
MIRT561400 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT561874 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT562027 LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) 1 1
MIRT562201 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562877 KIAA1456 KIAA1456 1 1
MIRT563086 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 1
MIRT563503 DLGAP3 discs, large (Drosophila) homolog-associated protein 3 1 1
MIRT563701 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563845 SMDT1 chromosome 22 open reading frame 32 1 1
MIRT563896 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564332 CCNT1 cyclin T1 1 1
MIRT564478 ZNF391 zinc finger protein 391 1 1
MIRT564552 CCDC80 coiled-coil domain containing 80 1 1
MIRT564836 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564950 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 1
MIRT564989 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565044 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT565401 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT566120 RASEF RAS and EF-hand domain containing 1 1
MIRT566650 NCKAP1 NCK-associated protein 1 1 1
MIRT566831 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567021 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT567446 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT567477 FZD9 frizzled family receptor 9 1 1
MIRT568021 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT568142 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568474 ARMC12 armadillo repeat containing 12 1 1
MIRT568574 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568625 ACVR2A activin A receptor, type IIA 1 1
MIRT570466 TLK1 tousled-like kinase 1 1 1
MIRT571119 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT571283 TTLL5 tubulin tyrosine ligase-like family, member 5 1 1
MIRT571428 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT571660 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571828 PHF19 PHD finger protein 19 1 1
MIRT571928 LSM11 LSM11, U7 small nuclear RNA associated 1 1
MIRT574057 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT574202 CLEC2D C-type lectin domain family 2, member D 1 1
MIRT574539 PDIA6 protein disulfide isomerase family A, member 6 1 2
MIRT574594 N4BP1 NEDD4 binding protein 1 1 1
MIRT575882 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575924 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576099 Pdcd1 programmed cell death 1 1 1
MIRT576591 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614698 TRAK1 trafficking protein, kinesin binding 1 1 1
MIRT616467 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618896 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621498 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 2
MIRT640538 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645510 BSPRY B-box and SPRY domain containing 1 1
MIRT646595 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648784 KLHL40 kelch repeat and BTB (POZ) domain containing 5 1 1
MIRT655812 NOTCH2 notch 2 1 1
MIRT658793 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT659256 CUL3 cullin 3 1 1
MIRT680982 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682285 RS1 retinoschisin 1 1 1
MIRT682514 GLP2R glucagon-like peptide 2 receptor 1 1
MIRT691709 FLOT2 flotillin 2 1 1
MIRT693930 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701506 NEGR1 neuronal growth regulator 1 1 1
MIRT702092 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702877 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713419 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT714438 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716432 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717461 ADORA3 adenosine A3 receptor 1 1
MIRT720149 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725132 SYNRG synergin, gamma 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*