Accession ID: MIRT003271 [miRNA, hsa-miR-204-5p :: TGFBR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-204LinkOut: [miRBase ]
Description Homo sapiens miR-204 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-204-5p
Mature Sequence 33| UUCCCUUUGUCAUCCUAUGCCU |54
Evidence Experimental
Experiments Cloned
Putative hsa-miR-204-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TGFBR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAT5, ACVRLK4, ALK-5, ALK5, LDS1A, LDS2A, SKR4, TGFR-1
Description transforming growth factor, beta receptor 1
Transcript NM_0011309    LinkOut: [ RefSeq ]
Other Transcripts NM_0046   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TGFBR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TGFBR1
(miRNA target sites are highlighted)
>TGFBR1|NM_0011309|3'UTR
   1 TAATTCTACAGCTTTGCCTGAACTCTCCTTTTTTCTTCAGATCTGCTCCTGGGTTTTAATTTGGGAGGTCAATTGTTCTA
  81 CCTCACTGAGAGGGAACAGAAGGATATTGCTTCCTTTTGCAGCAGTGTAATAAAGTCAATTAAAAACTTCCCAGGATTTC
 161 TTTGGACCCAGGAAACAGCCATGTGGGTCCTTTCTGTGCACTATGAACGCTTCTTTCCCAGGACAGAAAATGTGTAGTCT
 241 ACCTTTATTTTTTATTAACAAAACTTGTTTTTTAAAAAGATGATTGCTGGTCTTAACTTTAGGTAACTCTGCTGTGCTGG
 321 AGATCATCTTTAAGGGCAAAGGAGTTGGATTGCTGAATTACAATGAAACATGTCTTATTACTAAAGAAAGTGATTTACTC
 401 CTGGTTAGTACATTCTCAGAGGATTCTGAACCACTAGAGTTTCCTTGATTCAGACTTTGAATGTACTGTTCTATAGTTTT
 481 TCAGGATCTTAAAACTAACACTTATAAAACTCTTATCTTGAGTCTAAAAATGACCTCATATAGTAGTGAGGAACATAATT
 561 CATGCAATTGTATTTTGTATACTATTATTGTTCTTTCACTTATTCAGAACATTACATGCCTTCAAAATGGGATTGTACTA
 641 TACCAGTAAGTGCCACTTCTGTGTCTTTCTAATGGAAATGAGTAGAATTGCTGAAAGTCTCTATGTTAAAACCTATAGTG
 721 TTTGAATTCAAAAAGCTTATTTATCTGGGTAACCCAAACTTTTTCTGTTTTGTTTTTGGAAGGGTTTTTGTGGTATGTCA
 801 TTTGGTATTCTATTCTGAAAATGCCTTTCTCCTACCAAAATGTGCTTAAGCCACTAAAGAAATGAAGTGGCATTAATTAG
 881 TAAATTATTAGCATGGTCATGTTTGAATATTCTCACATCAAGCTTTTGCATTTTAATTGTGTTGTCTAAGTATACTTTTA
 961 AAAAATCAAGTGGCACTCTAGATGCTTATAGTACTTTAATATTTGTAGCATACAGACTAATTTTTCTAAAAGGGAAAGTC
1041 TGTCTAGCTGCTTGTGAAAAGTTATGTGGTATTCTGTAAGCCATTTTTTTCTTTATCTGTTCAAAGACTTATTTTTTAAG
1121 ACATGAATTACATTTAAAATTAGAATATGGTTAATATTAAATAATAGGCCTTTTTCTAGGAAGGCGAAGGTAGTTAATAA
1201 TTTGAATAGATAACAGATGTGCAAGAAAGTCACATTTGTTATGTATGTAGGAGTAAACGTTCGGTGGATCCTCTGTCTTT
1281 GTAACTGAGGTTAGAGCTAGTGTGGTTTTGAGGTCTCACTACACTTTGAGGAAGGCAGCTTTTAATTCAGTGTTTCCTTA
1361 TGTGTGCGTACATTGCAACTGCTTACATGTAATTTATGTAATGCATTCAGTGCACCCTTGTTACTTGGGAGAGGTGGTAG
1441 CTAAAGAACATTCTGAGTATAGGTTTTTCTCCATTTACAGATGTCTTTGGTCAAATATTGAAAGCAAACTTGTCATGGTC
1521 TTCTTACATTAAGTTGAAACTAGCTTATAATAACTGGTTTTTACTTCCAATGCTATGAAGTCTCTGCAGGGCTTTTACAG
1601 TTTTCGAAGTCCTTTTATCACTGTGATCTTATTCTGAGGGGAGAAAAAACTATCATAGCTCTGAGGCAAGACTTCGACTT
1681 TATAGTGCTATCAGTTCCCCGATACAGGGTCAGAGTAACCCATACAGTATTTTGGTCAGGAAGAGAAAGTGGCCATTTAC
1761 ACTGAATGAGTTGCATTCTGATAATGTCTTATCTCTTATACGTAGAATAAATTTGAAAGACTATTTGATCTTAAAACCAA
1841 AGTAATTTTAGAATGAGTGACATATTACATAGGAATTTAGTGTCAATTTCATGTGTTTAAAAACATCATGGGAAAAATGC
1921 TTAGAGGTTACTATTTTGACTACAAAGTTGAGTTTTTTTCTGTAGTTACCATAATTTCATTGAAGCAAATGAATGAGTTT
2001 GAGAGGTTTGTTTTTATAGTTGTGTTGTATTACTTGTTTAATAATAATCTCTAATTCTGTGATCAGGTACTTTTTTTGTG
2081 GGGGTTTTTTTTTTGTTTTTTTTTTTTTGTTGTTGTTTTTGGGCCATTTCTAAGCCTACCAGATCTGCTTTATGAAATCC
2161 AGGGGACCAATGCATTTTATCACTAAAACTATTTTTATATAATTTTAAGAATATACCAAAAGTTGTCTGATTTAAAGTTG
2241 TAATACATGATTTCTCACTTTCATGTAAGGTTATCCACTTTTGCTGAAGATATTTTTTATTGAATCAAAGATTGAGTTAC
2321 AATTATACTTTTCTTACCTAAGTGGATAAAATGTACTTTTGATGAATCAGGGAATTTTTTTAAAGTTGGAGTTTAGTTCT
2401 AAATTGACTTTACGTATTACTGCAGTTAATTCCTTTTTTGGCTAGGGATGGTTTGATAAACCACAATTGGCTGATATTGA
2481 AAATGAAAGAAACTTAAAAGGTGGGATGGATCATGATTACTGTCGATAACTGCAGATAAATTTGATTAGAGTAATAATTT
2561 TGTCATTTAAAAACACAGTTGTTTATACTGCCCATCCTAGGATGCTCACCTTCCAAGATTCAACGTGGCTAAAACATCTT
2641 CTGGTAAATTGTGCGTCCATATTCATTTTGTCAGTAGCCAGGAGAAATGGGGATGGGGGAAATACGACTTAGTGAGGCAT
2721 AGACATCCCTGGTCCATCCTTTCTGTCTCCAGCTGTTTCTTGGAACCTGCTCTCCTGCTTGCTGGTCCCTGACGCAGAGA
2801 CCGTTGCCTCCCCCACAGCCGTTTGACTGAAGGCTGCTCTGGAGACCTAGAGTAAAACGGCTGATGGAAGTTGTGGGACC
2881 CACTTCCATTTCCTTCAGTCATTAGAGGTGGAAGGGAGGGGTCTCCAAGTTTGGAGATTGAGCAGATGAGGCTTGGGATG
2961 CCCCTGCTTTGACTTCAGCCATGGATGAGGAGTGGGATGGCAGCAAGGTGGCTCCTGTGGCAGTGGAGTTGTGCCAGAAA
3041 CAGTGGCCAGTTGTATCGCCTATAAGACAGGGTAAGGTCTGAAGAGCTGAGCCTGTAATTCTGCTGTAATAATGATAGTG
3121 CTCAAGAAGTGCCTTGAGTTGGTGTACAGTGCCATGGCCATCAAGAATCCCAGATTTCAGGTTTTATTACAAAATGTAAG
3201 TGGTCACTTGGCGATTTTGTAGTACATGCATGAGTTACCTTTTTTCTCTATGTCTGAGAACTGTCAGATTAAAACAAGAT
3281 GGCAAAGAGATCGTTAGAGTGCACAACAAAATCACTATCCCATTAGACACATCATCAAAAGCTTATTTTTATTCTTGCAC
3361 TGGAAGAATCGTAAGTCAACTGTTTCTTGACCATGGCAGTGTTCTGGCTCCAAATGGTAGTGATTCCAAATAATGGTTCT
3441 GTTAACACTTTGGCAGAAAATGCCAGCTCAGATATTTTGAGATACTAAGGATTATCTTTGGACATGTACTGCAGCTTCTT
3521 GTCTCTGTTTTGGATTACTGGAATACCCATGGGCCCTCTCAAGAGTGCTGGACTTCTAGGACATTAAGATGATTGTCAGT
3601 ACATTAAACTTTTCAATCCCATTATGCAATCTTGTTTGTAAATGTAAACTTCTAAAAATATGGTTAATAACATTCAACCT
3681 GTTTATTACAACTTAAAAGGAACTTCAGTGAATTTGTTTTTATTTTTTAACAAGATTTGTGAACTGAATATCATGAACCA
3761 TGTTTTGATACCCCTTTTTCACGTTGTGCCAACGGAATAGGGTGTTTGATATTTCTTCATATGTTAAGGAGATGCTTCAA
3841 AATGTCAATTGCTTTAAACTTAAATTACCTCTCAAGAGACCAAGGTACATTTACCTCATTGTGTATATAATGTTTAATAT
3921 TTGTCAGAGCATTCTCCAGGTTTGCAGTTTTATTTCTATAAAGTATGGGTATTATGTTGCTCAGTTACTCAAATGGTACT
4001 GTATTGTTTATATTTGTACCCCAAATAACATCGTCTGTACTTTCTGTTTTCTGTATTGTATTTGTGCAGGATTCTTTAGG
4081 CTTTATCAGTGTAATCTCTGCCTTTTAAGATATGTACAGAAAATGTCCATATAAATTTCCATTGAAGTCGAATGATACTG
4161 AGAAGCCTGTAAAGAGGAGAAAAAAACATAAGCTGTGTTTCCCCATAAGTTTTTTTAAATTGTATATTGTATTTGTAGTA
4241 ATATTCCAAAAGAATGTAAATAGGAAATAGAAGAGTGATGCTTATGTTAAGTCCTAACACTACAGTAGAAGAATGGAAGC
4321 AGTGCAAATAAATTACATTTTTCCCAAGTGCCAGTGGCATATTTTAAAATAAAGTGTATACGTTGGAATGAGTCATGCCA
4401 TATGTAGTTGCTGTAGATGGCAACTAGAACCTTTGAGTTACAAGAGTCTTTAGAAGTTTTCTAACCCTGCCTAGTGCAAG
4481 TTACAATATTATAGCGTGTTCGGGGAGTGCCCTCCTGTCTGCAGGTGTGTCTCTGTGCCTGGGGGCTTTTCTCCACATGC
4561 TTAGGGGTGTGGGTCTTCCATTGGGGCATGATGGACCTGTCTACAGGTGATCTCTGTTGCCTTTGGGTCAGCACATTTGT
4641 TAGTCTCCTGGGGGTGAAAACTTGGCTTACAAGAGAACTGGAAAAATGATGAGATGTGGTCCCCAAACCCTTGATTGACT
4721 CTGGGGAGGGGCTTTGTGAATAGGATTGCTCTCACATTAAAGATAGTTACTTCAATTTGAAGGCTGGATTTAGGGATTTT
4801 TTTTTTTCCTTATAACAAAGACATCACCAGGATATGAAGCTTTTGTTGAAAGTTGGAAAAAAAGTGAAATTAAAGACATT
4881 CCCAGACAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucCGUAU-CCU-ACUG-------UUUCCCUu 5'
            |||||  || | |:       ||||||| 
Target 5' taGCATACAGACTAATTTTTCTAAAAGGGAa 3'
1006 - 1036 144.00 -12.00
2
miRNA  3' uccGUAUCCUACUGUUUCCCUu 5'
             |||  || |  :|||||| 
Target 5' agtCATTAGAGGTGGAAGGGAg 3'
2897 - 2918 139.00 -15.50
3
miRNA  3' uccgUAUCCUACUGUUUCCCUu 5'
              | | ||||:||||| || 
Target 5' taaaACAAGATGGCAAAGAGAt 3'
3270 - 3291 138.00 -13.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-204-5p :: TGFBR1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... The native seed binding sequence was changed by either 3 (M3) or 7 (M7) nucleotides as indicated in Fig. 10C. The data summarized in Fig. 10D show that there is no signii??cant difference (n 3; P0.77) in luciferase activity between the control (empty vector) and the TGF- R2 mutant construct (M7). Likewise, there is no signii??cant difference (n 3; P0.8) in luciferase activity between the control (empty vector) and the SNAIL2 mutant construct (SNAIL2 M3). Taken together, these data show that TGF- R2 and SNAIL2 are direct targets of miR-204 ...

- Wang, F. E. Zhang, C. Maminishkis, A. Dong, et al., 2010, FASEB J.

Article - Wang, F. E. Zhang, C. Maminishkis, A. Dong, et al.
- FASEB J, 2010
MicroRNA (miRNA) expression in fetal human retinal pigment epithelium (hfRPE), retina, and choroid were pairwise compared to determine those miRNAs that are enriched by 10-fold or more in each tissue compared with both of its neighbors. miRs-184, 187, 200a/200b, 204/211, and 221/222 are enriched in hfRPE by 10- to 754-fold compared with neuroretina or choroid (P<0.05). Five of these miRNAs are enriched in RPE compared with 20 tissues throughout the body and are 10- to 20,000-fold more highly expressed (P<0.005). miR-204 and 211 are the most highly expressed in the RPE. In addition, expression of miR-204/211 is significantly lower in the NCI60 tumor cell line panel compared with that in 13 normal tissues, suggesting the progressive disruption of epithelial barriers and increased proliferation. We demonstrated that TGF-beta receptor 2 (TGF-betaR2) and SNAIL2 are direct targets of miR-204 and that a reduction in miR-204 expression leads to reduced expression of claudins 10, 16, and 19 (message/protein) consistent with our observation that anti-miR-204/211 decreased transepithelial resistance by 80% and reduced cell membrane voltage and conductance. The anti-miR-204-induced decrease in Kir7.1 protein levels suggests a signaling pathway that connects TGF-betaR2 and maintenance of potassium homeostasis. Overall, these data indicate a critical role for miR-204/211 in maintaining epithelial barrier function and cell physiology.-Wang, F. E., Zhang, C., Maminishkis, A., Dong, L., Zhi, C., Li, R., Zhao, J., Majerciak, V., Gaur, A. B., Chen, S., Miller, S. S. MicroRNA-204/211 alters epithelial physiology.
LinkOut: [PMID: 20056717]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
89 hsa-miR-204-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000189 MEIS1 Meis homeobox 1 4 2
MIRT000190 HOXA10 homeobox A10 2 2
MIRT000191 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT000192 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT003271 TGFBR1 transforming growth factor, beta receptor 1 2 1
MIRT003272 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 3 2
MIRT003273 SNAI2 snail homolog 2 (Drosophila) 2 1
MIRT003546 MEIS2 Meis homeobox 2 3 1
MIRT004651 SNAI1 snail homolog 1 (Drosophila) 2 1
MIRT005337 SPDEF SAM pointed domain containing ets transcription factor 3 1
MIRT005524 THRB thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian) 4 1
MIRT005784 CDX2 caudal type homeobox 2 1 1
MIRT005814 AKAP1 A kinase (PRKA) anchor protein 1 1 1
MIRT005815 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT005816 AP1S2 adaptor-related protein complex 1, sigma 2 subunit 3 1
MIRT005817 ARHGAP29 Rho GTPase activating protein 29 1 1
MIRT005818 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 2 2
MIRT005819 BCL2L2 BCL2-like 2 4 1
MIRT005820 BIRC2 baculoviral IAP repeat-containing 2 4 1
MIRT005821 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT005822 COL5A3 collagen, type V, alpha 3 1 1
MIRT005823 CXCL3 chemokine (C-X-C motif) ligand 3 1 1
MIRT005824 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 3 1
MIRT005825 EZR ezrin 4 2
MIRT005826 FARP1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) 1 1
MIRT005827 FZD1 frizzled homolog 1 (Drosophila) 3 1
MIRT005828 HAS2 hyaluronan synthase 2 1 1
MIRT005829 IL11 interleukin 11 2 2
MIRT005830 IL1B interleukin 1, beta 1 1
MIRT005831 IL1RAP interleukin 1 receptor accessory protein 1 1
MIRT005832 IL8 interleukin 8 1 1
MIRT005833 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT005834 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT005835 M6PR mannose-6-phosphate receptor (cation dependent) 4 1
MIRT005836 MAPRE2 microtubule-associated protein, RP/EB family, member 2 1 1
MIRT005837 MYOC myocilin, trabecular meshwork inducible glucocorticoid response 1 1
MIRT005838 PLAT plasminogen activator, tissue 1 1
MIRT005839 PLAUR plasminogen activator, urokinase receptor 1 1
MIRT005840 RAB22A RAB22A, member RAS oncogene family 4 2
MIRT005841 RAB40B RAB40B, member RAS oncogene family 3 1
MIRT005842 SERINC3 serine incorporator 3 3 1
MIRT005843 SERP1 stress-associated endoplasmic reticulum protein 1 4 1
MIRT005844 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT005845 TCF12 transcription factor 12 4 2
MIRT005846 TCF4 transcription factor 4 3 1
MIRT006344 FOXC1 forkhead box C1 2 1
MIRT006449 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 2 1
MIRT006460 CREB5 cAMP responsive element binding protein 5 3 1
MIRT006461 ELOVL6 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 3 1
MIRT006895 RUNX2 runt-related transcription factor 2 3 1
MIRT007100 SOX4 SRY (sex determining region Y)-box 4 4 2
MIRT007101 EFNB2 ephrin-B2 3 1
MIRT007116 ALPL alkaline phosphatase, liver/bone/kidney 1 1
MIRT007117 SOST sclerostin 1 1
MIRT024972 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 1 1
MIRT024973 AURKB aurora kinase B 1 1
MIRT024974 CDC25B cell division cycle 25 homolog B (S. pombe) 1 1
MIRT024975 ARPC1B actin related protein 2/3 complex, subunit 1B, 41kDa 1 1
MIRT024976 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT024977 HMGA2 high mobility group AT-hook 2 1 1
MIRT024978 FBN2 fibrillin 2 1 1
MIRT024979 ERF Ets2 repressor factor 1 1
MIRT024980 EFNB1 ephrin-B1 1 1
MIRT024981 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) 1 1
MIRT024982 CTSC cathepsin C 1 1
MIRT024983 CDH11 cadherin 11, type 2, OB-cadherin (osteoblast) 1 1
MIRT024984 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 1 1
MIRT024985 ITGB4 integrin, beta 4 1 1
MIRT024986 HOXB7 homeobox B7 1 1
MIRT024987 BMP1 bone morphogenetic protein 1 1 1
MIRT047009 BPTF bromodomain PHD finger transcription factor 1 1
MIRT047010 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT047011 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT047012 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT047013 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT047014 RPLP1 ribosomal protein, large, P1 1 1
MIRT047015 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT047016 CCNT2 cyclin T2 1 1
MIRT047017 IPO7 importin 7 1 1
MIRT047018 TEC transient erythroblastopenia of childhood 1 1
MIRT047019 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT047020 HACL1 2-hydroxyacyl-CoA lyase 1 1 1
MIRT047021 ENO1 enolase 1, (alpha) 1 1
MIRT047022 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT047023 BRD2 bromodomain containing 2 1 1
MIRT047024 HIST2H4B histone cluster 2, H4b 1 1
MIRT047025 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT047026 RPL3 ribosomal protein L3 1 1
MIRT047027 BEX2 brain expressed X-linked 2 1 1