Accession ID: MIRT003274 [miRNA, hsa-miR-30d-5p :: GNAI2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30dLinkOut: [miRBase ]
Description Homo sapiens miR-30d stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30d-5p
Mature Sequence 6| UGUAAACAUCCCCGACUGGAAG |27
Evidence Experimental
Experiments Cloned
Putative hsa-miR-30d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GNAI2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GIP, GNAI2B, H_LUCA15.1, H_LUCA16.1
Description guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Transcript NM_0011664    LinkOut: [ RefSeq ]
Other Transcripts NM_0020   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GNAI2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GNAI2
(miRNA target sites are highlighted)
>GNAI2|NM_0011664|3'UTR
   1 TGAGGGGCAGCGGGGCCTGGCGGGATGGGCCACCGCCGACTTTGTACCCCCCAACCCCTGAGGAAGATGGGGGCAAGAAG
  81 ATCACGCTCCCCGCCTGTTCCCCCGCCGCTTTTCTCCTCTTTCCTCTCTTTGTTCTCAGCTCCCCCTGTCCCCTCAGCTC
 161 CAGACGTAGGGGAGGGGTTGCCACAGGCCTCCCTGTTTGAAGCCTGCCCTTGTCTGAGATGCTGGTAATGGCCATGGTAC
 241 CCCCTTCTGGGCATCTGTTCTGGTTTTTAACCATTGTCTTGTTCTGTGATGAGGGGAGGGGGGCACATGCTGAGTCTCCC
 321 AAGGCTGCGTCTGGAGGGGCCCCTGCTTCTCCAGCCTGGACCCCCAGCTTTGCCCAACACCAGCCCCTGCCCCAGCCCAA
 401 GTCCAAATGTTTACAGGGAGCCTCCTGCCCAGTCCCCCAACCCCAGCCGCTCGGAGGCCCCAAAGGAAAAAGCACAAGAA
 481 GCGTGAGACGCCACCATTCCTGGAAACCACAGTCCACCTGCTCATTCTCGTAGCTTTTTAAAAAAATGAAAGTAAAGGAA
 561 AAAAAAAAAACTGCAAATCTAGAAAACTTTTTAGAGAAAAACTATTTAAAACTGTCAGATCCTGACCAGCAAGCCCCCCC
 641 CCAGCCCCCCTTCCAAGTGACTCCGTGCCTTGAGTGTGTCTGCGTGTTTACACCCGTCCCTCTGCTGGCCGCCCCCGTGC
 721 GAGCGGCACCCCTGCCCTGCCCTCCACAGAATTGGGTTCCAAGGGCTGTTCCAGACAACTGCCAACGTCACTGAGGGCCC
 801 TGCCCCAGCGGCCCTGGCCCCAGGCTCTATTAACCTAAAATGTAGCTCCCTAGCGCTAACCTAGGAACCGCCGCTGCCTG
 881 CTGGGGGGCCACGCCCCTCATGCCCTTGTCCCAGGCCCGGGGCCTTCAGCGTTGAACACTTCCTTGCTTTTTTCACATGT
 961 TTTATGGAATTGTTCACCTGGTTTGAAATAATAAAATGTAGAAAGAAAAAAAAT
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30d-5p :: GNAI2    [ Functional MTI ]
Validation Method Western blot , , Other
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research microRNA.org , miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-30d Posttranscriptionally Down-regulates GNAI2 Expression by Directly Targeting Its 3`-UTR. ...

- Yao, J. Liang, L. Huang, S. Ding, J. Tan, et al., 2010, Hepatology.

Article - Yao, J. Liang, L. Huang, S. Ding, J. Tan, et al.
- Hepatology, 2010
The pathological relevance and significance of microRNAs (miRNAs) in hepatocarcinogenesis have attracted much attention in recent years; however, little is known about the underlying molecular mechanisms through which miRNAs are involved in the development and progression of hepatocellular carcinoma (HCC). In this study, we demonstrate that miR-30d is frequently up-regulated in HCC and that its expression is highly associated with the intrahepatic metastasis of HCC. Furthermore, the enhanced expression of miR-30d could promote HCC cell migration and invasion in vitro and intrahepatic and distal pulmonary metastasis in vivo, while silencing its expression resulted in a reduced migration and invasion. Galphai2 (GNAI2) was identified as the direct and functional target of miR-30d with integrated bioinformatics analysis and messenger RNA array assay. This regulation was further confirmed by luciferase reporter assays. In addition, our results, for the first time, showed that GNAI2 was frequently suppressed in HCC by way of quantitative reverse-transcription polymerase chain reaction and immunohistochemical staining assays. The increase of the GNAI2 expression significantly inhibits, whereas knockdown of the GNAI2 expression remarkably enhances HCC cell migration and invasion, indicating that GNAI2 functions as a metastasis suppressor in HCC. The restoration of GNAI2 can inhibit miR-30d-induced HCC cell invasion and metastasis. Conclusion: The newly identified miR-30d/GNAI2 axis elucidates the molecular mechanism of HCC cell invasion and metastasis and represents a new potential therapeutic target for HCC treatment. (HEPATOLOGY 2010.).
LinkOut: [PMID: 20054866]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
62 hsa-miR-30d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003274 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 3 1
MIRT005418 TP53 tumor protein p53 4 1
MIRT006240 CASP3 caspase 3, apoptosis-related cysteine peptidase 2 1
MIRT006322 SMAD1 SMAD family member 1 2 1
MIRT006608 Snai1 snail homolog 1 (Drosophila) 1 1
MIRT006763 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT006920 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT007057 GPR78 G protein-coupled receptor 78 1 1
MIRT025969 RUNX2 runt-related transcription factor 2 2 1
MIRT047776 FAM60A family with sequence similarity 60, member A 1 1
MIRT047777 EXOC2 exocyst complex component 2 1 1
MIRT047778 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT047779 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT047780 IRF2 interferon regulatory factor 2 1 1
MIRT047781 SENP2 SUMO1/sentrin/SMT3 specific peptidase 2 1 1
MIRT047782 TAF1C TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa 1 1
MIRT047783 KLF14 Kruppel-like factor 14 1 1
MIRT047784 HOXA11 homeobox A11 1 1
MIRT047785 DENND5A DENN/MADD domain containing 5A 1 1
MIRT047786 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT047787 SMEK1 SMEK homolog 1, suppressor of mek1 (Dictyostelium) 1 1
MIRT047788 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT047789 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT047790 RREB1 ras responsive element binding protein 1 1 1
MIRT047791 ZNF609 zinc finger protein 609 1 1
MIRT047792 TAB1 TGF-beta activated kinase 1/MAP3K7 binding protein 1 1 1
MIRT047793 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT047794 ADC arginine decarboxylase 1 1
MIRT047795 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT047796 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT047797 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT047798 RPLP0 ribosomal protein, large, P0 1 1
MIRT047799 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT047800 RAB35 RAB35, member RAS oncogene family 1 1
MIRT047801 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT047802 FNIP1 folliculin interacting protein 1 1 1
MIRT047803 SLC27A1 solute carrier family 27 (fatty acid transporter), member 1 1 1
MIRT047804 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT047805 SRSF9 splicing factor, arginine/serine-rich 9 1 1
MIRT047806 RPN2 ribophorin II 1 1
MIRT047807 HDHD3 haloacid dehalogenase-like hydrolase domain containing 3 1 1
MIRT047808 MAP1B microtubule-associated protein 1B 1 1
MIRT047809 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT047810 RPS17 ribosomal protein S17 1 1
MIRT047811 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT047812 C10orf137 chromosome 10 open reading frame 137 1 1
MIRT047813 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT047814 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT047815 FBN2 fibrillin 2 1 1
MIRT047816 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT047817 DROSHA ribonuclease type III, nuclear 1 1
MIRT047818 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT047819 ZNF227 zinc finger protein 227 1 1
MIRT047820 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT047821 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT047822 NMT1 N-myristoyltransferase 1 1 1
MIRT047823 FKTN fukutin 1 1
MIRT047824 YKT6 YKT6 v-SNARE homolog (S. cerevisiae) 1 1
MIRT047825 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT047826 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT047827 MED28 mediator complex subunit 28 1 1
MIRT047828 ZBTB4 zinc finger and BTB domain containing 4 1 1