Accession ID: MIRT003498 [miRNA, hsa-miR-181d-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181dLinkOut: [miRBase ]
Description Homo sapiens miR-181d stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181d-5p
Mature Sequence 36| AACAUUCAUUGUUGUCGGUGGGU |58
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-181d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0006   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_0006|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181d-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions A549 , SGC7901/VCR
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... BCL2 is a target gene of the mature miR-181s ...

- Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P., 2010, Int J Cancer.

Article - Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P.
- Int J Cancer, 2010
MicroRNAs (miRNAs) are short non-coding RNA molecules, which post-transcriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis and proliferation. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in human gastric and lung cancer cell lines. We found that miR-181b was downregulated in both multidrug resistant human gastric cancer cell line SGC7901/VCR and multidrug resistant human lung cancer cell line A549/CDDP and the downregulation of miR-181b in SGC7901/VCR and A549/CDDP cells was concurrent with the upregulation of BCL2 protein, compared with the parental SGC7901 and A549 cell lines, respectively. In vitro drug sensitivity assay demonstrated that overexpression of miR-181b sensitized SGC7901/VCR and A549/CDDP cells to anticancer drugs, respectively. The luciferase activity of a BCL2 3'-untranslated region-based reporter construct in SGC7901/VCR and A549/CDDP cells, suggesting that a new target site in the 3'UTR of BCL2 of the mature miR-181s (miR-181a, miR-181b, miR-181c, miR-181d) was found. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively. Taken together, our findings suggest that miR-181b could play a role in the development of MDR in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. (c) 2010 UICC.
LinkOut: [PMID: 20162574]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181d-5p :: BCL2    [ Functional MTI ]
Validation Method FACS , Immunohistochemistry , Luciferase reporter assay , qRT-PCR , Western blot
Conditions U251 , LN229
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... K-ras and Bcl-2 were identiļ¬ed as direct targets of miR-181d and were up-regulated in glioma samples. ...

- Wang, X. F. Shi, Z. M. Wang, X. R. Cao, L. et al., 2012, J Cancer Res Clin Oncol.

Article - Wang, X. F. Shi, Z. M. Wang, X. R. Cao, L. et al.
- J Cancer Res Clin Oncol, 2012
PURPOSE: Recently, several microRNAs (miRNAs) were reported to be involved in the modulation of glioma development. The aim of our study was to determine the effect of miR-181d on the growth of glioma and to investigate whether this growth is modulated by targeting K-ras and Bcl-2. METHODS: Real-time PCR was used to analyze the expression of miR-181d in human glioma samples and glioma cell lines. Apoptosis, cell cycle, and proliferation (MTT) assays were performed to assess the phenotypic changes in glioma cells. Immunohistochemistry was used to determine the expression of K-ras and Bcl-2 in glioma tissues, and a luciferase reporter assay was carried out to confirm whether K-ras and Bcl-2 are direct targets of miR-181d. Western blotting was used to identify the potential signaling pathways affected glioma cell growth by miR-181d. In vivo, xenograft tumors were examined for an anti-glioma effect of miR-181d. RESULTS: MiR-181d was down-regulated in human glioma samples and up-regulated in transfected glioma cells. Ectopic expression of miR-181d suppressed proliferation and triggered cell cycle arrest and apoptosis in glioma cell lines. K-ras and Bcl-2 were identified as direct targets of miR-181d and were up-regulated in glioma samples. The results showed evidence linking the tumor suppressor activity of miR-181d in glioma cells with the K-ras-related PI3K/AKT and MAPK/ERK pathways. Furthermore, xenograft tumors from miR-181d-treated U251 cells were suppressed in vivo. CONCLUSION: MiR-181d may act as a glioma suppressor by targeting K-ras and Bcl-2.
LinkOut: [PMID: 22207524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
28 hsa-miR-181d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003498 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT006548 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 1
MIRT006937 MGMT O-6-methylguanine-DNA methyltransferase 3 1
MIRT016260 GATA6 GATA binding protein 6 1 1
MIRT016261 NLK nemo-like kinase 1 1
MIRT016263 CDX2 caudal type homeobox 2 1 1
MIRT041161 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT041162 C20orf173 chromosome 20 open reading frame 173 1 1
MIRT041163 HMGB1 high-mobility group box 1 1 1
MIRT041164 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT041165 BORA chromosome 13 open reading frame 34 1 1
MIRT041166 FCHO2 FCH domain only 2 1 1
MIRT041167 ENO1 enolase 1, (alpha) 1 1
MIRT041168 HIST1H3D histone cluster 1, H3d 1 1
MIRT041169 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT041170 RPS14 ribosomal protein S14 1 1
MIRT041171 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT041172 DHRS4 dehydrogenase/reductase (SDR family) member 4 1 1
MIRT041173 CTC1 chromosome 17 open reading frame 68 1 1
MIRT041174 NID2 nidogen 2 (osteonidogen) 1 1
MIRT041175 ATP6 ATP synthase F0 subunit 6 1 1
MIRT041176 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT041177 GAB1 GRB2-associated binding protein 1 1 1
MIRT041178 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT041179 MGRN1 mahogunin, ring finger 1 1 1
MIRT041180 C10orf35 chromosome 10 open reading frame 35 1 1
MIRT041181 EP300 E1A binding protein p300 1 1
MIRT041182 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 1