Accession ID: MIRT003498 [miRNA, hsa-miR-181d-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181dLinkOut: [miRBase ]
Description Homo sapiens miR-181d stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181d-5p
Mature Sequence 36| AACAUUCAUUGUUGUCGGUGGGU |58
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-181d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181d-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions A549 , SGC7901/VCR
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... BCL2 is a target gene of the mature miR-181s ...

- Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P., 2010, Int J Cancer.

Article - Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P.
- Int J Cancer, 2010
MicroRNAs (miRNAs) are short non-coding RNA molecules, which post-transcriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis and proliferation. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in human gastric and lung cancer cell lines. We found that miR-181b was downregulated in both multidrug resistant human gastric cancer cell line SGC7901/VCR and multidrug resistant human lung cancer cell line A549/CDDP and the downregulation of miR-181b in SGC7901/VCR and A549/CDDP cells was concurrent with the upregulation of BCL2 protein, compared with the parental SGC7901 and A549 cell lines, respectively. In vitro drug sensitivity assay demonstrated that overexpression of miR-181b sensitized SGC7901/VCR and A549/CDDP cells to anticancer drugs, respectively. The luciferase activity of a BCL2 3'-untranslated region-based reporter construct in SGC7901/VCR and A549/CDDP cells, suggesting that a new target site in the 3'UTR of BCL2 of the mature miR-181s (miR-181a, miR-181b, miR-181c, miR-181d) was found. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively. Taken together, our findings suggest that miR-181b could play a role in the development of MDR in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. (c) 2010 UICC.
LinkOut: [PMID: 20162574]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181d-5p :: BCL2    [ Functional MTI ]
Validation Method FACS , Immunohistochemistry , Luciferase reporter assay , qRT-PCR , Western blot
Conditions U251 , LN229
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... K-ras and Bcl-2 were identified as direct targets of miR-181d and were up-regulated in glioma samples. ...

- Wang, X. F. Shi, Z. M. Wang, X. R. Cao, L. et al., 2012, J Cancer Res Clin Oncol.

Article - Wang, X. F. Shi, Z. M. Wang, X. R. Cao, L. et al.
- J Cancer Res Clin Oncol, 2012
PURPOSE: Recently, several microRNAs (miRNAs) were reported to be involved in the modulation of glioma development. The aim of our study was to determine the effect of miR-181d on the growth of glioma and to investigate whether this growth is modulated by targeting K-ras and Bcl-2. METHODS: Real-time PCR was used to analyze the expression of miR-181d in human glioma samples and glioma cell lines. Apoptosis, cell cycle, and proliferation (MTT) assays were performed to assess the phenotypic changes in glioma cells. Immunohistochemistry was used to determine the expression of K-ras and Bcl-2 in glioma tissues, and a luciferase reporter assay was carried out to confirm whether K-ras and Bcl-2 are direct targets of miR-181d. Western blotting was used to identify the potential signaling pathways affected glioma cell growth by miR-181d. In vivo, xenograft tumors were examined for an anti-glioma effect of miR-181d. RESULTS: MiR-181d was down-regulated in human glioma samples and up-regulated in transfected glioma cells. Ectopic expression of miR-181d suppressed proliferation and triggered cell cycle arrest and apoptosis in glioma cell lines. K-ras and Bcl-2 were identified as direct targets of miR-181d and were up-regulated in glioma samples. The results showed evidence linking the tumor suppressor activity of miR-181d in glioma cells with the K-ras-related PI3K/AKT and MAPK/ERK pathways. Furthermore, xenograft tumors from miR-181d-treated U251 cells were suppressed in vivo. CONCLUSION: MiR-181d may act as a glioma suppressor by targeting K-ras and Bcl-2.
LinkOut: [PMID: 22207524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
279 hsa-miR-181d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003498 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT006548 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 1
MIRT006937 MGMT O-6-methylguanine-DNA methyltransferase 3 2
MIRT016260 GATA6 GATA binding protein 6 1 1
MIRT016261 NLK nemo-like kinase 1 1
MIRT016263 CDX2 caudal type homeobox 2 1 1
MIRT041161 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT041162 C20orf173 chromosome 20 open reading frame 173 1 1
MIRT041163 HMGB1 high mobility group box 1 1 1
MIRT041164 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT041165 BORA bora, aurora kinase A activator 1 1
MIRT041166 FCHO2 FCH domain only 2 1 1
MIRT041167 ENO1 enolase 1, (alpha) 1 1
MIRT041168 HIST1H3D histone cluster 1, H3d 1 2
MIRT041169 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT041170 RPS14 ribosomal protein S14 1 1
MIRT041171 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT041172 DHRS4 dehydrogenase/reductase (SDR family) member 4 1 1
MIRT041173 CTC1 CTS telomere maintenance complex component 1 1 1
MIRT041174 NID2 nidogen 2 (osteonidogen) 1 1
MIRT041175 ATP6 ATP synthase F0 subunit 6 1 1
MIRT041176 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT041177 GAB1 GRB2-associated binding protein 1 1 1
MIRT041178 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT041179 MGRN1 mahogunin ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT041180 C10orf35 chromosome 10 open reading frame 35 1 1
MIRT041181 EP300 E1A binding protein p300 1 1
MIRT041182 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT054565 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT055117 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 2
MIRT056152 OTUD1 OTU domain containing 1 1 1
MIRT057095 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT068605 NHLRC3 NHL repeat containing 3 1 1
MIRT071719 CCNK cyclin K 1 2
MIRT074783 PAPD5 PAP associated domain containing 5 1 1
MIRT081049 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT081144 LDLR low density lipoprotein receptor 1 1
MIRT086587 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT088068 SEPT2 septin 2 1 2
MIRT088435 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT095893 CCNG1 cyclin G1 1 1
MIRT097064 TNPO1 transportin 1 1 1
MIRT106872 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT109668 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT125901 DUSP5 dual specificity phosphatase 5 1 1
MIRT128346 CUL5 cullin 5 1 1
MIRT128556 ATM ataxia telangiectasia mutated 1 2
MIRT131162 INCENP inner centromere protein antigens 135/155kDa 1 1
MIRT131435 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT133215 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT134667 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT137311 IPO5 importin 5 1 1
MIRT137430 RLF rearranged L-myc fusion 1 1
MIRT137705 RCOR1 REST corepressor 1 1 1
MIRT138435 KIF2C kinesin family member 2C 1 2
MIRT143461 CHD9 chromodomain helicase DNA binding protein 9 1 2
MIRT147129 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT149123 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT149981 ZNF136 zinc finger protein 136 1 1
MIRT152772 KIF3B kinesin family member 3B 1 1
MIRT153575 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT153867 NCOA3 nuclear receptor coactivator 3 1 1
MIRT156997 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT161706 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT163351 PRKCD protein kinase C, delta 1 1
MIRT172794 SLC25A37 solute carrier family 25 (mitochondrial iron transporter), member 37 1 1
MIRT172880 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 1 1
MIRT175460 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT182142 ADRBK1 adrenergic, beta, receptor kinase 1 1 1
MIRT183812 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 1
MIRT184931 ZNF268 zinc finger protein 268 1 1
MIRT191112 ARF6 ADP-ribosylation factor 6 1 1
MIRT194177 ZFAND6 zinc finger, AN1-type domain 6 1 3
MIRT199134 LMAN1 lectin, mannose-binding, 1 1 1
MIRT199778 MRPL34 mitochondrial ribosomal protein L34 1 1
MIRT202712 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT210757 CHMP2B charged multivesicular body protein 2B 1 1
MIRT231565 DRAM1 DNA-damage regulated autophagy modulator 1 1 1
MIRT234623 KIAA0195 KIAA0195 1 1
MIRT234948 ZNF440 zinc finger protein 440 1 2
MIRT234956 ZNF439 zinc finger protein 439 1 1
MIRT237878 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 2
MIRT247911 KIAA1551 KIAA1551 1 1
MIRT252254 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT253454 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT256746 HIGD2A HIG1 hypoxia inducible domain family, member 2A 1 1
MIRT257375 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT273449 DAZAP2 DAZ associated protein 2 1 1
MIRT279878 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 1
MIRT305131 SLC35G2 solute carrier family 35, member G2 1 1
MIRT314553 MTX3 metaxin 3 1 1
MIRT442469 IQCG IQ motif containing G 1 1
MIRT445120 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT447012 RSF1 remodeling and spacing factor 1 1 1
MIRT451639 FAM96A family with sequence similarity 96, member A 1 1
MIRT467858 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT470385 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT473031 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT477001 FAM73B family with sequence similarity 73, member B 1 1
MIRT478248 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT479957 CBX4 chromobox homolog 4 1 3
MIRT480024 CAPRIN2 caprin family member 2 1 2
MIRT498149 FKBP1C FK506 binding protein 1C 1 2
MIRT498522 ZNF83 zinc finger protein 83 1 4
MIRT499141 HSPA1B heat shock 70kDa protein 1B 1 4
MIRT499471 ZNF669 zinc finger protein 669 1 4
MIRT500267 ZNF788 zinc finger family member 788 1 3
MIRT500277 ZNF781 zinc finger protein 781 1 3
MIRT500302 ZNF667 zinc finger protein 667 1 4
MIRT500332 ZNF487P zinc finger protein 487, pseudogene 1 3
MIRT502347 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT502624 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 1 3
MIRT507376 EPS8 epidermal growth factor receptor pathway substrate 8 1 2
MIRT513008 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT513566 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT519608 ZNF791 zinc finger protein 791 1 3
MIRT519848 ZFP69B zinc finger protein 643 1 2
MIRT520648 NPM3 nucleophosmin/nucleoplasmin 3 1 3
MIRT523127 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 2
MIRT526142 GJB7 gap junction protein, beta 7, 25kDa 1 1
MIRT528356 ZDHHC15 zinc finger, DHHC-type containing 15 1 1
MIRT529131 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT532857 ZNF699 zinc finger protein 699 1 1
MIRT535282 PHOX2B paired-like homeobox 2b 1 1
MIRT535321 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT536905 HEPHL1 hephaestin-like 1 1 1
MIRT539051 ATP8B1 ATPase, aminophospholipid transporter, class I, type 8B, member 1 1 1
MIRT542775 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT542880 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 2
MIRT543606 ZNF844 zinc finger protein 844 1 2
MIRT543633 ZNF780B zinc finger protein 780B 1 1
MIRT543949 NCOA7 nuclear receptor coactivator 7 1 1
MIRT544387 ZNF266 zinc finger protein 266 1 1
MIRT544460 KRBOX4 zinc finger family member 673 1 1
MIRT545435 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT546319 TMCC1 transmembrane and coiled-coil domain family 1 1 2
MIRT548174 FOXL1 forkhead box L1 1 2
MIRT551116 ZNF107 zinc finger protein 107 1 1
MIRT554023 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT554671 RNF6 ring finger protein (C3H2C3 type) 6 1 2
MIRT555159 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT557273 HMGA2 high mobility group AT-hook 2 1 1
MIRT558549 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT559451 ARSJ arylsulfatase family, member J 1 1
MIRT559794 ZNF415 zinc finger protein 415 1 1
MIRT560744 ZNF616 zinc finger protein 616 1 1
MIRT560841 SUV39H2 suppressor of variegation 3-9 homolog 2 (Drosophila) 1 1
MIRT562337 FAM3C family with sequence similarity 3, member C 1 1
MIRT562764 ZNF846 zinc finger protein 846 1 1
MIRT564739 ZNF23 zinc finger protein 23 1 1
MIRT565164 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT566980 LBR lamin B receptor 1 2
MIRT567385 GTPBP3 GTP binding protein 3 (mitochondrial) 1 1
MIRT568679 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT575084 Ddit4 DNA-damage-inducible transcript 4 1 1
MIRT575947 Unc5b unc-5 homolog B (C. elegans) 1 1
MIRT611623 SLC35G3 solute carrier family 35, member G3 1 1
MIRT613088 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 2
MIRT614681 UNC5B unc-5 homolog B (C. elegans) 1 2
MIRT620867 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT622406 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT624714 AP5M1 adaptor-related protein complex 5, mu 1 subunit 1 2
MIRT631076 ZNF829 zinc finger protein 829 1 1
MIRT633490 WDR72 WD repeat domain 72 1 1
MIRT635713 HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1 1
MIRT637036 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT639500 SCN8A sodium channel, voltage gated, type VIII, alpha subunit 1 1
MIRT641322 ATXN7 ataxin 7 1 1
MIRT646841 TLDC1 KIAA1609 1 1
MIRT649735 RBM25 RNA binding motif protein 25 1 1
MIRT651422 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT660603 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT669765 ZNF556 zinc finger protein 556 1 1
MIRT683296 ZNF253 zinc finger protein 253 1 1
MIRT698126 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT698673 TEF thyrotrophic embryonic factor 1 1
MIRT702060 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT705935 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT707906 RSBN1L round spermatid basic protein 1-like 1 1
MIRT708827 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT708955 PDK3 pyruvate dehydrogenase kinase, isozyme 3 1 1
MIRT711039 RNF187 ring finger protein 187 1 1
MIRT711100 ZNF597 zinc finger protein 597 1 1
MIRT712565 CENPO centromere protein O 1 1
MIRT713214 FAM13A family with sequence similarity 13, member A 1 1
MIRT714103 RLIM ring finger protein, LIM domain interacting 1 1
MIRT715361 VCAM1 vascular cell adhesion molecule 1 1 1
MIRT716285 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT719333 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT720072 ZNF449 zinc finger protein 449 1 1
MIRT722292 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT722499 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT725538 EN2 engrailed homeobox 2 1 1
MIRT726022 ZNF664 zinc finger protein 664 1 1
MIRT726054 ZNF121 zinc finger protein 121 1 1
MIRT726065 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT726086 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT726175 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT726215 TUBB tubulin, beta class I 1 1
MIRT726222 TSG101 tumor susceptibility gene 101 1 1
MIRT726253 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT726272 TMF1 TATA element modulatory factor 1 1 1
MIRT726291 TMEM30A transmembrane protein 30A 1 1
MIRT726331 TFRC transferrin receptor (p90, CD71) 1 1
MIRT726350 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726361 TBC1D7 TBC1 domain family, member 7 1 1
MIRT726373 TBC1D13 TBC1 domain family, member 13 1 1
MIRT726415 STX2 syntaxin 2 1 1
MIRT726434 STAG1 stromal antigen 1 1 1
MIRT726438 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT726456 SRGN serglycin 1 1
MIRT726472 SORT1 sortilin 1 1 1
MIRT726488 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 1
MIRT726516 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT726536 SLC38A2 solute carrier family 38, member 2 1 1
MIRT726554 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT726564 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT726568 SIPA1L1 signal-induced proliferation-associated 1 like 1 1 1
MIRT726578 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT726706 RP2 retinitis pigmentosa 2 (X-linked recessive) 1 1
MIRT726741 RHOG ras homolog family member G 1 1
MIRT726744 RGS16 regulator of G-protein signaling 16 1 1
MIRT726790 RAN RAN, member RAS oncogene family 1 1
MIRT726818 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT726827 PURB purine-rich element binding protein B 1 1
MIRT726968 PGAP1 post-GPI attachment to proteins 1 1 1
MIRT726980 PER2 period homolog 2 (Drosophila) 1 1
MIRT727002 PBRM1 polybromo 1 1 1
MIRT727040 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT727075 NMT2 N-myristoyltransferase 2 1 1
MIRT727079 FAM192A family with sequence similarity 192, member A 1 1
MIRT727083 NIN ninein (GSK3B interacting protein) 1 1
MIRT727097 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT727109 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT727130 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT727158 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT727179 KMT2E myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) 1 1
MIRT727284 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727288 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT727329 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT727372 EFCAB14 KIAA0494 1 1
MIRT727379 KIAA0196 KIAA0196 1 1
MIRT727402 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT727446 INO80D INO80 complex subunit D 1 1
MIRT727457 IL1A interleukin 1, alpha 1 1
MIRT727504 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT727535 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 1 1
MIRT727540 GOLGA8B golgin A8 family, member B 1 1
MIRT727549 GOLGA1 golgin A1 1 1
MIRT727556 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT727576 GK5 glycerol kinase 5 (putative) 1 1
MIRT727623 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT727642 FSD1L fibronectin type III and SPRY domain containing 1-like 1 1
MIRT727676 FBXO11 F-box protein 11 1 1
MIRT727702 FAM58A family with sequence similarity 58, member A 1 1
MIRT727712 FAM160A2 family with sequence similarity 160, member A2 1 1
MIRT727754 EPS15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT727800 EED embryonic ectoderm development 1 1
MIRT727833 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT727889 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1 1
MIRT727942 CPOX coproporphyrinogen oxidase 1 1
MIRT727961 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727981 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728029 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT728036 CCDC88C coiled-coil domain containing 88C 1 1
MIRT728135 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT728154 GSKIP GSK3B interacting protein 1 1
MIRT728164 C11orf30 chromosome 11 open reading frame 30 1 1
MIRT728198 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT728221 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT728252 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT728275 ATG2B autophagy related 2B 1 1
MIRT728293 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT728297 ARRDC3 arrestin domain containing 3 1 1
MIRT728300 ARRB2 arrestin, beta 2 1 1
MIRT728324 APOL6 apolipoprotein L, 6 1 1
MIRT728357 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT728377 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728390 ACYP1 acylphosphatase 1, erythrocyte (common) type 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*