Accession ID: MIRT003499 [miRNA, hsa-miR-181c-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181cLinkOut: [miRBase ]
Synonyms MIRN181C, mir-181c, MIR181C
Description Homo sapiens miR-181c stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181c-5p
Mature Sequence 27| AACAUUCAACCUGUCGGUGAGU |48
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181c-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions A549 , SGC7901/VCR
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... BCL2 is a target gene of the mature miR-181s ...

- Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P., 2010, Int J Cancer.

Article - Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P.
- Int J Cancer, 2010
MicroRNAs (miRNAs) are short non-coding RNA molecules, which post-transcriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis and proliferation. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in human gastric and lung cancer cell lines. We found that miR-181b was downregulated in both multidrug resistant human gastric cancer cell line SGC7901/VCR and multidrug resistant human lung cancer cell line A549/CDDP and the downregulation of miR-181b in SGC7901/VCR and A549/CDDP cells was concurrent with the upregulation of BCL2 protein, compared with the parental SGC7901 and A549 cell lines, respectively. In vitro drug sensitivity assay demonstrated that overexpression of miR-181b sensitized SGC7901/VCR and A549/CDDP cells to anticancer drugs, respectively. The luciferase activity of a BCL2 3'-untranslated region-based reporter construct in SGC7901/VCR and A549/CDDP cells, suggesting that a new target site in the 3'UTR of BCL2 of the mature miR-181s (miR-181a, miR-181b, miR-181c, miR-181d) was found. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively. Taken together, our findings suggest that miR-181b could play a role in the development of MDR in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. (c) 2010 UICC.
LinkOut: [PMID: 20162574]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
270 hsa-miR-181c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000233 NLK nemo-like kinase 2 1
MIRT000234 GATA6 GATA binding protein 6 2 1
MIRT000235 CDX2 caudal type homeobox 2 2 1
MIRT003209 NOTCH2 notch 2 4 1
MIRT003210 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 2
MIRT003211 NOTCH4 notch 4 4 1
MIRT003499 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT006845 Tnf tumor necrosis factor 3 1
MIRT006877 TRIM2 tripartite motif containing 2 1 1
MIRT006878 SIRT1 sirtuin 1 1 1
MIRT006896 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT007221 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 2 2
MIRT025034 IL2 interleukin 2 3 1
MIRT047219 TUB tubby homolog (mouse) 1 1
MIRT047220 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT047221 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT047222 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 1 1
MIRT047223 ISCA1 iron-sulfur cluster assembly 1 homolog (S. cerevisiae) 1 1
MIRT053527 DPYSL2 dihydropyrimidinase-like 2 2 1
MIRT053528 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT054564 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT055115 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 2
MIRT056151 OTUD1 OTU domain containing 1 1 1
MIRT057093 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT068602 NHLRC3 NHL repeat containing 3 1 1
MIRT071715 CCNK cyclin K 1 2
MIRT074782 PAPD5 PAP associated domain containing 5 1 1
MIRT081043 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT081142 LDLR low density lipoprotein receptor 1 1
MIRT086585 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT088066 SEPT2 septin 2 1 2
MIRT088434 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT095892 CCNG1 cyclin G1 1 1
MIRT097058 TNPO1 transportin 1 1 1
MIRT106870 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT109662 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT125894 DUSP5 dual specificity phosphatase 5 1 1
MIRT128341 CUL5 cullin 5 1 1
MIRT128545 ATM ataxia telangiectasia mutated 1 2
MIRT131158 INCENP inner centromere protein antigens 135/155kDa 1 1
MIRT131429 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT133213 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT134658 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT137304 IPO5 importin 5 1 1
MIRT137418 RLF rearranged L-myc fusion 1 1
MIRT137702 RCOR1 REST corepressor 1 1 1
MIRT138429 KIF2C kinesin family member 2C 1 2
MIRT143447 CHD9 chromodomain helicase DNA binding protein 9 1 2
MIRT147122 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT149119 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT149979 ZNF136 zinc finger protein 136 1 1
MIRT152747 KIF3B kinesin family member 3B 1 1
MIRT153574 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT153854 NCOA3 nuclear receptor coactivator 3 1 1
MIRT161697 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT163344 PRKCD protein kinase C, delta 1 1
MIRT172791 SLC25A37 solute carrier family 25 (mitochondrial iron transporter), member 37 1 1
MIRT172873 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 1 1
MIRT175457 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT182139 ADRBK1 adrenergic, beta, receptor kinase 1 1 1
MIRT183811 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 1
MIRT184929 ZNF268 zinc finger protein 268 1 1
MIRT191111 ARF6 ADP-ribosylation factor 6 1 1
MIRT194176 ZFAND6 zinc finger, AN1-type domain 6 1 3
MIRT199132 LMAN1 lectin, mannose-binding, 1 1 1
MIRT199775 MRPL34 mitochondrial ribosomal protein L34 1 1
MIRT202711 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT210752 CHMP2B charged multivesicular body protein 2B 1 1
MIRT231563 DRAM1 DNA-damage regulated autophagy modulator 1 1 1
MIRT234622 KIAA0195 KIAA0195 1 1
MIRT234947 ZNF440 zinc finger protein 440 1 2
MIRT234953 ZNF439 zinc finger protein 439 1 1
MIRT237877 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 2
MIRT247905 KIAA1551 KIAA1551 1 1
MIRT252250 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT253452 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT256744 HIGD2A HIG1 hypoxia inducible domain family, member 2A 1 1
MIRT257373 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT273446 DAZAP2 DAZ associated protein 2 1 1
MIRT279877 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 1
MIRT305130 SLC35G2 solute carrier family 35, member G2 1 1
MIRT314552 MTX3 metaxin 3 1 1
MIRT330481 KLF6 Kruppel-like factor 6 2 1
MIRT442470 IQCG IQ motif containing G 1 1
MIRT445121 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT447013 RSF1 remodeling and spacing factor 1 1 1
MIRT451640 FAM96A family with sequence similarity 96, member A 1 1
MIRT467857 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT470384 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT473032 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT477003 FAM73B family with sequence similarity 73, member B 1 1
MIRT478249 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT479958 CBX4 chromobox homolog 4 1 3
MIRT480023 CAPRIN2 caprin family member 2 1 2
MIRT498150 FKBP1C FK506 binding protein 1C 1 2
MIRT498523 ZNF83 zinc finger protein 83 1 4
MIRT499142 HSPA1B heat shock 70kDa protein 1B 1 4
MIRT499472 ZNF669 zinc finger protein 669 1 4
MIRT500269 ZNF788 zinc finger family member 788 1 3
MIRT500276 ZNF781 zinc finger protein 781 1 3
MIRT500298 ZNF667 zinc finger protein 667 1 4
MIRT500333 ZNF487P zinc finger protein 487, pseudogene 1 3
MIRT502350 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT502623 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 1 3
MIRT507377 EPS8 epidermal growth factor receptor pathway substrate 8 1 2
MIRT513009 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT513567 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT519611 ZNF791 zinc finger protein 791 1 3
MIRT519849 ZFP69B zinc finger protein 643 1 2
MIRT520649 NPM3 nucleophosmin/nucleoplasmin 3 1 3
MIRT523129 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 2
MIRT526143 GJB7 gap junction protein, beta 7, 25kDa 1 1
MIRT528357 ZDHHC15 zinc finger, DHHC-type containing 15 1 1
MIRT529132 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT532858 ZNF699 zinc finger protein 699 1 1
MIRT535283 PHOX2B paired-like homeobox 2b 1 1
MIRT535317 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT536906 HEPHL1 hephaestin-like 1 1 1
MIRT539054 ATP8B1 ATPase, aminophospholipid transporter, class I, type 8B, member 1 1 1
MIRT542776 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT542881 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 2
MIRT543607 ZNF844 zinc finger protein 844 1 2
MIRT543634 ZNF780B zinc finger protein 780B 1 1
MIRT543950 NCOA7 nuclear receptor coactivator 7 1 1
MIRT544388 ZNF266 zinc finger protein 266 1 1
MIRT544461 KRBOX4 zinc finger family member 673 1 1
MIRT545436 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT546315 TMCC1 transmembrane and coiled-coil domain family 1 1 2
MIRT548175 FOXL1 forkhead box L1 1 2
MIRT551117 ZNF107 zinc finger protein 107 1 1
MIRT554021 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT554672 RNF6 ring finger protein (C3H2C3 type) 6 1 2
MIRT555160 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT557274 HMGA2 high mobility group AT-hook 2 1 1
MIRT558553 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT559449 ARSJ arylsulfatase family, member J 1 1
MIRT559795 ZNF415 zinc finger protein 415 1 1
MIRT560745 ZNF616 zinc finger protein 616 1 1
MIRT560842 SUV39H2 suppressor of variegation 3-9 homolog 2 (Drosophila) 1 1
MIRT562336 FAM3C family with sequence similarity 3, member C 1 1
MIRT562765 ZNF846 zinc finger protein 846 1 1
MIRT564740 ZNF23 zinc finger protein 23 1 1
MIRT565162 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT566981 LBR lamin B receptor 1 2
MIRT567386 GTPBP3 GTP binding protein 3 (mitochondrial) 1 1
MIRT568680 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT575086 Ddit4 DNA-damage-inducible transcript 4 1 1
MIRT575948 Unc5b unc-5 homolog B (C. elegans) 1 1
MIRT611624 SLC35G3 solute carrier family 35, member G3 1 1
MIRT613089 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 2
MIRT614682 UNC5B unc-5 homolog B (C. elegans) 1 2
MIRT620868 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT622407 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT624715 AP5M1 adaptor-related protein complex 5, mu 1 subunit 1 2
MIRT631077 ZNF829 zinc finger protein 829 1 1
MIRT633491 WDR72 WD repeat domain 72 1 1
MIRT635714 HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1 1
MIRT637037 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT639501 SCN8A sodium channel, voltage gated, type VIII, alpha subunit 1 1
MIRT641323 ATXN7 ataxin 7 1 1
MIRT646842 TLDC1 KIAA1609 1 1
MIRT649736 RBM25 RNA binding motif protein 25 1 1
MIRT651420 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT660604 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT669766 ZNF556 zinc finger protein 556 1 1
MIRT683297 ZNF253 zinc finger protein 253 1 1
MIRT698125 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT698674 TEF thyrotrophic embryonic factor 1 1
MIRT702061 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT705936 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT707907 RSBN1L round spermatid basic protein 1-like 1 1
MIRT708828 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT708956 PDK3 pyruvate dehydrogenase kinase, isozyme 3 1 1
MIRT711040 RNF187 ring finger protein 187 1 1
MIRT711101 ZNF597 zinc finger protein 597 1 1
MIRT712566 CENPO centromere protein O 1 1
MIRT713215 FAM13A family with sequence similarity 13, member A 1 1
MIRT714104 RLIM ring finger protein, LIM domain interacting 1 1
MIRT715362 VCAM1 vascular cell adhesion molecule 1 1 1
MIRT716286 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT720068 ZNF449 zinc finger protein 449 1 1
MIRT722500 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT725540 EN2 engrailed homeobox 2 1 1
MIRT726023 ZNF664 zinc finger protein 664 1 1
MIRT726055 ZNF121 zinc finger protein 121 1 1
MIRT726066 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT726087 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT726176 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT726217 TUBB tubulin, beta class I 1 1
MIRT726224 TSG101 tumor susceptibility gene 101 1 1
MIRT726254 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT726273 TMF1 TATA element modulatory factor 1 1 1
MIRT726292 TMEM30A transmembrane protein 30A 1 1
MIRT726330 TFRC transferrin receptor (p90, CD71) 1 1
MIRT726351 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726363 TBC1D7 TBC1 domain family, member 7 1 1
MIRT726374 TBC1D13 TBC1 domain family, member 13 1 1
MIRT726416 STX2 syntaxin 2 1 1
MIRT726435 STAG1 stromal antigen 1 1 1
MIRT726439 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT726457 SRGN serglycin 1 1
MIRT726471 SORT1 sortilin 1 1 1
MIRT726487 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 1
MIRT726515 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT726537 SLC38A2 solute carrier family 38, member 2 1 1
MIRT726555 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT726565 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT726569 SIPA1L1 signal-induced proliferation-associated 1 like 1 1 1
MIRT726580 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT726708 RP2 retinitis pigmentosa 2 (X-linked recessive) 1 1
MIRT726740 RHOG ras homolog family member G 1 1
MIRT726745 RGS16 regulator of G-protein signaling 16 1 1
MIRT726791 RAN RAN, member RAS oncogene family 1 1
MIRT726820 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT726828 PURB purine-rich element binding protein B 1 1
MIRT726969 PGAP1 post-GPI attachment to proteins 1 1 1
MIRT726982 PER2 period homolog 2 (Drosophila) 1 1
MIRT727001 PBRM1 polybromo 1 1 1
MIRT727042 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT727076 NMT2 N-myristoyltransferase 2 1 1
MIRT727080 FAM192A family with sequence similarity 192, member A 1 1
MIRT727084 NIN ninein (GSK3B interacting protein) 1 1
MIRT727099 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT727111 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT727131 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT727159 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT727178 KMT2E myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) 1 1
MIRT727286 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727289 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT727330 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT727371 EFCAB14 KIAA0494 1 1
MIRT727381 KIAA0196 KIAA0196 1 1
MIRT727401 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT727448 INO80D INO80 complex subunit D 1 1
MIRT727456 IL1A interleukin 1, alpha 1 1
MIRT727493 HIST1H3D histone cluster 1, H3d 1 1
MIRT727505 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT727536 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 1 1
MIRT727539 GOLGA8B golgin A8 family, member B 1 1
MIRT727548 GOLGA1 golgin A1 1 1
MIRT727557 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT727575 GK5 glycerol kinase 5 (putative) 1 1
MIRT727622 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT727641 FSD1L fibronectin type III and SPRY domain containing 1-like 1 1
MIRT727677 FBXO11 F-box protein 11 1 1
MIRT727703 FAM58A family with sequence similarity 58, member A 1 1
MIRT727713 FAM160A2 family with sequence similarity 160, member A2 1 1
MIRT727756 EPS15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT727799 EED embryonic ectoderm development 1 1
MIRT727834 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT727890 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1 1
MIRT727944 CPOX coproporphyrinogen oxidase 1 1
MIRT727963 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727982 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728030 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT728037 CCDC88C coiled-coil domain containing 88C 1 1
MIRT728137 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT728156 GSKIP GSK3B interacting protein 1 1
MIRT728165 C11orf30 chromosome 11 open reading frame 30 1 1
MIRT728199 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT728222 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT728253 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT728277 ATG2B autophagy related 2B 1 1
MIRT728294 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT728298 ARRDC3 arrestin domain containing 3 1 1
MIRT728302 ARRB2 arrestin, beta 2 1 1
MIRT728323 APOL6 apolipoprotein L, 6 1 1
MIRT728358 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT728378 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728391 ACYP1 acylphosphatase 1, erythrocyte (common) type 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*