Accession ID: MIRT003500 [miRNA, hsa-miR-181b-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181b-1LinkOut: [miRBase ]
Synonyms MIRN181B1, MIR181B1
Description Homo sapiens miR-181b-1 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181b-5p
Mature Sequence 36| AACAUUCAUUGCUGUCGGUGGGU |58
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181b-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions A549 , SGC7901/VCR
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... BCL2 is a target gene of the mature miR-181s ...

- Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P., 2010, Int J Cancer.

Article - Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P.
- Int J Cancer, 2010
MicroRNAs (miRNAs) are short non-coding RNA molecules, which post-transcriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis and proliferation. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in human gastric and lung cancer cell lines. We found that miR-181b was downregulated in both multidrug resistant human gastric cancer cell line SGC7901/VCR and multidrug resistant human lung cancer cell line A549/CDDP and the downregulation of miR-181b in SGC7901/VCR and A549/CDDP cells was concurrent with the upregulation of BCL2 protein, compared with the parental SGC7901 and A549 cell lines, respectively. In vitro drug sensitivity assay demonstrated that overexpression of miR-181b sensitized SGC7901/VCR and A549/CDDP cells to anticancer drugs, respectively. The luciferase activity of a BCL2 3'-untranslated region-based reporter construct in SGC7901/VCR and A549/CDDP cells, suggesting that a new target site in the 3'UTR of BCL2 of the mature miR-181s (miR-181a, miR-181b, miR-181c, miR-181d) was found. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively. Taken together, our findings suggest that miR-181b could play a role in the development of MDR in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. (c) 2010 UICC.
LinkOut: [PMID: 20162574]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181b-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions SGC7901/VCR , A549/CDDP
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... MiR-181 acts directly at the BCL-2/MCL-1/XIAP-3´UTR ...

- Zhu, D. X. Zhu, W. Fang, C. Fan, L. Zou, Z. et al., 2012, Carcinogenesis.

Article - Zhu, D. X. Zhu, W. Fang, C. Fan, L. Zou, Z. et al.
- Carcinogenesis, 2012
MicroRNAs (miRNAs) have been shown to play critical roles in regulating the progress of leukemia. We performed miRNA expression profile in six Chinese patients with chronic lymphocytic leukemia (CLL), and in peripheral B cells from pooled 30 healthy donors, using a platform containing 866 human miRNAs. The most frequent changes in miRNAs in CLL cells included downregulation of miR-126, miR-572, miR-494, miR-923, miR-638, miR-130a, miR-181a and miR-181b and up-regulation of miR-29a, miR-660, miR-20a, miR-106b, miR-142-5p, miR-101, miR-30b, miR-34a, miR-let-7f, miR-21 and miR-155. Among the miRNAs down-regulated in CLL cells, we showed that miR-181a/b expression levels were significantly lower in poor prognostic subgroups defined by unmutated immunoglobulin heavy chain variable status and p53 aberrations. Furthermore, under-expression of miR-181a and miR-181b was associated with shorter overall survival and treatment-free survival in CLL patients. We further evaluated fludarabine-induced apoptosis after transfection of primary CLL cells from 40 patients with miR-15a, miR-16-1, miR-34a, miR-181a and miR-181b mimics. Transfection of miR-34a, miR-181a and miR-181b mimics into CLL cells from p53 wild-type patients led to significant increase in apoptosis compared with miRNA control. However, enforced expression of these miRNAs had no effect on B-CLL cells from p53-attenuated patients. We further demonstrated that miR-181a and miR-181b inhibiting BCL-2, MCL-1 and X-linked inhibitor of apoptosis protein by direct binding to 3'UTR. Thus, these results suggest that miR-181a/b may play important roles in the pathogenesis of CLL and may provide a possible therapeutic avenue and a sensitive indicator of the activity of the p53 axis in CLL.
LinkOut: [PMID: 22610076]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181b-5p :: BCL2    [ Functional MTI ]
Validation Method
Article - Cai, B. An, Y. Lv, N. Chen, J. Tu, M. Sun, et al.
- Oncol Rep, 2013
Pancreatic ductal adenocarcinoma (PDAC) is a highly lethal disease and is usually resistant to chemotherapy. MicroRNA181b (miR-181b) has been reported to be associated with chemoresistance in various types of cancer. In this study, we investigated the effects of miR-181b on the chemosensitivity of PDAC cells to gemcitabine and the underlying molecular events. miR-181b mimics and inhibitors were synthesized for transient gene transfection in vitro. Lentivirus carrying miR-181b mimics were used to infect PDAC cells for nude mouse xenograft assays by implanting infected PDAC cells into recipient mice. Cell viability was determined by MTT assays, while gene expression was assessed using qRT-PCR, western blot analysis and enzyme-linked immunosorbent assay (ELISA). miR-181b targeting BCL-2 expression was assessed by a dual-luciferase activity assay. The data showed that miRNA-181b expression sensitized PDAC cells to gemcitabine treatment. Although gemcitabine-resistant PDAC cell sublines (SW1990/GR and CFPAC-1/GR) expressed higher levels of miRNA-181b, gemcitabine induced higher levels of apoptosis in PDAC cells transfected with miRNA-181b mimics. The nude mouse xenograft assay data showed that miR-181b transfection also sensitized the cells to gemcitabine treatment in vivo. Molecularly, bioinformatics data predicted that miR-181b was able to bind to BCL-2 mRNA 3'UTR. The dual luciferase activity assay revealed that miRNA-181b downregulated BCL-2 expression. The results from western blot analysis showed a reduced BCL-2 expression following miR-181b transfection but an enhanced caspase-3 activity in miRNA-181b mimic-transfected PDAC cells. This study demonstrates that miRNA-181b sensitizes PDAC cells to gemcitabine by targeting BCL-2.
LinkOut: [PMID: 23440261]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
357 hsa-miR-181b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000237 AICDA activation-induced cytidine deaminase 1 1
MIRT000238 NLK nemo-like kinase 2 1
MIRT000239 GATA6 GATA binding protein 6 2 1
MIRT000240 CDX2 caudal type homeobox 2 2 1
MIRT000637 TIMP3 TIMP metallopeptidase inhibitor 3 4 3
MIRT000697 PLAG1 pleiomorphic adenoma gene 1 4 1
MIRT003035 GRIA2 glutamate receptor, ionotropic, AMPA 2 3 1
MIRT003036 VSNL1 visinin-like 1 3 1
MIRT003500 BCL2 B-cell CLL/lymphoma 2 4 3
MIRT004328 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT005106 TCL1A T-cell leukemia/lymphoma 1A 5 2
MIRT005545 MAP3K10 mitogen-activated protein kinase kinase kinase 10 3 1
MIRT005595 CYLD cylindromatosis (turban tumor syndrome) 3 1
MIRT006167 RNF2 ring finger protein 2 4 1
MIRT006232 TMED7 transmembrane emp24 protein transport domain containing 7 3 1
MIRT006272 SIRT1 sirtuin 1 1 1
MIRT006371 CBX7 chromobox homolog 7 1 1
MIRT006951 XIAP X-linked inhibitor of apoptosis 1 1
MIRT006952 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT007239 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT025035 Aicda activation-induced cytidine deaminase 1 1
MIRT025036 ESR1 estrogen receptor 1 1 1
MIRT025037 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT035553 E2F1 E2F transcription factor 1 3 2
MIRT047224 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT047225 C20orf173 chromosome 20 open reading frame 173 1 1
MIRT047226 FAM5B family with sequence similarity 5, member B 1 1
MIRT047227 NDE1 nudE nuclear distribution E homolog 1 (A. nidulans) 1 1
MIRT047228 KRI1 KRI1 homolog (S. cerevisiae) 1 1
MIRT047229 RBMX RNA binding motif protein, X-linked 1 1
MIRT047230 DNAJB11 DnaJ (Hsp40) homolog, subfamily B, member 11 1 1
MIRT047231 PTEN phosphatase and tensin homolog 1 1
MIRT047232 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT047233 KLHL7 kelch-like 7 (Drosophila) 1 1
MIRT047234 NDC1 transmembrane protein 48 1 1
MIRT047235 TMEM189 transmembrane protein 189 1 1
MIRT047236 KPNB1 karyopherin (importin) beta 1 1 1
MIRT047237 CAT catalase 1 1
MIRT047238 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 1 1
MIRT047239 USP10 ubiquitin specific peptidase 10 1 1
MIRT047240 LMCD1 LIM and cysteine-rich domains 1 1 1
MIRT047241 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT047242 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047243 THOC3 THO complex 3 1 1
MIRT047244 ZFHX3 zinc finger homeobox 3 1 1
MIRT047245 MED14 mediator complex subunit 14 1 1
MIRT047246 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT047247 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT047248 RPL18A ribosomal protein L18a 1 1
MIRT047249 RPS7 ribosomal protein S7 1 1
MIRT047250 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT047251 RNF187 ring finger protein 187 1 2
MIRT047252 ZNF526 zinc finger protein 526 1 1
MIRT047253 HIST1H1E histone cluster 1, H1e 1 1
MIRT047254 EP300 E1A binding protein p300 1 1
MIRT047255 INO80B INO80 complex subunit B 1 1
MIRT047256 C5orf34 chromosome 5 open reading frame 34 1 1
MIRT047257 IFNGR1 interferon gamma receptor 1 1 1
MIRT047258 ZXDC ZXD family zinc finger C 1 1
MIRT047259 MEPCE methylphosphate capping enzyme 1 1
MIRT047260 NRBP1 nuclear receptor binding protein 1 1 1
MIRT047261 ZNF503 zinc finger protein 503 1 1
MIRT047262 UBB ubiquitin B 1 1
MIRT047263 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT047264 NR2F1 nuclear receptor subfamily 2, group F, member 1 1 1
MIRT047265 RAP1GAP2 RAP1 GTPase activating protein 2 1 1
MIRT047266 ARHGAP35 Rho GTPase activating protein 35 1 1
MIRT047267 XPO6 exportin 6 1 1
MIRT047268 ZNF747 zinc finger protein 747 1 1
MIRT047269 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT047270 SCAP SREBF chaperone 1 1
MIRT047271 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT047272 TRRAP transformation/transcription domain-associated protein 1 1
MIRT047273 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047274 C17orf100 chromosome 17 open reading frame 100 1 1
MIRT047275 RPS12 ribosomal protein S12 1 1
MIRT047276 FBL fibrillarin 1 1
MIRT047277 FUS fused in sarcoma 1 1
MIRT047278 NEK3 NIMA (never in mitosis gene a)-related kinase 3 1 1
MIRT047279 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT047280 RTFDC1 replication termination factor 2 domain containing 1 1 1
MIRT047281 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT047282 DIDO1 death inducer-obliterator 1 1 1
MIRT047283 ZBTB4 zinc finger and BTB domain containing 4 1 2
MIRT047284 HIST2H4B histone cluster 2, H4b 1 1
MIRT047285 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT047286 BPTF bromodomain PHD finger transcription factor 1 1
MIRT047287 DDHD1 DDHD domain containing 1 1 1
MIRT047288 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT047289 USP24 ubiquitin specific peptidase 24 1 1
MIRT047290 EIF4E2 eukaryotic translation initiation factor 4E family member 2 1 1
MIRT047291 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT047292 MYO1C myosin IC 1 1
MIRT047293 RPS8 ribosomal protein S8 1 1
MIRT047294 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT047295 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047296 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT047297 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT047298 ATP6 ATP synthase F0 subunit 6 1 1
MIRT047299 ASB13 ankyrin repeat and SOCS box containing 13 1 1
MIRT047300 KIAA1524 KIAA1524 1 1
MIRT047301 C2orf69 chromosome 2 open reading frame 69 1 2
MIRT052904 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 3 1
MIRT052975 PBX3 pre-B-cell leukemia homeobox 3 3 1
MIRT053150 ATM ataxia telangiectasia mutated 3 3
MIRT053489 CREB1 cAMP responsive element binding protein 1 3 1
MIRT054563 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT054648 ADCY9 adenylate cyclase 9 3 1
MIRT055114 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 2
MIRT056150 OTUD1 OTU domain containing 1 1 1
MIRT057092 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT068601 NHLRC3 NHL repeat containing 3 1 1
MIRT071714 CCNK cyclin K 1 2
MIRT074781 PAPD5 PAP associated domain containing 5 1 1
MIRT081042 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT081141 LDLR low density lipoprotein receptor 1 1
MIRT088065 SEPT2 septin 2 1 2
MIRT088433 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT095891 CCNG1 cyclin G1 1 1
MIRT097057 TNPO1 transportin 1 1 1
MIRT106869 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT109661 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT125893 DUSP5 dual specificity phosphatase 5 1 1
MIRT128340 CUL5 cullin 5 1 1
MIRT131157 INCENP inner centromere protein antigens 135/155kDa 1 1
MIRT131428 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT133212 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT134657 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT137302 IPO5 importin 5 1 1
MIRT137417 RLF rearranged L-myc fusion 1 1
MIRT137701 RCOR1 REST corepressor 1 1 1
MIRT138428 KIF2C kinesin family member 2C 1 2
MIRT143446 CHD9 chromodomain helicase DNA binding protein 9 1 2
MIRT147121 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT149118 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT149978 ZNF136 zinc finger protein 136 1 1
MIRT152746 KIF3B kinesin family member 3B 1 1
MIRT153573 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT153853 NCOA3 nuclear receptor coactivator 3 1 1
MIRT156990 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT161696 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT163343 PRKCD protein kinase C, delta 1 1
MIRT172789 SLC25A37 solute carrier family 25 (mitochondrial iron transporter), member 37 1 1
MIRT172872 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 1 1
MIRT175456 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT182138 ADRBK1 adrenergic, beta, receptor kinase 1 1 1
MIRT183810 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 1
MIRT184928 ZNF268 zinc finger protein 268 1 1
MIRT191110 ARF6 ADP-ribosylation factor 6 1 1
MIRT194175 ZFAND6 zinc finger, AN1-type domain 6 1 3
MIRT199131 LMAN1 lectin, mannose-binding, 1 1 1
MIRT199774 MRPL34 mitochondrial ribosomal protein L34 1 1
MIRT202710 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT210751 CHMP2B charged multivesicular body protein 2B 1 1
MIRT231561 DRAM1 DNA-damage regulated autophagy modulator 1 1 1
MIRT234621 KIAA0195 KIAA0195 1 1
MIRT234946 ZNF440 zinc finger protein 440 1 2
MIRT234952 ZNF439 zinc finger protein 439 1 1
MIRT237876 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 2
MIRT247904 KIAA1551 KIAA1551 1 1
MIRT252249 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT253451 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT256743 HIGD2A HIG1 hypoxia inducible domain family, member 2A 1 1
MIRT257372 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT273445 DAZAP2 DAZ associated protein 2 1 1
MIRT279876 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 1
MIRT305129 SLC35G2 solute carrier family 35, member G2 1 1
MIRT314551 MTX3 metaxin 3 1 1
MIRT403875 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT437420 FOS FBJ murine osteosarcoma viral oncogene homolog 4 1
MIRT437774 NFIA nuclear factor I/A 1 1
MIRT438371 SIX2 SIX homeobox 2 3 1
MIRT442471 IQCG IQ motif containing G 1 1
MIRT445122 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT447014 RSF1 remodeling and spacing factor 1 1 1
MIRT451641 FAM96A family with sequence similarity 96, member A 1 1
MIRT467861 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT470387 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT473033 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT477004 FAM73B family with sequence similarity 73, member B 1 1
MIRT478250 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT479954 CBX4 chromobox homolog 4 1 3
MIRT480027 CAPRIN2 caprin family member 2 1 2
MIRT498151 FKBP1C FK506 binding protein 1C 1 2
MIRT498524 ZNF83 zinc finger protein 83 1 4
MIRT499143 HSPA1B heat shock 70kDa protein 1B 1 4
MIRT499473 ZNF669 zinc finger protein 669 1 4
MIRT500266 ZNF788 zinc finger family member 788 1 3
MIRT500275 ZNF781 zinc finger protein 781 1 3
MIRT500300 ZNF667 zinc finger protein 667 1 4
MIRT500334 ZNF487P zinc finger protein 487, pseudogene 1 3
MIRT502349 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT502622 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 1 3
MIRT507378 EPS8 epidermal growth factor receptor pathway substrate 8 1 2
MIRT513010 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT513568 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT519609 ZNF791 zinc finger protein 791 1 3
MIRT519850 ZFP69B zinc finger protein 643 1 2
MIRT520650 NPM3 nucleophosmin/nucleoplasmin 3 1 3
MIRT523125 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 2
MIRT526144 GJB7 gap junction protein, beta 7, 25kDa 1 1
MIRT528358 ZDHHC15 zinc finger, DHHC-type containing 15 1 1
MIRT529133 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT532859 ZNF699 zinc finger protein 699 1 1
MIRT535285 PHOX2B paired-like homeobox 2b 1 1
MIRT535318 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT536907 HEPHL1 hephaestin-like 1 1 1
MIRT539053 ATP8B1 ATPase, aminophospholipid transporter, class I, type 8B, member 1 1 1
MIRT542774 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT542882 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 2
MIRT543608 ZNF844 zinc finger protein 844 1 2
MIRT543635 ZNF780B zinc finger protein 780B 1 1
MIRT543951 NCOA7 nuclear receptor coactivator 7 1 1
MIRT544389 ZNF266 zinc finger protein 266 1 1
MIRT544462 KRBOX4 zinc finger family member 673 1 1
MIRT545437 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT546316 TMCC1 transmembrane and coiled-coil domain family 1 1 2
MIRT548176 FOXL1 forkhead box L1 1 2
MIRT551118 ZNF107 zinc finger protein 107 1 1
MIRT554025 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT554673 RNF6 ring finger protein (C3H2C3 type) 6 1 2
MIRT555161 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT557275 HMGA2 high mobility group AT-hook 2 1 1
MIRT558551 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT559452 ARSJ arylsulfatase family, member J 1 1
MIRT559796 ZNF415 zinc finger protein 415 1 1
MIRT560746 ZNF616 zinc finger protein 616 1 1
MIRT560843 SUV39H2 suppressor of variegation 3-9 homolog 2 (Drosophila) 1 1
MIRT562335 FAM3C family with sequence similarity 3, member C 1 1
MIRT562766 ZNF846 zinc finger protein 846 1 1
MIRT564742 ZNF23 zinc finger protein 23 1 1
MIRT565161 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT566982 LBR lamin B receptor 1 2
MIRT567387 GTPBP3 GTP binding protein 3 (mitochondrial) 1 1
MIRT568681 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT575087 Ddit4 DNA-damage-inducible transcript 4 1 1
MIRT575949 Unc5b unc-5 homolog B (C. elegans) 1 1
MIRT611625 SLC35G3 solute carrier family 35, member G3 1 1
MIRT613090 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 2
MIRT614683 UNC5B unc-5 homolog B (C. elegans) 1 2
MIRT620869 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT622408 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT624716 AP5M1 adaptor-related protein complex 5, mu 1 subunit 1 2
MIRT631078 ZNF829 zinc finger protein 829 1 1
MIRT633492 WDR72 WD repeat domain 72 1 1
MIRT635715 HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1 1
MIRT637038 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT639502 SCN8A sodium channel, voltage gated, type VIII, alpha subunit 1 1
MIRT641324 ATXN7 ataxin 7 1 1
MIRT646843 TLDC1 KIAA1609 1 1
MIRT649737 RBM25 RNA binding motif protein 25 1 1
MIRT651419 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT660605 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT669767 ZNF556 zinc finger protein 556 1 1
MIRT683298 ZNF253 zinc finger protein 253 1 1
MIRT698127 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT698675 TEF thyrotrophic embryonic factor 1 1
MIRT702062 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT705937 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT707908 RSBN1L round spermatid basic protein 1-like 1 1
MIRT708829 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT708957 PDK3 pyruvate dehydrogenase kinase, isozyme 3 1 1
MIRT711102 ZNF597 zinc finger protein 597 1 1
MIRT712567 CENPO centromere protein O 1 1
MIRT713216 FAM13A family with sequence similarity 13, member A 1 1
MIRT714105 RLIM ring finger protein, LIM domain interacting 1 1
MIRT715359 VCAM1 vascular cell adhesion molecule 1 1 1
MIRT716287 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT720069 ZNF449 zinc finger protein 449 1 1
MIRT722501 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT725541 EN2 engrailed homeobox 2 1 1
MIRT726024 ZNF664 zinc finger protein 664 1 1
MIRT726056 ZNF121 zinc finger protein 121 1 1
MIRT726067 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT726177 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT726216 TUBB tubulin, beta class I 1 1
MIRT726223 TSG101 tumor susceptibility gene 101 1 1
MIRT726255 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT726275 TMF1 TATA element modulatory factor 1 1 1
MIRT726293 TMEM30A transmembrane protein 30A 1 1
MIRT726332 TFRC transferrin receptor (p90, CD71) 1 1
MIRT726353 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726362 TBC1D7 TBC1 domain family, member 7 1 1
MIRT726376 TBC1D13 TBC1 domain family, member 13 1 1
MIRT726417 STX2 syntaxin 2 1 1
MIRT726437 STAG1 stromal antigen 1 1 1
MIRT726440 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT726458 SRGN serglycin 1 1
MIRT726473 SORT1 sortilin 1 1 1
MIRT726489 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 1
MIRT726517 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT726538 SLC38A2 solute carrier family 38, member 2 1 1
MIRT726556 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT726567 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT726570 SIPA1L1 signal-induced proliferation-associated 1 like 1 1 1
MIRT726579 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT726707 RP2 retinitis pigmentosa 2 (X-linked recessive) 1 1
MIRT726742 RHOG ras homolog family member G 1 1
MIRT726746 RGS16 regulator of G-protein signaling 16 1 1
MIRT726792 RAN RAN, member RAS oncogene family 1 1
MIRT726821 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT726830 PURB purine-rich element binding protein B 1 1
MIRT726970 PGAP1 post-GPI attachment to proteins 1 1 1
MIRT726983 PER2 period homolog 2 (Drosophila) 1 1
MIRT727003 PBRM1 polybromo 1 1 1
MIRT727041 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT727077 NMT2 N-myristoyltransferase 2 1 1
MIRT727082 FAM192A family with sequence similarity 192, member A 1 1
MIRT727085 NIN ninein (GSK3B interacting protein) 1 1
MIRT727098 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT727110 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT727133 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT727161 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT727180 KMT2E myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) 1 1
MIRT727285 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727290 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT727331 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT727373 EFCAB14 KIAA0494 1 1
MIRT727380 KIAA0196 KIAA0196 1 1
MIRT727403 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT727449 INO80D INO80 complex subunit D 1 1
MIRT727458 IL1A interleukin 1, alpha 1 1
MIRT727492 HIST1H3D histone cluster 1, H3d 1 1
MIRT727506 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT727538 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 1 1
MIRT727541 GOLGA8B golgin A8 family, member B 1 1
MIRT727550 GOLGA1 golgin A1 1 1
MIRT727559 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT727577 GK5 glycerol kinase 5 (putative) 1 1
MIRT727624 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT727643 FSD1L fibronectin type III and SPRY domain containing 1-like 1 1
MIRT727678 FBXO11 F-box protein 11 1 1
MIRT727704 FAM58A family with sequence similarity 58, member A 1 1
MIRT727714 FAM160A2 family with sequence similarity 160, member A2 1 1
MIRT727755 EPS15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT727801 EED embryonic ectoderm development 1 1
MIRT727836 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT727891 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1 1
MIRT727943 CPOX coproporphyrinogen oxidase 1 1
MIRT727962 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727983 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728031 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT728038 CCDC88C coiled-coil domain containing 88C 1 1
MIRT728136 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT728157 GSKIP GSK3B interacting protein 1 1
MIRT728167 C11orf30 chromosome 11 open reading frame 30 1 1
MIRT728201 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT728223 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT728254 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT728276 ATG2B autophagy related 2B 1 1
MIRT728295 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT728299 ARRDC3 arrestin domain containing 3 1 1
MIRT728303 ARRB2 arrestin, beta 2 1 1
MIRT728325 APOL6 apolipoprotein L, 6 1 1
MIRT728359 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT728379 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728393 ACYP1 acylphosphatase 1, erythrocyte (common) type 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*