Accession ID: MIRT003500 [miRNA, hsa-miR-181b-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181b-1LinkOut: [miRBase ]
Synonyms MIRN181B1, MIR181B1
Description Homo sapiens miR-181b-1 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181b-5p
Mature Sequence 36| AACAUUCAUUGCUGUCGGUGGGU |58
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0006   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_0006|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uggguggCUGUCGUUACUUACAa 5'
                 || |||||||||||| 
Target 5' catgttaGA-AGCAATGAATGTa 3'
2885 - 2906 167.00 -14.90
2
miRNA  3' ugGGUGGCUGUCGUU----ACUUACAa 5'
            |:||| | || ||    ||:|||| 
Target 5' agCTACCTA-AGAAAAACCTGGATGTc 3'
1966 - 1991 142.00 -11.00
3
miRNA  3' ugggUGG-CUG--UCGUUACUUACaa 5'
              |:| ||:  ||| |||||||  
Target 5' gaaaATCAGATGGAGC-ATGAATGgt 3'
4542 - 4566 136.00 -12.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181b-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions A549 , SGC7901/VCR
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... BCL2 is a target gene of the mature miR-181s ...

- Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P., 2010, Int J Cancer.

Article - Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P.
- Int J Cancer, 2010
MicroRNAs (miRNAs) are short non-coding RNA molecules, which post-transcriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis and proliferation. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in human gastric and lung cancer cell lines. We found that miR-181b was downregulated in both multidrug resistant human gastric cancer cell line SGC7901/VCR and multidrug resistant human lung cancer cell line A549/CDDP and the downregulation of miR-181b in SGC7901/VCR and A549/CDDP cells was concurrent with the upregulation of BCL2 protein, compared with the parental SGC7901 and A549 cell lines, respectively. In vitro drug sensitivity assay demonstrated that overexpression of miR-181b sensitized SGC7901/VCR and A549/CDDP cells to anticancer drugs, respectively. The luciferase activity of a BCL2 3'-untranslated region-based reporter construct in SGC7901/VCR and A549/CDDP cells, suggesting that a new target site in the 3'UTR of BCL2 of the mature miR-181s (miR-181a, miR-181b, miR-181c, miR-181d) was found. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively. Taken together, our findings suggest that miR-181b could play a role in the development of MDR in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. (c) 2010 UICC.
LinkOut: [PMID: 20162574]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181b-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions SGC7901/VCR , A549/CDDP
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... MiR-181 acts directly at the BCL-2/MCL-1/XIAP-3´UTR ...

- Zhu, D. X. Zhu, W. Fang, C. Fan, L. Zou, Z. et al., 2012, Carcinogenesis.

Article - Zhu, D. X. Zhu, W. Fang, C. Fan, L. Zou, Z. et al.
- Carcinogenesis, 2012
MicroRNAs (miRNAs) have been shown to play critical roles in regulating the progress of leukemia. We performed miRNA expression profile in six Chinese patients with chronic lymphocytic leukemia (CLL), and in peripheral B cells from pooled 30 healthy donors, using a platform containing 866 human miRNAs. The most frequent changes in miRNAs in CLL cells included downregulation of miR-126, miR-572, miR-494, miR-923, miR-638, miR-130a, miR-181a and miR-181b and up-regulation of miR-29a, miR-660, miR-20a, miR-106b, miR-142-5p, miR-101, miR-30b, miR-34a, miR-let-7f, miR-21 and miR-155. Among the miRNAs down-regulated in CLL cells, we showed that miR-181a/b expression levels were significantly lower in poor prognostic subgroups defined by unmutated immunoglobulin heavy chain variable status and p53 aberrations. Furthermore, under-expression of miR-181a and miR-181b was associated with shorter overall survival and treatment-free survival in CLL patients. We further evaluated fludarabine-induced apoptosis after transfection of primary CLL cells from 40 patients with miR-15a, miR-16-1, miR-34a, miR-181a and miR-181b mimics. Transfection of miR-34a, miR-181a and miR-181b mimics into CLL cells from p53 wild-type patients led to significant increase in apoptosis compared with miRNA control. However, enforced expression of these miRNAs had no effect on B-CLL cells from p53-attenuated patients. We further demonstrated that miR-181a and miR-181b inhibiting BCL-2, MCL-1 and X-linked inhibitor of apoptosis protein by direct binding to 3'UTR. Thus, these results suggest that miR-181a/b may play important roles in the pathogenesis of CLL and may provide a possible therapeutic avenue and a sensitive indicator of the activity of the p53 axis in CLL.
LinkOut: [PMID: 22610076]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
102 hsa-miR-181b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000237 AICDA activation-induced cytidine deaminase 1 1
MIRT000238 NLK nemo-like kinase 2 1
MIRT000239 GATA6 GATA binding protein 6 2 1
MIRT000240 CDX2 caudal type homeobox 2 2 1
MIRT000637 TIMP3 TIMP metallopeptidase inhibitor 3 4 2
MIRT000697 PLAG1 pleiomorphic adenoma gene 1 4 1
MIRT003035 GRIA2 glutamate receptor, ionotropic, AMPA 2 3 1
MIRT003036 VSNL1 visinin-like 1 3 1
MIRT003500 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT004328 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT005106 TCL1A T-cell leukemia/lymphoma 1A 5 2
MIRT005545 MAP3K10 mitogen-activated protein kinase kinase kinase 10 3 1
MIRT005595 CYLD cylindromatosis (turban tumor syndrome) 3 1
MIRT006167 RNF2 ring finger protein 2 4 1
MIRT006232 TMED7 transmembrane emp24 protein transport domain containing 7 3 1
MIRT006272 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT006371 CBX7 chromobox homolog 7 1 1
MIRT006951 XIAP X-linked inhibitor of apoptosis 1 1
MIRT006952 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT007239 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT025035 Aicda activation-induced cytidine deaminase 1 1
MIRT025036 ESR1 estrogen receptor 1 1 1
MIRT025037 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT035553 E2F1 E2F transcription factor 1 3 2
MIRT047224 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT047225 C20orf173 chromosome 20 open reading frame 173 1 1
MIRT047226 FAM5B family with sequence similarity 5, member B 1 1
MIRT047227 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT047228 KRI1 KRI1 homolog (S. cerevisiae) 1 1
MIRT047229 RBMX RNA binding motif protein, X-linked 1 1
MIRT047230 DNAJB11 DnaJ (Hsp40) homolog, subfamily B, member 11 1 1
MIRT047231 PTEN phosphatase and tensin homolog 1 1
MIRT047232 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT047233 KLHL7 kelch-like 7 (Drosophila) 1 1
MIRT047234 NDC1 transmembrane protein 48 1 1
MIRT047235 TMEM189 transmembrane protein 189 1 1
MIRT047236 KPNB1 karyopherin (importin) beta 1 1 1
MIRT047237 CAT catalase 1 1
MIRT047238 DTD2 chromosome 14 open reading frame 126 1 1
MIRT047239 USP10 ubiquitin specific peptidase 10 1 1
MIRT047240 LMCD1 LIM and cysteine-rich domains 1 1 1
MIRT047241 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT047242 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047243 THOC3 THO complex 3 1 1
MIRT047244 ZFHX3 zinc finger homeobox 3 1 1
MIRT047245 MED14 mediator complex subunit 14 1 1
MIRT047246 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT047247 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT047248 RPL18A ribosomal protein L18a 1 1
MIRT047249 RPS7 ribosomal protein S7 1 1
MIRT047250 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT047251 RNF187 ring finger protein 187 1 1
MIRT047252 ZNF526 zinc finger protein 526 1 1
MIRT047253 HIST1H1E histone cluster 1, H1e 1 1
MIRT047254 EP300 E1A binding protein p300 1 1
MIRT047255 INO80B INO80 complex subunit B 1 1
MIRT047256 C5orf34 chromosome 5 open reading frame 34 1 1
MIRT047257 IFNGR1 interferon gamma receptor 1 1 1
MIRT047258 ZXDC ZXD family zinc finger C 1 1
MIRT047259 MEPCE methylphosphate capping enzyme 1 1
MIRT047260 NRBP1 nuclear receptor binding protein 1 1 1
MIRT047261 ZNF503 zinc finger protein 503 1 1
MIRT047262 UBB ubiquitin B 1 1
MIRT047263 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT047264 NR2F1 nuclear receptor subfamily 2, group F, member 1 1 1
MIRT047265 RAP1GAP2 RAP1 GTPase activating protein 2 1 1
MIRT047266 ARHGAP35 glucocorticoid receptor DNA binding factor 1 1 1
MIRT047267 XPO6 exportin 6 1 1
MIRT047268 ZNF747 zinc finger protein 747 1 1
MIRT047269 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT047270 SCAP SREBF chaperone 1 1
MIRT047271 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT047272 TRRAP transformation/transcription domain-associated protein 1 1
MIRT047273 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047274 C17orf100 chromosome 17 open reading frame 100 1 1
MIRT047275 RPS12 ribosomal protein S12 1 1
MIRT047276 FBL fibrillarin 1 1
MIRT047277 FUS fused in sarcoma 1 1
MIRT047278 NEK3 NIMA (never in mitosis gene a)-related kinase 3 1 1
MIRT047279 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT047280 RTFDC1 chromosome 20 open reading frame 43 1 1
MIRT047281 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT047282 DIDO1 death inducer-obliterator 1 1 1
MIRT047283 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT047284 HIST2H4B histone cluster 2, H4b 1 1
MIRT047285 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT047286 BPTF bromodomain PHD finger transcription factor 1 1
MIRT047287 DDHD1 DDHD domain containing 1 1 1
MIRT047288 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT047289 USP24 ubiquitin specific peptidase 24 1 1
MIRT047290 EIF4E2 eukaryotic translation initiation factor 4E family member 2 1 1
MIRT047291 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT047292 MYO1C myosin IC 1 1
MIRT047293 RPS8 ribosomal protein S8 1 1
MIRT047294 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT047295 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047296 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT047297 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT047298 ATP6 ATP synthase F0 subunit 6 1 1
MIRT047299 ASB13 ankyrin repeat and SOCS box-containing 13 1 1
MIRT047300 KIAA1524 KIAA1524 1 1
MIRT047301 C2orf69 chromosome 2 open reading frame 69 1 1