Accession ID: MIRT003501 [miRNA, hsa-miR-181a-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181a-2LinkOut: [miRBase ]
Synonyms MIRN181A, MIRN181A2, MIR181A2, MIR181A2HG
Description Homo sapiens miR-181a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181a-5p
Mature Sequence 39| AACAUUCAACGCUGUCGGUGAGU |61
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0006   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_0006|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions A549 , SGC7901/VCR
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... BCL2 is a target gene of the mature miR-181s ...

- Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P., 2010, Int J Cancer.

Article - Zhu, W. Shan, X. Wang, T. Shu, Y. Liu, P.
- Int J Cancer, 2010
MicroRNAs (miRNAs) are short non-coding RNA molecules, which post-transcriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis and proliferation. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in human gastric and lung cancer cell lines. We found that miR-181b was downregulated in both multidrug resistant human gastric cancer cell line SGC7901/VCR and multidrug resistant human lung cancer cell line A549/CDDP and the downregulation of miR-181b in SGC7901/VCR and A549/CDDP cells was concurrent with the upregulation of BCL2 protein, compared with the parental SGC7901 and A549 cell lines, respectively. In vitro drug sensitivity assay demonstrated that overexpression of miR-181b sensitized SGC7901/VCR and A549/CDDP cells to anticancer drugs, respectively. The luciferase activity of a BCL2 3'-untranslated region-based reporter construct in SGC7901/VCR and A549/CDDP cells, suggesting that a new target site in the 3'UTR of BCL2 of the mature miR-181s (miR-181a, miR-181b, miR-181c, miR-181d) was found. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively. Taken together, our findings suggest that miR-181b could play a role in the development of MDR in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. (c) 2010 UICC.
LinkOut: [PMID: 20162574]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Chen, G. Zhu, W. Shi, D. Lv, L. Zhang, C. et al.
- Oncol Rep, 2010
Radiotherapy is widely used in cancer treatment and biological studies. Multiple mechanisms induced by radiation, especially changes of the expression profile of genes, lead to the disruption of cellular homeostasis. MicroRNAs (miRNAs) are important post-transcriptional gene regulators and play an important role in response to cellular stress. Here we investigated the profiles of miRNA expression following exposure to radiation and the possible role of miRNAs in the modulation of radiosensitivity in the glioblastoma multiform U87MG cell line. MiRNA expression profiles revealed a limited set of miRNAs with altered expression in U87MG cells in response to radiation treatment. MiR-181a, a member of miR-181 family, was one of the down-regulated miRNAs, whose expression was further validated by qRT-PCR. The target mRNAs of radiation-responsive miRNAs were predicted with a target prediction tool. Transiently overexpressed miR-181a significantly sensitized malignant glioma cells to radiation treatment concurrent with the down-regulation of the protein Bcl-2 (B cell lymphoma/lewkmia-2). It indicates that miR-181a may modulate radiosensitivity by targeting Bcl-2 in human malignant glioma cells. These data suggest that radiation can affect miRNA expression, which regulates the cellular response, and miR-181a could be a target for enhancing the effect of radiation treatment on malignant glioma cells.
LinkOut: [PMID: 20204284]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: BCL2    [ Functional MTI ]
Validation Method Immunoblot , Luciferase reporter assay , qRT-PCR , Western blot
Conditions BOSC23
Location of target site 3'UTR
Original Description (Extracted from the article) ... In summary, Bcl-2, Mcl-1, and Bim are targets of mouse miR-181.Protein levels of Bcl-2 and Mcl-1 change inversely with changes in miR-181a. Reduction of miR-181a levels is associated with reduced cell death, reduced oxidative stress, and preserved mitochondrial function in astrocytes. ...

- Ouyang, Y. B. Lu, Y. Yue, S. Giffard, R. G., 2012, Mitochondrion.

Article - Ouyang, Y. B. Lu, Y. Yue, S. Giffard, R. G.
- Mitochondrion, 2012
Mitochondria are central to the execution of apoptosis, and the Bcl-2 protein family of pro- and anti-apoptotic proteins interacts with mitochondria to regulate apoptosis. Using bioinformatics we predicted that miR-181, a microRNA expressed in brain, could target the 3'UTRs of Bcl-2 family members Bcl-2-L11/Bim, Mcl-1, and Bcl-2. Using the luciferase reporter assay we confirmed these targets. We used mimic and inhibitor to alter miR-181a levels in primary astrocyte cultures and found miR-181a reduction was associated with increased Bcl-2 and Mcl-1 protein levels. Decreased miR-181a levels reduced glucose deprivation induced apoptosis, mitochondrial dysfunction, and loss of mitochondrial membrane potential in astrocytes.
LinkOut: [PMID: 21958558]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions HL-60 , HEK293T
Disease Acute myeloid leukaemia
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Bcl-2 was con W rmed as a direct miR-181a target by immunoblot analysis and reporter gene assays. ...

- Bai, H. Cao, Z. Deng, C. Zhou, L. Wang, C., 2012, J Cancer Res Clin Oncol.

Article - Bai, H. Cao, Z. Deng, C. Zhou, L. Wang, C.
- J Cancer Res Clin Oncol, 2012
BACKGROUND: Ara-C is one of the most commonly used drugs in the treatment of AML. However, the development of drug resistance always prevented its further use. It has been shown that miR-181a is associated with the clinical outcome of AML patients. Here, we investigated the possible role of miR-181a in AML Ara-C resistance. METHODS: miR-181a expression was measured by real-time PCR. Cell viability was detected by MTT assay. Protein expressions were measured by western blotting. Caspase activity was examined by fluorescence assay. RESULTS: We found that miR-181a expression was downregulated in the Ara-C-resistant cell line HL-60/Ara-C compared with its parental cell line HL-60. Overexpression of miR-181a in HL-60/Ara-C cells sensitized the cells to Ara-C treatment. Furthermore, Bcl-2 was confirmed as a direct miR-181a target by immunoblot analysis and reporter gene assays. Knockdown of Bcl-2 mimicked the effect of enforced miR-181a expression by reducing cell viability. In addition, the apoptosis pathway was activated by cytochrome C release and caspase 9/caspase 3 activation after miR-181a overexpression. CONCLUSIONS: This study for the first time demonstrated that downregulation of miR-181a and upregulation of Bcl-2 in leukaemia cells confer resistance to Ara-C-based therapy. These results suggest that restoration of miR-181a expression might provide a promising therapeutic in drug resistance of leukaemia.
LinkOut: [PMID: 22209977]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions K562 , K562/A02
Disease leukemia
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... BCL-2 is a direct target gene of miR-181a ...

- Li, H. Hui, L. Xu, W., 2012, Acta Biochim Biophys Sin (Shanghai).

Article - Li, H. Hui, L. Xu, W.
- Acta Biochim Biophys Sin (Shanghai), 2012
The aim of this study was to investigate whether miR-181a could modulate the sensitivity of the leukemia drug-resistant cell line K562/A02 to the chemotherapeutic agent daunorubicin (DNR), and explore the mechanism of miR-181a on the DNR sensitivity of K562/A02 cells. MicroRNA microarray and stem-loop reverse transcription-polymerase chain reaction were used to detect the expression of miR-181a. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide assay was performed to quantify the effect of miR-181a on K562 cells growth and viability. Apoptotic cells were quantitatively detected using Annexin V/FITC and PI apoptosis detection kit. BCL-2 protein expression was measured by western blot. Luciferase reporter vector with the putative BCL-2 3' untranslated region was constructed to explore whether BCL-2 was a direct target gene of miR-181a. BCL-2 siRNA was transfected into the cell to explore the relationship between BCL-2 and DNR resistance. The miR-181a expression level was lower in the K562/A02 cells than in the K562 cells (P< 0.05). K562 cells that were transfected with miR-181a inhibitor had a significantly higher survival than K562 cells, and K562/A02 cells that were transfected with the miR-181a mimic had a significantly lower survival than K562/A02 cells (P< 0.05). miR-181a could enhance DNR-induced apoptosis in K562/A02 cells. BCL-2 siRNA transfected K562/A02 cells had decreased survival compared with the K562/A02 control group. In conclusion, miR-181a could play a role in the development of DNR resistance in K562/A02 cells and the over-expression of miR-181a could sensitize K562/A02 cells to DNR by targeting BCL-2.
LinkOut: [PMID: 22285729]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions SGC7901/VCR , A549/CDDP
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... MiR-181 acts directly at the BCL-2/MCL-1/XIAP-3´UTR ...

- Zhu, D. X. Zhu, W. Fang, C. Fan, L. Zou, Z. et al., 2012, Carcinogenesis.

Article - Zhu, D. X. Zhu, W. Fang, C. Fan, L. Zou, Z. et al.
- Carcinogenesis, 2012
MicroRNAs (miRNAs) have been shown to play critical roles in regulating the progress of leukemia. We performed miRNA expression profile in six Chinese patients with chronic lymphocytic leukemia (CLL), and in peripheral B cells from pooled 30 healthy donors, using a platform containing 866 human miRNAs. The most frequent changes in miRNAs in CLL cells included downregulation of miR-126, miR-572, miR-494, miR-923, miR-638, miR-130a, miR-181a and miR-181b and up-regulation of miR-29a, miR-660, miR-20a, miR-106b, miR-142-5p, miR-101, miR-30b, miR-34a, miR-let-7f, miR-21 and miR-155. Among the miRNAs down-regulated in CLL cells, we showed that miR-181a/b expression levels were significantly lower in poor prognostic subgroups defined by unmutated immunoglobulin heavy chain variable status and p53 aberrations. Furthermore, under-expression of miR-181a and miR-181b was associated with shorter overall survival and treatment-free survival in CLL patients. We further evaluated fludarabine-induced apoptosis after transfection of primary CLL cells from 40 patients with miR-15a, miR-16-1, miR-34a, miR-181a and miR-181b mimics. Transfection of miR-34a, miR-181a and miR-181b mimics into CLL cells from p53 wild-type patients led to significant increase in apoptosis compared with miRNA control. However, enforced expression of these miRNAs had no effect on B-CLL cells from p53-attenuated patients. We further demonstrated that miR-181a and miR-181b inhibiting BCL-2, MCL-1 and X-linked inhibitor of apoptosis protein by direct binding to 3'UTR. Thus, these results suggest that miR-181a/b may play important roles in the pathogenesis of CLL and may provide a possible therapeutic avenue and a sensitive indicator of the activity of the p53 axis in CLL.
LinkOut: [PMID: 22610076]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
241 hsa-miR-181a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000242 BDNF brain-derived neurotrophic factor 1 1
MIRT000243 NLK nemo-like kinase 2 1
MIRT000244 GATA6 GATA binding protein 6 3 2
MIRT000245 CDX2 caudal type homeobox 2 2 1
MIRT000698 PLAG1 pleiomorphic adenoma gene 1 4 1
MIRT002870 HOXA11 homeobox A11 1 1
MIRT003501 BCL2 B-cell CLL/lymphoma 2 4 6
MIRT003630 PROX1 prospero homeobox 1 4 1
MIRT004327 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT004554 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 5 2
MIRT005544 ZNF763 zinc finger protein 763 4 1
MIRT005575 DDIT4 DNA-damage-inducible transcript 4 3 1
MIRT005576 ATM ataxia telangiectasia mutated 3 1
MIRT005577 HIPK2 homeodomain interacting protein kinase 2 3 1
MIRT005767 BCL2L11 BCL2-like 11 (apoptosis facilitator) 3 1
MIRT005880 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 1
MIRT006166 RNF2 ring finger protein 2 4 1
MIRT006194 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 4 1
MIRT006213 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 2 2
MIRT006395 PRAP1 proline-rich acidic protein 1 1 1
MIRT006481 DUSP6 dual specificity phosphatase 6 2 1
MIRT006482 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 1
MIRT006483 DUSP5 dual specificity phosphatase 5 2 1
MIRT006484 PTPN22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) 2 1
MIRT006851 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT006871 MTMR3 myotubularin related protein 3 1 1
MIRT006939 KLF6 Kruppel-like factor 6 3 1
MIRT006949 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT006950 XIAP X-linked inhibitor of apoptosis 1 1
MIRT007058 GPR78 G protein-coupled receptor 78 1 1
MIRT025038 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT025039 LRRC17 leucine rich repeat containing 17 1 1
MIRT025040 CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 1 1
MIRT025041 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT025042 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 1 1
MIRT025043 FXYD6 FXYD domain containing ion transport regulator 6 1 1
MIRT025044 KCTD3 potassium channel tetramerisation domain containing 3 1 1
MIRT025045 TSHR thyroid stimulating hormone receptor 1 1
MIRT025046 ZNF558 zinc finger protein 558 1 1
MIRT025047 C8A complement component 8, alpha polypeptide 1 1
MIRT025048 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT025049 ZNF426 zinc finger protein 426 1 1
MIRT025050 ESR1 estrogen receptor 1 1 1
MIRT025051 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT025052 PRR4 proline rich 4 (lacrimal) 1 1
MIRT025053 TCF21 transcription factor 21 1 1
MIRT025054 PHOX2A paired-like homeobox 2a 1 1
MIRT025055 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT025056 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT025057 GSTM2 glutathione S-transferase mu 2 (muscle) 1 1
MIRT025058 FSIP1 fibrous sheath interacting protein 1 1 1
MIRT025059 KBTBD3 kelch repeat and BTB (POZ) domain containing 3 1 1
MIRT025060 PTPRZ1 protein tyrosine phosphatase, receptor-type, Z polypeptide 1 1 1
MIRT025061 WNT3A wingless-type MMTV integration site family, member 3A 1 1
MIRT025062 TUSC1 tumor suppressor candidate 1 1 1
MIRT025063 LRRN3 leucine rich repeat neuronal 3 1 1
MIRT025064 TMEM45A transmembrane protein 45A 1 1
MIRT025065 ARF6 ADP-ribosylation factor 6 1 1
MIRT025066 C1orf109 chromosome 1 open reading frame 109 1 1
MIRT025067 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT025068 PLXDC2 plexin domain containing 2 1 1
MIRT025069 NMRK2 integrin beta 1 binding protein 3 1 1
MIRT025070 WNT2 wingless-type MMTV integration site family member 2 1 1
MIRT025071 ATG10 ATG10 autophagy related 10 homolog (S. cerevisiae) 1 1
MIRT025072 PRDX3 peroxiredoxin 3 1 1
MIRT025073 ZNF652 zinc finger protein 652 1 1
MIRT025075 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 1 1
MIRT025076 PCDHB8 protocadherin beta 8 1 1
MIRT025077 ENAH enabled homolog (Drosophila) 1 1
MIRT025078 ZNF25 zinc finger protein 25 1 1
MIRT025079 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT025080 S100A1 S100 calcium binding protein A1 1 1
MIRT025081 PLA2G4C phospholipase A2, group IVC (cytosolic, calcium-independent) 1 1
MIRT025082 NOL4 nucleolar protein 4 1 1
MIRT025083 SIX6 SIX homeobox 6 1 1
MIRT025084 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT025085 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT025086 OR11A1 olfactory receptor, family 11, subfamily A, member 1 1 1
MIRT025087 INCENP inner centromere protein antigens 135/155kDa 1 1
MIRT025088 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT025089 CLUAP1 clusterin associated protein 1 1 1
MIRT025090 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT025091 CCDC6 coiled-coil domain containing 6 1 1
MIRT025092 BAG2 BCL2-associated athanogene 2 1 1
MIRT025093 GPR83 G protein-coupled receptor 83 1 1
MIRT025094 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT025095 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT025096 RLF rearranged L-myc fusion 1 1
MIRT025097 FBXO28 F-box protein 28 1 1
MIRT025098 ZNF350 zinc finger protein 350 1 1
MIRT025099 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT025100 RNF34 ring finger protein 34 1 1
MIRT025101 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT025102 KIAA1462 KIAA1462 1 1
MIRT025103 ZNF35 zinc finger protein 35 1 1
MIRT025104 PITPNB phosphatidylinositol transfer protein, beta 1 1
MIRT025105 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT025106 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT025107 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT025108 LGALSL galectin-related protein 1 1
MIRT025109 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT025110 MOB1A MOB1, Mps One Binder kinase activator-like 1B (yeast) 1 1
MIRT025111 SLC35B4 solute carrier family 35, member B4 1 1
MIRT025112 FAM160A2 family with sequence similarity 160, member A2 1 1
MIRT025113 NUPL1 nucleoporin like 1 1 1
MIRT025114 GPRIN3 GPRIN family member 3 1 1
MIRT025115 H1F0 H1 histone family, member 0 1 1
MIRT025116 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT025117 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT025118 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT025119 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT025120 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT025121 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT025122 TRIM2 tripartite motif-containing 2 1 1
MIRT025123 FBXO33 F-box protein 33 1 1
MIRT025124 NRP1 neuropilin 1 2 2
MIRT025125 FAM47B family with sequence similarity 47, member B 1 1
MIRT025126 CCNG1 cyclin G1 1 1
MIRT025127 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT025128 OTUD1 OTU domain containing 1 1 1
MIRT025129 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT025130 WNT16 wingless-type MMTV integration site family, member 16 1 1
MIRT025131 CST5 cystatin D 1 1
MIRT025132 SH3BGRL SH3 domain binding glutamic acid-rich protein like 1 1
MIRT025133 GPR137B G protein-coupled receptor 137B 1 1
MIRT025134 OFCC1 orofacial cleft 1 candidate 1 1 1
MIRT025135 IQCG IQ motif containing G 1 1
MIRT025136 NKX3-2 NK3 homeobox 2 1 1
MIRT025137 OTX2 orthodenticle homeobox 2 1 1
MIRT025138 ROPN1L ropporin 1-like 1 1
MIRT025139 TMEM14A transmembrane protein 14A 1 1
MIRT025140 TAF2 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa 1 1
MIRT025141 IDS iduronate 2-sulfatase 1 1
MIRT025142 FRA10AC1 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 1 1
MIRT025143 COL27A1 collagen, type XXVII, alpha 1 1 1
MIRT025144 EPHA5 EPH receptor A5 1 1
MIRT025145 DCST1 DC-STAMP domain containing 1 1 1
MIRT025146 ZNF562 zinc finger protein 562 1 1
MIRT025147 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT025148 CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) 1 1
MIRT025149 TAAR6 trace amine associated receptor 6 1 1
MIRT025150 SLCO2A1 solute carrier organic anion transporter family, member 2A1 1 1
MIRT025151 TMEM257 chromosome X open reading frame 1 1 1
MIRT025152 HMGB2 high-mobility group box 2 1 1
MIRT025153 HERC3 hect domain and RLD 3 1 1
MIRT025154 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT025155 SRPK2 SFRS protein kinase 2 1 1
MIRT025156 DNAJC7 DnaJ (Hsp40) homolog, subfamily C, member 7 1 1
MIRT025157 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1 1
MIRT025158 CFI complement factor I 1 1
MIRT025159 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT025160 HEY2 hairy/enhancer-of-split related with YRPW motif 2 1 1
MIRT025161 MTMR12 myotubularin related protein 12 1 1
MIRT025162 ACOT12 acyl-CoA thioesterase 12 1 1
MIRT025163 KIAA0101 KIAA0101 1 1
MIRT025164 USP28 ubiquitin specific peptidase 28 1 1
MIRT025165 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT025166 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT025167 DSCR8 Down syndrome critical region gene 8 1 1
MIRT025168 UGT3A1 UDP glycosyltransferase 3 family, polypeptide A1 1 1
MIRT025169 HSD17B3 hydroxysteroid (17-beta) dehydrogenase 3 1 1
MIRT025170 GADD45G growth arrest and DNA-damage-inducible, gamma 1 1
MIRT025171 FBXO34 F-box protein 34 1 1
MIRT025172 C1QTNF9 C1q and tumor necrosis factor related protein 9 1 1
MIRT025173 KLRC4 killer cell lectin-like receptor subfamily C, member 4 1 1
MIRT025174 MOB3B MOB1, Mps One Binder kinase activator-like 2B (yeast) 1 1
MIRT025175 FKBP7 FK506 binding protein 7 1 1
MIRT025176 TBX4 T-box 4 1 1
MIRT025177 TMPRSS11A transmembrane protease, serine 11A 1 1
MIRT025178 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT025179 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT025180 NUDT12 nudix (nucleoside diphosphate linked moiety X)-type motif 12 1 1
MIRT025181 COPS2 COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) 1 1
MIRT025182 ZNF12 zinc finger protein 12 1 1
MIRT025183 PRLR prolactin receptor 1 1
MIRT025184 PLCL2 phospholipase C-like 2 1 1
MIRT025185 ZNF594 zinc finger protein 594 1 1
MIRT025186 METAP1 methionyl aminopeptidase 1 1 1
MIRT025187 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT025188 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT025189 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT025190 SLC37A3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1 1
MIRT025191 FBXO11 F-box protein 11 1 1
MIRT025192 ZNF445 zinc finger protein 445 1 1
MIRT025193 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT025194 ATP8A1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1 1
MIRT025195 TMEM64 transmembrane protein 64 1 1
MIRT025196 MOB1B MOB1, Mps One Binder kinase activator-like 1A (yeast) 1 1
MIRT025197 GNAI3 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 1 1
MIRT025198 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT025199 SRSF7 splicing factor, arginine/serine-rich 7, 35kDa 1 1
MIRT025200 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT025201 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT025202 LBR lamin B receptor 1 1
MIRT025203 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT025204 KLHL42 kelch domain containing 5 1 1
MIRT025205 TMEM132B transmembrane protein 132B 1 1
MIRT025206 AFTPH aftiphilin 1 1
MIRT025207 ZNF148 zinc finger protein 148 1 1
MIRT025208 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT025209 NFYB nuclear transcription factor Y, beta 1 1
MIRT035538 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 2 1
MIRT047302 SIK2 salt-inducible kinase 2 1 1
MIRT047303 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT047304 FAM222B chromosome 17 open reading frame 63 1 1
MIRT047305 RPS8 ribosomal protein S8 1 1
MIRT047306 STAG2 stromal antigen 2 1 1
MIRT047307 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT047308 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT047309 ZEB2 zinc finger E-box binding homeobox 2 1 1
MIRT047310 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT047311 RPL14 ribosomal protein L14 1 1
MIRT047312 KCTD2 potassium channel tetramerisation domain containing 2 1 1
MIRT047313 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT047314 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 1 1
MIRT047315 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 1 1
MIRT047316 HDAC6 histone deacetylase 6 1 1
MIRT047317 TMEM192 transmembrane protein 192 1 1
MIRT047318 LAMA3 laminin, alpha 3 1 1
MIRT047319 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT047320 ND2 MTND2 1 1
MIRT047321 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT047322 OCA2 oculocutaneous albinism II 1 1
MIRT047323 AP1M1 adaptor-related protein complex 1, mu 1 subunit 1 1
MIRT047324 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 1 1
MIRT047325 PGD phosphogluconate dehydrogenase 1 1
MIRT047326 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT047327 AKAP12 A kinase (PRKA) anchor protein 12 1 1
MIRT047328 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT047329 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047330 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT047331 H2AFY H2A histone family, member Y 1 1
MIRT047332 TEAD4 TEA domain family member 4 1 1
MIRT047333 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT047334 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT047335 BRCA1 breast cancer 1, early onset 1 1
MIRT047336 SOGA2 KIAA0802 1 1
MIRT047337 KIAA0100 KIAA0100 1 1
MIRT047338 PPP1R9A protein phosphatase 1, regulatory (inhibitor) subunit 9A 1 1
MIRT047339 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 1
MIRT047340 TNIP1 TNFAIP3 interacting protein 1 1 1