Accession ID: MIRT003549 [miRNA, hsa-miR-489-3p :: PTPN11, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-489LinkOut: [miRBase ]
Synonyms MIRN489, hsa-mir-489, MIR489
Description Homo sapiens miR-489 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-489-3p
Mature Sequence 52| GUGACAUCACAUAUACGGCAGC |73
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-489-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PTPN11 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BPTP3, CFC, MGC14433, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2
Description protein tyrosine phosphatase, non-receptor type 11
Transcript NM_0028    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PTPN11 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PTPN11
(miRNA target sites are highlighted)
>PTPN11|NM_0028|3'UTR
   1 TGAGAAAACCTGCCAAAACTTCAGCACAGAAATAGATGTGGACTTTCACCCTCTCCCTAAAAAGATCAAGAACAGACGCA
  81 AGAAAGTTTATGTGAAGACAGAATTTGGATTTGGAAGGCTTGCAATGTGGTTGACTACCTTTTGATAAGCAAAATTTGAA
 161 ACCATTTAAAGACCACTGTATTTTAACTCAACAATACCTGCTTCCCAATTACTCATTTCCTCAGATAAGAAGAAATCATC
 241 TCTACAATGTAGACAACATTATATTTTATAGAATTTGTTTGAAATTGAGGAAGCAGTTAAATTGTGCGCTGTATTTTGCA
 321 GATTATGGGGATTCAAATTCTAGTAATAGGCTTTTTTATTTTTATTTTTATACCCTTAACCAGTTTAATTTTTTTTTTCC
 401 TCATTGTTGGGGATGATGAGAAGAAATGATTTGGGAAAATTAAGTAACAACGACCTAGAAAAGTGAGAACAATCTCATTT
 481 ACCATCATGTATCCAGTAGTGGATAATTCATTTTGATGGCTTCTATTTTTGGCCAAATGAGAATTAAGCCAGTGCCTGAG
 561 ACTGTCAGAAGTTGACCTTTGCACTGGCATTAAAGAGTCATAGAAAAAGAATCATGGATATTTATGAATTAAGGTAAGAG
 641 GTGTGGCTTTTTTTTTTTTCTTTTTTCCAGCCGTTGACCAATTATAGTTCGGCTGTTGACTGAGAAGTTTGTGGTGGGAA
 721 AACGTTTGCCATATTTTCTTTGCATTTGAATAATTGTCTTGTACTTAGAAAAAAGGCGTCTATGAATGACCAGTGTTTTT
 801 GGTCGCCAAATGTTGCTGACAAACTTATCCCAAAACTTTAGTGGCTTAAAAAAACCTGCCCCCAACTGTTAGTCAATCTG
 881 AGCTGGGCTCAGCTGGGCTGTTCTTCTGCCAGCCTGCAGGTGGCCACTCATGTGGTCAGCAGGTCGGCGGAGAGACTGGG
 961 ATGGCTGGGCTTCTCTCTCTGCCTGCAGTCCTGAGTCTCTCCTTCTTCGTGTAGTCTCTTTCAGTGGCCTGGCTGGCAGG
1041 GTAGCTAGACCTCTCACATGCAGCTCAGAGCTCCCAAGAGCTCAAAAGCAGAAATGGCCAGGCCTTCTGAAAACTTAAGT
1121 CCAGAATTGTCACAGTGTCCCTTCTACTTCCCTCTATTGATGATGATGATGATGATGATGATGATGATGATGATGATGAT
1201 GATGGTTTTTTCTAATCAGAAGAAAGCTGGGGTATGCCCTCTACTTACTAAACAAGTCACAAGCCCAGCTCAGATTCAAG
1281 AAAAGGGTGTGAAGTAGAGGTGCAGTTAAGTGGGGGGCCACTAGTCTAACAGACGGTCACAACCAGTGCCATGGAAAACC
1361 AAGGATATTAGCAAAAGCAGAAGTTGCTAGTGACCTTGGGAAGCCGAAGCTGCTTACAGTAGCTGGGACAAGCTGAAAGT
1441 CAGACTAAGAAATAAAGAGAGGGCCTTCAAGAAGCTTCCTGAATGATTTCTGCTAGCCCTGAGCCTATTTTTGGAACCAG
1521 CACTTGGGGAAACTGATCTTGTGAGGATGGATGTGTTTAGGGACACAGGGCTTTTGAGAGCAGCACCACCCCACTGGGGC
1601 ATCCCCAGACTTGGGAAACGTGACTCTTTCTTAATGCCACTGGGTTTTAGTCAGGCCACAGTGAGAAGGAACAGCCCTAA
1681 CAGGCCTCCAGCCAGGTTGAATGAGCTCATTTTTGTTGTAGCCAACCAGTAAGATTTGCTAATGTTCTACATTAAGTGCC
1761 TTCTCCAAAGACATCCCTCTTTGCCTCATATGTTGAATCATCCAGTGCGGATATTTCAATGAAAATATCATTGGTTGACT
1841 TTTGTGATGGTAATAATGCTATGGCATCTTTGCCATGAAGTTGTGGCCTCCTTGGATTCTTCTGACTTTGGCTTCTGAAA
1921 GGAAGGCCTAGATCCAGCCCTGGTGGTAGTTCCTTTCTGAGGTCTCTCAGTCCCTTGAGACTTTGGGGTAGTTTGGCTGC
2001 CATTCTCACTGACAAAATGTATATCAGCCCCCACCTCCACCCCCCAATATTCCTTGAACTTTGAATTGCTTCAGAACACA
2081 GGTGTGGCCTGAAGGTATTCCCTTATTAGGGAAGTGTCACTGCTGTCTTCTAGTCAAACTTGTAAAGAAAAAGATTCCAG
2161 TTCAGTATTTGCAGCAAGAAGCTTGAATGCTGTTCTTTTTATCGCATTGTTACATCGACTCATTCTCCATTTTGCTTTGG
2241 TTTTGTCTTGACTTGACTTGACTTTGGGGGTAAAGTCTTTCACCAGCACACAAGAGTTTGATTGTACAAATATATCTTCT
2321 GCATTAACATCTCTGCCTGTTGCTTAAGATCAGTTGCTTTTATACTCAGAATGGAAATACCTGATCTTGGCTAGTTTTGT
2401 TATAAGATATTGATTTCATTTAGATTTCCCTCCACGAGGTCAGCAAACTATCATGTTCTTATGTAAACTTAGGCCAAGGC
2481 CAGAGTTATCATAGTCCCTAGGTTGCTACGGCTTATCATGTGCTTGGTAAAAGGTGATCGCAGGTTCTCAGACGAGTTTA
2561 CTTTACATGAGATGGAATCAGGCAGAGAGGCTGGGATGATGGAGAAAGCTCGAGGTGAAGTTTTAAAAAAAAAGTTGTGG
2641 AAAGGAAAGTTCCAAAGAGGTGGTTTCTGAGGAAGTCAGAGCGCCCAGGGCCAGAGCAGTCAGTAATGGGTGAATGAGGT
2721 TGTTTGGAAAGTCGGTGTGACAGACACATGGATGCCATCTACTTCTAGGTTGCTGGTGGGTATTAAATATGCACAATATT
2801 CCATAGCTCACTGAGGATTTTAAAATTATAAGCATAGGATTTTATATTTTGGGGTGAAAGAATTATCTGGCACATTAGGT
2881 ATTGGAGTTTAAAAAAAAAGCCAAATTTCACAGTCTTAATAACTTTTTTTAAAAAAAACTAAAAGGCGCTTCATGTCCAG
2961 TGTGTGGCCCTTCTGAAACTTATGGTCATCTCTCCCACTGAAACCAAGGTCTTTTCAAATGTGGCTAAATGGGGATGAGG
3041 AGACACGGGTAGGACTTTCTTGGTGTGTGTGCATTCTTTAAAGAGCCAAGTTGCTTCGGGGAAACAGCCAGGAAAATGGT
3121 CAAGATTATTTTTAGAGGTTATTTTATTGGGGATTTTAAGAACTAATAACATCTTGAGTTATTTTTAATTCAGGGGGATG
3201 TGGAAAGGTTTGCAATTGTCAAGTGTTTTGTTGTAGCTTAGTATCCATAAGGGAAACTTAGACTATAGACATAACTACAA
3281 AGCCAGTGCAGCTTTTGTTTTCTGTATGTTGTTGGGGGATCAACTTTCACACATAGCAAGCACATGGCCTCCCTGATGTC
3361 AGGATGCCTTTGTTAGGATCTGTATTTGCCCTTAATTTTGTTGAAATCTTTTTTCCTTCTTCCTCTTGAAAAGTTCCAAA
3441 ATATAGTTTATTGTATCTTTCATCACTAAAAATTTGTTCCTTTTTCACTATGGGCAGTTCACACAAGGCAAAAACTATTG
3521 AACAGTTGGTTTTAGTGTGTTGTATAACTTTGCTGTATATCAAACTAATTTTGACAAGTTTTCATCCTAAGCCTCAAATC
3601 ATGTAATTAATAATTTGCCTGTTTATTTATGACCTAATTGTGATTCTTTTATTAATAAAAGCTAATGGGAAAAGGATCCC
3681 TGATTAAGCTGATGACTAGACCTACAATTAATTTTCCTGCAGTATATGAAGTATTGTACCAGAGTATTAAAAGATATGTA
3761 ATATTTTATTGATAAATCTATCCTTTAAAAGGAATACGTTTTAGGATGTCATCATTTTGATGTGAATCATGTAAATGTTG
3841 ATAATATGCTGTTTATTATACATTTAGTGTTTCAAGAGATTCACTTAATTGCCTTTTTGCCCACGTATATTATGTAGTCT
3921 ATTTGCAACTGTTCTTAAAAAAATGACATTAAAAGAATAGTTTATGTAGAGAAACATTAGTGGATGTTAATTGTCTCCCC
4001 ACCTATATTTATGGGTGTTAGCGCAACTGCTTTGCTAGTTGCAAAGCTGTATTATCAGAGTAAAAGTGTATTTGTAAACT
4081 GTATGGGAACTAAAAATTAGGAATAAAACCATTTTCTTATATGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgacgGCAUAUACACUACAGUg 5'
               ||| | |  ||||||| 
Target 5' gaataCGT-TTTAGGATGTCAt 3'
3792 - 3812 148.00 -12.60
2
miRNA  3' cgacggcauauacACUACAGUg 5'
                       |||||||| 
Target 5' cacatggcctcccTGATGTCAg 3'
3341 - 3362 145.00 -11.20
3
miRNA  3' cgacggcaUAUACA-CUACAGUg 5'
                  ||  || |||||:| 
Target 5' agagaaacATTAGTGGATGTTAa 3'
3968 - 3990 130.00 -8.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-489-3p :: PTPN11    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot ,
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miR-489 negatively regulates PTPN11 expression.//This study is to identify tumour-suppressive miRNAs based on clinical HSCC miRNA expression signature. We have specifically identified a tumour-suppressive miRNA (miR-489) and found its direct target (PTPN11). Disruption of this interaction may lead to the deregulation of miR-489-PTPN11 signalling in HSCC.//Luminescence intensity was significantly decreased for the vectors carrying the 3'UTR and the deletion at position 3353a3359, but not in the vector with the deletion at position 3803a3809 (Figure 3), indicating that the region between positions 3803a3809 contains the miR-489 target site. ...

- Kikkawa, N. Hanazawa, T. Fujimura, L. et al., 2010, Br J Cancer.

Article - Kikkawa, N. Hanazawa, T. Fujimura, L. et al.
- Br J Cancer, 2010
Background:Hypopharyngeal squamous cell carcinoma (HSCC) is an aggressive malignancy with one of the worst prognoses among all head and neck cancers. Greater understanding of the pertinent molecular oncogenic pathways could help improve diagnosis, therapy, and prevention of this disease. The aim of this study was to identify tumour-suppressive microRNAs (miRNAs), based on miRNA expression signatures from clinical HSCC specimens, and to predict their biological target genes.Methods:Expression levels of 365 human mature miRNAs from 10 HSCC clinical samples were screened using stem-loop real-time quantitative PCR. Downregulated miRNAs were used in cell proliferation assays to identify a tumour-suppressive miRNA. Genome-wide gene expression analyses were then performed to identify the target genes of the tumour-suppressive miRNA.Results:Expression analysis identified 11 upregulated and 31 downregulated miRNAs. Gain-of-function analysis of the downregulated miRNAs revealed that miR-489 inhibited cell growth in all head and neck cancer cell lines examined. The gene PTPN11 coding for a cytoplasmic protein tyrosine phosphatase containing two Src Homology 2 domains was identified as a miR-489-targeted gene. Knockdown of PTPN11 resulted in the inhibition of cell proliferation in head and neck SCC cells.Conclusion:Identification of the tumour-suppressive miRNA miR-489 and its target, PTPN11, might provide new insights into the underlying molecular mechanisms of HSCC.British Journal of Cancer advance online publication, 10 August 2010; doi:10.1038/sj.bjc.6605811 www.bjcancer.com.
LinkOut: [PMID: 20700123]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
3 hsa-miR-489-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003549 PTPN11 protein tyrosine phosphatase, non-receptor type 11 3 1
MIRT016614 PEX7 peroxisomal biogenesis factor 7 1 1
MIRT016615 GCA grancalcin, EF-hand calcium binding protein 1 1