Accession ID: MIRT003597 [miRNA, hsa-miR-135b-5p :: RUNX2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-135bLinkOut: [miRBase ]
Description Homo sapiens miR-135b stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-135b-5p
Mature Sequence 16| UAUGGCUUUUCAUUCCUAUGUGA |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-135b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-135b-5p :: RUNX2    [ Functional MTI ]
Validation Method qRT-PCR , Other
Conditions Unrestricted Somatic Stem Cells
Tools used in this research DIANA-microT , miRBase Target Database , PicTar , TargetScanS
Article - Schaap-Oziemlak, A. M. Raymakers, R. A. et al.
- Stem Cells Dev, 2010
Unrestricted somatic stem cells (USSCs) have been recently identified in human umbilical cord blood and have been shown to differentiate into lineages representing all 3 germ layers. To characterize microRNAs that may regulate osteogenic differentiation of USSCs, we carried out expression analysis for 157 microRNAs using quantitative RT-PCR before and after osteogenic induction (t = 0.5, 24, 72, 168, 216 h). Three microRNAs, hsa-miR-135b, hsa-miR-224, and hsa-miR-31, were consistently down-regulated during osteogenesis of USSC line 1. Hsa-miR-135b was shown to be the most profoundly down-regulated in osteogenesis of USSC line 1 and further confirmed to be down-regulated in the osteogenic differentiation of 2 additional USSC lines. Function of hsa-miR-135b in osteogenesis of USSCs was examined by retroviral overexpression, which resulted in an evident decreased mineralization, indicating that hsa-miR-135b down-regulation is functionally important for full osteogenic differentiation of USSCs. MicroRNAs have been shown to regulate negatively expression of their target gene(s). To identify putative targets of hsa-miR-135b, we performed cDNA microarray expression analysis. We selected in total 10 transcripts that were down-regulated (>or=2-fold) in response to hsa-miR-135b overexpression at day 7 and day 9 of osteogenic differentiation. The function of most of these targets in human osteogenesis is unknown and requires further investigation. Markedly, quantitative RT-PCR data showed decreased expression of osteogenic markers IBSP and Osterix, both known to be involved in bone mineralization, in osteogenesis of USSCs that overexpress hsa-miR-135b. This finding suggests that hsa-miR-135b may control osteoblastic differentiation of USSCs by regulating expression of bone-related genes.
LinkOut: [PMID: 19795981]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
70 hsa-miR-135b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001940 APC adenomatous polyposis coli 3 1
MIRT003594 IBSP integrin-binding sialoprotein 2 1
MIRT003596 BGLAP bone gamma-carboxyglutamate (gla) protein 2 1
MIRT003597 RUNX2 runt-related transcription factor 2 2 1
MIRT004567 SP7 Sp7 transcription factor 2 1
MIRT005440 KLF4 Kruppel-like factor 4 (gut) 4 1
MIRT005442 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 4 1
MIRT007298 CASR calcium-sensing receptor 2 2
MIRT053099 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 3 1
MIRT054461 SMAD5 SMAD family member 5 5 2
MIRT130101 TXNIP thioredoxin interacting protein 1 4
MIRT181058 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT289438 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT437778 LZTS1 leucine zipper, putative tumor suppressor 1 3 2
MIRT437876 MID1 midline 1 (Opitz/BBB syndrome) 2 1
MIRT437877 MTCH2 mitochondrial carrier 2 2 1
MIRT438735 ACVR1B activin A receptor, type IB 4 1
MIRT438736 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 4 1
MIRT438737 TGFBR1 transforming growth factor, beta receptor 1 4 1
MIRT445158 VNN3 vanin 3 1 1
MIRT445281 GAGE1 G antigen 1 1 1
MIRT447347 KIF6 kinesin family member 6 1 1
MIRT447761 TTLL7 tubulin tyrosine ligase-like family, member 7 1 1
MIRT448598 PCP4L1 Purkinje cell protein 4 like 1 1 1
MIRT449401 TOX4 TOX high mobility group box family member 4 1 1
MIRT449577 APOA1 apolipoprotein A-I 1 1
MIRT449682 CDR1 cerebellar degeneration-related protein 1, 34kDa 1 1
MIRT450056 IL17RA interleukin 17 receptor A 1 1
MIRT471858 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT497602 KIAA1958 KIAA1958 1 1
MIRT497850 GATA6 GATA binding protein 6 1 2
MIRT499107 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 3
MIRT500553 XBP1P1 X-box binding protein 1 pseudogene 1 1 4
MIRT503996 NHS Nance-Horan syndrome (congenital cataracts and dental anomalies) 1 1
MIRT511177 MARCKS myristoylated alanine-rich protein kinase C substrate 1 2
MIRT519597 ZNF805 zinc finger protein 805 1 1
MIRT529263 TRIM4 tripartite motif containing 4 1 2
MIRT537136 GNL1 guanine nucleotide binding protein-like 1 1 1
MIRT537982 DPP8 dipeptidyl-peptidase 8 1 1
MIRT544164 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT545420 SLC39A6 solute carrier family 39 (zinc transporter), member 6 1 1
MIRT549355 ARC activity-regulated cytoskeleton-associated protein 1 1
MIRT551664 KIAA1143 KIAA1143 1 2
MIRT562211 HMGB2 high mobility group box 2 1 1
MIRT562591 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT563733 ZNF107 zinc finger protein 107 1 2
MIRT570773 ZNF468 zinc finger protein 468 1 1
MIRT571500 ZNF846 zinc finger protein 846 1 1
MIRT613221 CCDC85C coiled-coil domain containing 85C 1 2
MIRT625939 SCYL3 SCY1-like 3 (S. cerevisiae) 1 1
MIRT636158 TNPO2 transportin 2 1 1
MIRT639988 PIAS4 protein inhibitor of activated STAT, 4 1 1
MIRT641254 CENPN centromere protein N 1 1
MIRT643451 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT654528 RAB3GAP2 RAB3 GTPase activating protein subunit 2 (non-catalytic) 1 1
MIRT656626 LRRC15 leucine rich repeat containing 15 1 1
MIRT674956 PEX2 peroxisomal biogenesis factor 2 1 1
MIRT681950 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682648 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT686790 AZF1 azoospermia factor 1 1 1
MIRT692903 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT695385 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT699504 SKIL SKI-like oncogene 1 1
MIRT702124 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT704724 CEP135 centrosomal protein 135kDa 1 1
MIRT711157 WDR82P1 WD repeat domain 82 pseudogene 1 1 1
MIRT711838 AMOTL2 angiomotin like 2 1 1
MIRT712663 PCTP phosphatidylcholine transfer protein 1 1
MIRT714430 SNED1 sushi, nidogen and EGF-like domains 1 1 1
MIRT718936 TRIM66 tripartite motif containing 66 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*