Accession ID: MIRT003597 [miRNA, hsa-miR-135b-5p :: RUNX2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-135bLinkOut: [miRBase ]
Description Homo sapiens miR-135b stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-135b-5p
Mature Sequence 16| UAUGGCUUUUCAUUCCUAUGUGA |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-135b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-135b-5p :: RUNX2    [ Functional MTI ]
Validation Method qRT-PCR , Other
Conditions Unrestricted Somatic Stem Cells
Tools used in this research DIANA-microT , miRBase Target Database , PicTar , TargetScanS
Article - Schaap-Oziemlak, A. M. Raymakers, R. A. et al.
- Stem Cells Dev, 2010
Unrestricted somatic stem cells (USSCs) have been recently identified in human umbilical cord blood and have been shown to differentiate into lineages representing all 3 germ layers. To characterize microRNAs that may regulate osteogenic differentiation of USSCs, we carried out expression analysis for 157 microRNAs using quantitative RT-PCR before and after osteogenic induction (t = 0.5, 24, 72, 168, 216 h). Three microRNAs, hsa-miR-135b, hsa-miR-224, and hsa-miR-31, were consistently down-regulated during osteogenesis of USSC line 1. Hsa-miR-135b was shown to be the most profoundly down-regulated in osteogenesis of USSC line 1 and further confirmed to be down-regulated in the osteogenic differentiation of 2 additional USSC lines. Function of hsa-miR-135b in osteogenesis of USSCs was examined by retroviral overexpression, which resulted in an evident decreased mineralization, indicating that hsa-miR-135b down-regulation is functionally important for full osteogenic differentiation of USSCs. MicroRNAs have been shown to regulate negatively expression of their target gene(s). To identify putative targets of hsa-miR-135b, we performed cDNA microarray expression analysis. We selected in total 10 transcripts that were down-regulated (>or=2-fold) in response to hsa-miR-135b overexpression at day 7 and day 9 of osteogenic differentiation. The function of most of these targets in human osteogenesis is unknown and requires further investigation. Markedly, quantitative RT-PCR data showed decreased expression of osteogenic markers IBSP and Osterix, both known to be involved in bone mineralization, in osteogenesis of USSCs that overexpress hsa-miR-135b. This finding suggests that hsa-miR-135b may control osteoblastic differentiation of USSCs by regulating expression of bone-related genes.
LinkOut: [PMID: 19795981]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
8 hsa-miR-135b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001940 APC adenomatous polyposis coli 3 1
MIRT003594 IBSP integrin-binding sialoprotein 2 1
MIRT003596 BGLAP bone gamma-carboxyglutamate (gla) protein 2 1
MIRT003597 RUNX2 runt-related transcription factor 2 2 1
MIRT004567 SP7 Sp7 transcription factor 2 1
MIRT005440 KLF4 Kruppel-like factor 4 (gut) 4 1
MIRT005442 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 4 1
MIRT007298 CASR calcium-sensing receptor 1 1