Accession ID: MIRT003659 [miRNA, hsa-miR-205-5p :: ERBB3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-205LinkOut: [miRBase ]
Description Homo sapiens miR-205 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-205-5p
Mature Sequence 34| UCCUUCAUUCCACCGGAGUCUG |55
Evidence Experimental
Experiments Cloned
Putative hsa-miR-205-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ERBB3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ErbB-3, HER3, LCCS2, MDA-BF-1, MGC88033, c-erbB-3, c-erbB3, erbB3-S, p180-ErbB3, p45-sErbB3, p85-sErbB3
Description v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
Transcript NM_0019    LinkOut: [ RefSeq ]
Other Transcripts NM_0010059   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ERBB3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ERBB3
(miRNA target sites are highlighted)
>ERBB3|NM_0019|3'UTR
   1 TAACTCCTGCTCCCTGTGGCACTCAGGGAGCATTTAATGGCAGCTAGTGCCTTTAGAGGGTACCGTCTTCTCCCTATTCC
  81 CTCTCTCTCCCAGGTCCCAGCCCCTTTTCCCCAGTCCCAGACAATTCCATTCAATCTTTGGAGGCTTTTAAACATTTTGA
 161 CACAAAATTCTTATGGTATGTAGCCAGCTGTGCACTTTCTTCTCTTTCCCAACCCCAGGAAAGGTTTTCCTTATTTTGTG
 241 TGCTTTCCCAGTCCCATTCCTCAGCTTCTTCACAGGCACTCCTGGAGATATGAAGGATTACTCTCCATATCCCTTCCTCT
 321 CAGGCTCTTGACTACTTGGAACTAGGCTCTTATGTGTGCCTTTGTTTCCCATCAGACTGTCAAGAAGAGGAAAGGGAGGA
 401 AACCTAGCAGAGGAAAGTGTAATTTTGGTTTATGACTCTTAACCCCCTAGAAAGACAGAAGCTTAAAATCTGTGAAGAAA
 481 GAGGTTAGGAGTAGATATTGATTACTATCATAATTCAGCACTTAACTATGAGCCAGGCATCATACTAAACTTCACCTACA
 561 TTATCTCACTTAGTCCTTTATCATCCTTAAAACAATTCTGTGACATACATATTATCTCATTTTACACAAAGGGAAGTCGG
 641 GCATGGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCTGAGGCAGAAGGATTACCTGAGGCAAGGAGTTTGAGACC
 721 AGCTTAGCCAACATAGTAAGACCCCCATCTCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAACTTTAGAACTGGGTGCAG
 801 TGGCTCATGCCTGTAATCCCAGCCAGCACTTTGGGAGGCTGAGATGGGAAGATCACTTGAGCCCAGAATTAGAGATAAGC
 881 CTATGGAAACATAGCAAGACACTGTCTCTACAGGGGAAAAAAAAAAAAGAAACTGAGCCTTAAAGAGATGAAATAAATTA
 961 AGCAGTAGATCCAGGATGCAAAATCCTCCCAATTCCTGTGCATGTGCTCTTATTGTAAGGTGCCAAGAAAAACTGATTTA
1041 AGTTACAGCCCTTGTTTAAGGGGCACTGTTTCTTGTTTTTGCACTGAATCAAGTCTAACCCCAACAGCCACATCCTCCTA
1121 TACCTAGACATCTCATCTCAGGAAGTGGTGGTGGGGGTAGTCAGAAGGAAAAATAACTGGACATCTTTGTGTAAACCATA
1201 ATCCACATGTGCCGTAAATGATCTTCACTCCTTATCCGAGGGCAAATTCACAAGGATCCCCAAGATCCACTTTTAGAAGC
1281 CATTCTCATCCA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-205-5p :: ERBB3    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other , Reporter assay;Other
Conditions 293T
Location of target site 3'UTR
Tools used in this research miRanda , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... ErbB3 and vascular endothelial growth factor A (VEGF-A) are direct targets for miR-205, and this miR-205-mediated suppression is likely through the direct interaction with the putative miR-205 binding site in the 3'-untranslated region (3'-UTR) of ErbB3 and VEGF-A. ...

- Wu, H. Zhu, S. Mo, Y. Y., 2009, Cell Res.

Article - Wu, H. Zhu, S. Mo, Y. Y.
- Cell Res, 2009
MicroRNAs (miRNAs) are endogenous, small, non-coding RNAs, which are capable of silencing gene expression at the post-transcriptional level. In this study, we report that miR-205 is significantly underexpressed in breast tumor compared to the matched normal breast tissue. Similarly, breast cancer cell lines, including MCF-7 and MDA-MB-231, express a lower level miR-205 than the non-malignant MCF-10A cells. Of interest, ectopic expression of miR-205 significantly inhibits cell proliferation and anchorage independent growth, as well as cell invasion. Furthermore, miR-205 was shown to suppress lung metastasis in an animal model. Finally, western blot combined with the luciferase reporter assays demonstrate that ErbB3 and vascular endothelial growth factor A (VEGF-A) are direct targets for miR-205, and this miR-205-mediated suppression is likely through the direct interaction with the putative miR-205 binding site in the 3'-untranslated region (3'-UTR) of ErbB3 and VEGF-A. Together, these results suggest that miR-205 is a tumor suppressor in breast cancer.
LinkOut: [PMID: 19238171]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-205-5p :: ERBB3    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions SKBr3 , MCF7 , HEK293
Disease breast cancer;
Location of target site 3'UTR
Tools used in this research mirGen
Original Description (Extracted from the article) ... miR-205 directly regulates HER3.//We first investigated the modulation of HER3 protein levels in SKBr3 and MCF7 breast cancer cells transfected with miR-205 precursor molecule or a scrambled oligonucleotide by Western blot. Over-expression of miR-205 (verified by Northern blot in Supplementary Fig. S3 and real-time PCR in Fig. 1A) decreased HER3 protein expression of f44% and 30% in SKBr3 and MCF7, respectively, as evaluated by densitometric analysis (Fig. 1B).//The reporter vector was cotransfected in HEK293 cells with miR-205 precursor molecule or a scrambled oligonucleotide as negative control, and the luciferase activity was markedly decreased (57% reduction) after miR-205 overexpression (P = 0.001; Fig. 1D). ...

- Iorio, M. V. Casalini, P. Piovan, C. Di et al., 2009, Cancer Res.

Article - Iorio, M. V. Casalini, P. Piovan, C. Di et al.
- Cancer Res, 2009
An increasing amount of experimental evidence shows that microRNAs can have a causal role in breast cancer tumorigenesis as a novel class of oncogenes or tumor suppressor genes, depending on the targets they regulate. HER2 overexpression is a hallmark of a particularly aggressive subset of breast tumors, and its activation is strictly dependent on the trans-interaction with other members of HER family; in particular, the activation of the PI3K/Akt survival pathway, so critically important in tumorigenesis, is predominantly driven through phosphorylation of the kinase-inactive member HER3. Here, we show that miR-205, down-modulated in breast tumors compared with normal breast tissue, directly targets HER3 receptor, and inhibits the activation of the downstream mediator Akt. The reintroduction of miR-205 in SKBr3 cells inhibits their clonogenic potential and increases the responsiveness to tyrosine-kinase inhibitors Gefitinib and Lapatinib, abrogating the HER3-mediated resistance and restoring a potent proapoptotic activity. Our data describe miR-205 as a new oncosuppressor gene in breast cancer, able to interfere with the proliferative pathway mediated by HER receptor family. Our study also provides experimental evidence suggesting that miR-205 can improve the responsiveness to specific anticancer therapies.
LinkOut: [PMID: 19276373]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-205-5p :: ERBB3    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HTR-8/SVneo cells
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... We found that MED1 was silenced 2-fold by miR-205. Likewise, FGFR1 and MAP2K1 were silenced 2-fold by miR-424.//In addition to these defined targets we found several other potential targets that were consistently but only mildly silenced by miRNAs. These include ERBB3, which was slightly inhibited by miR-205, as shown by others, and AP2M1 and DMN1, which were repressed by miR-224. ...

- Mouillet, J. F. Chu, T. Nelson, D. M. et al., 2010, FASEB J.

Article - Mouillet, J. F. Chu, T. Nelson, D. M. et al.
- FASEB J, 2010
Acting through degradation of target mRNA or inhibition of translation, microRNAs (miRNAs) regulate development, differentiation, and cellular response to diverse cues. We analyzed changes in miRNA expression in human placental trophoblasts exposed to hypoxia, which may result from hypoperfusion and placental injury. Using an miRNA microarray screen, confirmed by Northern blot analysis, we defined a set of seven miRNAs (miR-93, miR-205, miR-224, miR-335, miR-424, miR-451, and miR-491) that are differentially regulated in primary trophoblasts exposed to hypoxia. We combined in silico prediction of miRNA targets with gene expression profiling data to identify a series of potential targets for the miRNAs, which were further analyzed using luciferase reporter assays. Among experimentally confirmed targets, we found that the transcriptional coactivator MED1, which plays an important role in placental development, is a target for miR-205. Using gain- and loss-of-function assays, we confirmed that miR-205 interacts with a specific target in the 3;-UTR sequence of MED1 and silences MED1 expression in human trophoblasts exposed to hypoxia, suggesting that miR-205 plays a role in trophoblast injury.-Mouillet, J.-F., Chu, T., Nelson, D. M., Mishima, T., Sadovsky, Y. MiR-205 silences MED1 in hypoxic primary human trophoblasts.
LinkOut: [PMID: 20065103]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-205-5p :: ERBB3    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , Western blot
Conditions SKBB3 , Raf1 , A549
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... The importance of miRNAs not only as regulators but also as effectors of ErbB signalling is emphasized by miR-21, a key mediator of cancer cell growth and invasion whose expression is stimulated by EGFR/ErbB2. Studies are underway to modulate miRNA expression and activity in vivo with a view to developing therapeutics that can effectively block signalling pathways critical to tumour development and progression, although technical hurdles relating to delivery and tissue specificity are still to be overcome. As high-throughput miRNA profiling becomes feasible, a major goal is the identification of miRNA signatures that are predictive of treatment response, clinical outcome, or that can stratify tumour phenotypes. Should recent advances in understanding the basic science of miRNAs in cancer be translated to the clinic then there is the potential that they will transform cancer diagnosis and treatment. ...

- Barker, A. Giles, K. M. Epis, M. R. Zhang, et al., 2010, Curr Opin Pharmacol.

Article - Barker, A. Giles, K. M. Epis, M. R. Zhang, et al.
- Curr Opin Pharmacol, 2010
Recent years have seen a massive expansion in our understanding of the biology of microRNAs (miRNAs) in cancer, through the identification of miRNAs with aberrant expression in specific cancers and the functional validation of their critical target molecules and cellular effects. In parallel, targeted therapeutic agents to block signalling pathways critical to tumour growth and progression have been developed but have yielded disappointing clinical results. The discovery of miRNAs that regulate ErbB signalling in cancer cells brings new hope that in the future these oncogenic pathways can be more effectively inhibited to improve patient outcomes.
LinkOut: [PMID: 20864407]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
24 hsa-miR-205-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001163 LRP1 low density lipoprotein receptor-related protein 1 4 1
MIRT002478 ZEB1 zinc finger E-box binding homeobox 1 5 2
MIRT002479 SIP1 survival of motor neuron protein interacting protein 1 1 1
MIRT003236 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 2 1
MIRT003238 INPPL1 inositol polyphosphate phosphatase-like 1 3 2
MIRT003239 MED1 mediator complex subunit 1 3 1
MIRT003321 E2F5 E2F transcription factor 5, p130-binding 1 2
MIRT003322 E2F1 E2F transcription factor 1 3 3
MIRT003659 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 5 5
MIRT003666 ZEB2 zinc finger E-box binding homeobox 2 5 3
MIRT003667 PRKCE protein kinase C, epsilon 2 1
MIRT004518 VEGFA vascular endothelial growth factor A 2 2
MIRT004655 SIGMAR1 sigma non-opioid intracellular receptor 1 2 1
MIRT005563 IL24 interleukin 24 4 2
MIRT005564 IL32 interleukin 32 4 1
MIRT006784 EGLN2 egl nine homolog 2 (C. elegans) 4 1
MIRT006897 TP73 tumor protein p73 2 1
MIRT006935 CYR61 cysteine-rich, angiogenic inducer, 61 1 1
MIRT006936 CTGF connective tissue growth factor 1 1
MIRT006982 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT007075 LAMC1 laminin, gamma 1 (formerly LAMB2) 3 1
MIRT007191 LRRK2 leucine-rich repeat kinase 2 3 1
MIRT024970 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT024971 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 1 1