Accession ID: MIRT003661 [miRNA, hsa-miR-29b-3p :: DNMT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29b-1LinkOut: [miRBase ]
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Mature Sequence 51| UAGCACCAUUUGAAAUCAGUGUU |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DNMT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIM, CXXC9, DNMT, HSN1E, MCMT
Description DNA (cytosine-5-)-methyltransferase 1
Transcript NM_001130823    LinkOut: [ RefSeq ]
Other Transcripts NM_001379   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DNMT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DNMT1
(miRNA target sites are highlighted)
>DNMT1|NM_001130823|3'UTR
   1 GCCAAAGCCCGAGAGAGTGCCTCAGCTAAAATAAAGGAGGAGGAAGCTGCTAAGGACTAGTTCTGCCCTCCCGTCACCCC
  81 TGTTTCTGGCACCAGGAATCCCCAACATGCACTGATGTTGTGTTTTTAACATGTCAATCTGTCCGTTCACATGTGTGGTA
 161 CATGGTGTTTGTGGCCTTGGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAATGATTTAGTGATCAAATTGT
 241 GCAGTACTTTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTACCACTGTATGAGTGGAAATTA
 321 AGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTATAAACCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGUG-AC-UAAAGUUUACCACGAu 5'
            ||| || :|  :| ||||||:| 
Target 5' ttCACATGTGTGGTACATGGTGTTt 3'
146 - 170 141.00 -13.30
2
miRNA  3' uuGUGACUAA------AGUUUACCACGau 5'
            :| |||||      |||||| ||||  
Target 5' acTAATGATTTAGTGATCAAATTGTGCag 3'
216 - 244 123.00 -9.60
3
miRNA  3' uuGUGACUAAAGUUUACCACGAu 5'
            |||||||     :| |||:| 
Target 5' tgCACTGAT-----GTTGTGTTt 3'
108 - 125 112.00 -11.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: DNMT1    [ Functional MTI ]
Validation Method immunoblot , Luciferase reporter assay , qRT-PCR , Other
Conditions K562
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-29b downregulates DNMT1 indirectly by targeting Sp1, a transactivator of the DNMT1 gene ...

- Garzon, R. Liu, S. Fabbri, M. Liu, Z. et al., 2009, Blood.

Article - Garzon, R. Liu, S. Fabbri, M. Liu, Z. et al.
- Blood, 2009
Aberrant DNA hypermethylation contributes to myeloid leukemogenesis by silencing structurally normal genes involved in hematopoiesis. MicroRNAs (miRNAs) are noncoding RNAs that regulate gene expression by targeting protein-coding mRNAs. Recently, miRNAs have been shown to play a role as both targets and effectors in gene hypermethylation and silencing in malignant cells. In the current study, we showed that enforced expression of miR-29b in acute myeloid leukemia cells resulted in marked reduction of the expression of DNA methyltransferases DNMT1, DNMT3A, and DNMT3B at both RNA and protein levels. This in turn led to decrease in global DNA methylation and reexpression of p15(INK4b) and ESR1 via promoter DNA hypomethylation. Although down-regulation of DNMT3A and DNMT3B was the result of a direct interaction of miR-29b with the 3' untranslated regions of these genes, no predicted miR-29b interaction sites were found in the DNMT1 3' untranslated regions. Further experiments revealed that miR-29b down-regulates DNMT1 indirectly by targeting Sp1, a transactivator of the DNMT1 gene. Altogether, these data provide novel functional links between miRNAs and aberrant DNA hypermethylation in acute myeloid leukemia and suggest a potentially therapeutic use of synthetic miR-29b oligonucleotides as effective hypomethylating compounds.
LinkOut: [PMID: 19211935]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: DNMT1    [ Functional MTI ]
Validation Method
Article - Dai, F. Zhang, Y. Zhu, X. Shan, N. Chen, Y.
- Target Oncol, 2012
Ovarian cancer has a poor prognosis and advanced ovarian cancer lacks effective therapy. In this study, we seek to establish targeting therapy for ovarian cancer through tumor tissue-specific delivery of miRNA-29b to reexpress PTEN tumor-suppressor gene. A chimera (Chi-29b) was constructed to compose of a mucin 1 (MUC1) aptamer targeting tumor cell surface MUC1 protein and miR-29b inhibiting DNA methyltransferases' expression, subsequently reexpressing PTEN gene. The specificity and efficacy of the chimera delivery were analyzed in OVCAR-3 ovarian tumor cells, and the biological activities of the chimera were identified by the expression of its downstream molecules and cell apoptosis. We demonstrated that Chi-29b chimera can be specifically delivered into OVCAR-3 cells in a concentration-dependent manner. Dicer efficiently cleaved the Chi-29b chimera to release miR-29b. Chi-29b chimera downregulated Dnmt1, Dnmt3a, and Dnmt3b protein levels; induced hypomethylation in PTEN promoter; and upregulated PTEN mRNA and protein expression in OVCAR-3 cells. Importantly, Chi-29b chimera significantly induced apoptosis in OVCAR-3 cells. Our study indicated that Chi-29b chimera can effectively exert antitumor effect through specific delivery of miR-29b into OVCAR-3 tumor cells, subsequently reexpressing PTEN gene and inducing cell apoptosis.
LinkOut: [PMID: 23179556]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
226 hsa-miR-29b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000095 TGFB3 transforming growth factor, beta 3 2 1
MIRT000096 HDAC4 histone deacetylase 4 2 2
MIRT000097 CTNNBIP1 catenin, beta interacting protein 1 3 3
MIRT000098 COL5A3 collagen, type V, alpha 3 2 2
MIRT000099 COL4A2 collagen, type IV, alpha 2 2 2
MIRT000100 COL1A1 collagen, type I, alpha 1 5 7
MIRT000101 ACVR2A activin A receptor, type IIA 1 1
MIRT000445 SP1 Sp1 transcription factor 5 6
MIRT000684 CDK6 cyclin-dependent kinase 6 5 4
MIRT000930 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT002310 SFPQ splicing factor proline/glutamine-rich 3 1
MIRT002316 DNAJB11 DnaJ (Hsp40) homolog, subfamily B, member 11 3 1
MIRT003026 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 6
MIRT003029 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 8
MIRT003287 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 6 15
MIRT003290 BCL2 B-cell CLL/lymphoma 2 4 3
MIRT003661 DNMT1 DNA (cytosine-5-)-methyltransferase 1 4 2
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 4 5
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet methylcytosine dioxygenase 1 4 2
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 (membrane-inserted) 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 (membrane-inserted) 4 2
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen, type III, alpha 1 5 4
MIRT005568 COL4A1 collagen, type IV, alpha 1 6 6
MIRT005570 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 5 8
MIRT005614 BBC3 BCL2 binding component 3 1 1
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 4 2
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor, beta 2 2 2
MIRT006059 TGFB1 transforming growth factor, beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 4 2
MIRT006251 NASP nuclear autoantigenic sperm protein (histone-binding) 2 1
MIRT006486 PPP1R13B protein phosphatase 1, regulatory subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 2
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras-like 2 4 2
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon, gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 2 2
MIRT007254 FOS FBJ murine osteosarcoma viral oncogene homolog 2 2
MIRT027237 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 2 2
MIRT027238 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 2 2
MIRT027239 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 2
MIRT048359 SCAF8 SR-related CTD-associated factor 8 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 low density lipoprotein receptor-related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT048365 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT048372 TPD52L2 tumor protein D52-like 2 1 1
MIRT048373 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT048374 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT048375 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT048377 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP neuronal regeneration related protein homolog (rat) 1 1
MIRT048383 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT053293 TDG thymine-DNA glycosylase 4 3
MIRT053581 CCND2 cyclin D2 4 2
MIRT053738 COL4A5 collagen, type IV, alpha 5 1 1
MIRT053739 COL7A1 collagen, type VII, alpha 1 1 1
MIRT053740 COL15A1 collagen, type XV, alpha 1 1 1
MIRT053741 COL2A1 collagen, type II, alpha 1 1 1
MIRT053742 COL4A6 collagen, type IV, alpha 6 1 1
MIRT053743 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT053744 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT053745 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT053746 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT053747 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 2 2
MIRT053748 NOTCH2 notch 2 1 1
MIRT053749 PPARD peroxisome proliferator-activated receptor delta 1 1
MIRT054045 SNAI3 snail homolog 3 (Drosophila) 2 1
MIRT054192 AKT2 v-akt murine thymoma viral oncogene homolog 2 3 1
MIRT054574 PER1 period homolog 1 (Drosophila) 3 1
MIRT061662 BTG2 BTG family, member 2 1 2
MIRT067385 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT079942 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT080798 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 2
MIRT081893 KCTD15 potassium channel tetramerisation domain containing 15 1 4
MIRT082515 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT085293 CCNT2 cyclin T2 1 3
MIRT102856 INSIG1 insulin induced gene 1 1 1
MIRT207249 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT207755 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 2
MIRT210969 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211650 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT213230 REST RE1-silencing transcription factor 1 5
MIRT225103 GOLGA7 golgin A7 1 1
MIRT250481 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT264266 FAM102B family with sequence similarity 102, member B 1 1
MIRT267090 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT303363 MXD1 MAX dimerization protein 1 2 1
MIRT316344 ULBP2 UL16 binding protein 2 1 1
MIRT401476 AIM1 absent in melanoma 1 2 1
MIRT437369 LAMC2 laminin, gamma 2 3 1
MIRT437372 ITGA6 integrin, alpha 6 3 2
MIRT437552 COL5A2 collagen, type V, alpha 2 1 1
MIRT437553 COL10A1 collagen, type X, alpha 1 1 1
MIRT437554 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 1 1
MIRT437555 FBN1 fibrillin 1 1 1
MIRT437556 LOX lysyl oxidase 2 2
MIRT437557 PDGFRB platelet-derived growth factor receptor, beta polypeptide 2 2
MIRT437710 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437713 TUBB2A tubulin, beta 2A class IIa 2 1
MIRT437716 EMP1 epithelial membrane protein 1 2 1
MIRT437719 SNX24 sorting nexin 24 2 1
MIRT437722 AMFR autocrine motility factor receptor, E3 ubiquitin protein ligase 2 1
MIRT437725 RIOK3 RIO kinase 3 (yeast) 2 1
MIRT437728 WDR26 WD repeat domain 26 3 2
MIRT437731 DSC2 desmocollin 2 2 1
MIRT437870 IL32 interleukin 32 1 1
MIRT438911 GATA3 GATA binding protein 3 2 1
MIRT438912 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 2 1
MIRT438913 PDGFC platelet derived growth factor C 2 1
MIRT438914 PDGFB platelet-derived growth factor beta polypeptide 2 1
MIRT438915 PDGFA platelet-derived growth factor alpha polypeptide 2 1
MIRT438916 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 2 1
MIRT438917 LOXL4 lysyl oxidase-like 4 2 1
MIRT438918 LOXL2 lysyl oxidase-like 2 2 1
MIRT438919 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 2 1
MIRT438920 ANGPTL4 angiopoietin-like 4 2 1
MIRT454812 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 1 1
MIRT456827 MORF4L2 mortality factor 4 like 2 1 4
MIRT462151 RPL22 ribosomal protein L22 1 1
MIRT465314 TRAM2 translocation associated membrane protein 2 1 1
MIRT467808 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT467829 SLC29A2 solute carrier family 29 (nucleoside transporters), member 2 1 1
MIRT467971 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 2
MIRT468225 SGK1 serum/glucocorticoid regulated kinase 1 1 1
MIRT469448 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT469723 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT469841 R3HDM4 R3H domain containing 4 1 1
MIRT472643 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae) 1 1
MIRT474209 LEPRE1 leucine proline-enriched proteoglycan (leprecan) 1 1 1
MIRT474576 KLHDC3 kelch domain containing 3 1 1
MIRT475837 HDGF hepatoma-derived growth factor 1 2
MIRT476721 FRK fyn-related kinase 1 2
MIRT477473 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT478668 CTC1 CTS telomere maintenance complex component 1 1 7
MIRT478710 CSRNP2 cysteine-serine-rich nuclear protein 2 1 1
MIRT478985 COMMD2 COMM domain containing 2 1 1
MIRT479826 CCNA2 cyclin A2 1 4
MIRT479901 CCDC117 coiled-coil domain containing 117 1 1
MIRT480066 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT482012 AMER1 family with sequence similarity 123B 1 4
MIRT489024 C1QTNF6 C1q and tumor necrosis factor related protein 6 1 1
MIRT492513 RAET1L retinoic acid early transcript 1L 1 1
MIRT493825 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT495936 SLC7A5P2 solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2 1 1
MIRT496358 PPY pancreatic polypeptide 1 1
MIRT496662 TMEM237 transmembrane protein 237 1 1
MIRT497644 GLDN gliomedin 1 1
MIRT501878 MORF4L1 mortality factor 4 like 1 1 4
MIRT502932 CDC42SE1 CDC42 small effector 1 1 2
MIRT506750 LDOC1L leucine zipper, down-regulated in cancer 1-like 1 3
MIRT507168 GAS2L3 growth arrest-specific 2 like 3 1 1
MIRT514918 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 3
MIRT523962 DYNLT1 dynein, light chain, Tctex-type 1 1 2
MIRT527675 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT536936 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT537359 FJX1 four jointed box 1 (Drosophila) 1 1
MIRT537687 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 1 1
MIRT538124 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 1 1
MIRT538813 C21orf91 chromosome 21 open reading frame 91 1 1
MIRT546938 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT547104 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT547823 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT548237 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT550036 WWTR1 WW domain containing transcription regulator 1 1 1
MIRT552619 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT556562 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT558857 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT565485 SPRTN SprT-like N-terminal domain 1 1
MIRT568205 CBX6 chromobox homolog 6 1 1
MIRT576774 Tmem127 transmembrane protein 127 1 1
MIRT576958 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT610003 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT616511 COX7A2L cytochrome c oxidase subunit VIIa polypeptide 2 like 1 1
MIRT640887 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT641350 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT642978 TESPA1 thymocyte expressed, positive selection associated 1 1 1
MIRT643634 YY2 YY2 transcription factor 1 1
MIRT644386 ZNF286A zinc finger protein 286A 1 1
MIRT650749 YAE1D1 Yae1 domain containing 1 1 1
MIRT661585 EPHX2 epoxide hydrolase 2, cytoplasmic 1 1
MIRT664287 RNMTL1 RNA methyltransferase like 1 1 1
MIRT689393 ZNF850 zinc finger protein 850 1 1
MIRT693815 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT694532 TRIM72 tripartite motif containing 72 1 1
MIRT694628 ZFPM1 zinc finger protein, multitype 1 1 1
MIRT695135 PRY2 PTPN13-like, Y-linked 2 1 1
MIRT695152 PRY PTPN13-like, Y-linked 1 1
MIRT703640 FBRS fibrosin 1 1
MIRT704551 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT704967 CBX2 chromobox homolog 2 1 1
MIRT705497 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT707993 OTUD4 OTU domain containing 4 1 1
MIRT708741 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT710621 COLEC10 collectin sub-family member 10 (C-type lectin) 1 1
MIRT713056 IFRD1 interferon-related developmental regulator 1 1 1
MIRT715515 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT720770 FAM193A family with sequence similarity 193, member A 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*