Accession ID: MIRT003661 [miRNA, hsa-miR-29b-3p :: DNMT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29b-1LinkOut: [miRBase ]
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Mature Sequence 51| UAGCACCAUUUGAAAUCAGUGUU |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DNMT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIM, CXXC9, DNMT, FLJ16293, MCMT, MGC104992
Description DNA (cytosine-5-)-methyltransferase 1
Transcript NM_0011308    LinkOut: [ RefSeq ]
Other Transcripts NM_0013   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DNMT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DNMT1
(miRNA target sites are highlighted)
>DNMT1|NM_0011308|3'UTR
   1 GCCAAAGCCCGAGAGAGTGCCTCAGCTAAAATAAAGGAGGAGGAAGCTGCTAAGGACTAGTTCTGCCCTCCCGTCACCCC
  81 TGTTTCTGGCACCAGGAATCCCCAACATGCACTGATGTTGTGTTTTTAACATGTCAATCTGTCCGTTCACATGTGTGGTA
 161 CATGGTGTTTGTGGCCTTGGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAATGATTTAGTGATCAAATTGT
 241 GCAGTACTTTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTACCACTGTATGAGTGGAAATTA
 321 AGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTATAAACCAAAAAAAAAAAAAAAAAAAA
 401 AAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: DNMT1    [ Functional MTI ]
Validation Method immunoblot , Luciferase reporter assay , qRT-PCR , Other
Conditions K562
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-29b downregulates DNMT1 indirectly by targeting Sp1, a transactivator of the DNMT1 gene ...

- Garzon, R. Liu, S. Fabbri, M. Liu, Z. et al., 2009, Blood.

Article - Garzon, R. Liu, S. Fabbri, M. Liu, Z. et al.
- Blood, 2009
Aberrant DNA hypermethylation contributes to myeloid leukemogenesis by silencing structurally normal genes involved in hematopoiesis. MicroRNAs (miRNAs) are noncoding RNAs that regulate gene expression by targeting protein-coding mRNAs. Recently, miRNAs have been shown to play a role as both targets and effectors in gene hypermethylation and silencing in malignant cells. In the current study, we showed that enforced expression of miR-29b in acute myeloid leukemia cells resulted in marked reduction of the expression of DNA methyltransferases DNMT1, DNMT3A, and DNMT3B at both RNA and protein levels. This in turn led to decrease in global DNA methylation and reexpression of p15(INK4b) and ESR1 via promoter DNA hypomethylation. Although down-regulation of DNMT3A and DNMT3B was the result of a direct interaction of miR-29b with the 3' untranslated regions of these genes, no predicted miR-29b interaction sites were found in the DNMT1 3' untranslated regions. Further experiments revealed that miR-29b down-regulates DNMT1 indirectly by targeting Sp1, a transactivator of the DNMT1 gene. Altogether, these data provide novel functional links between miRNAs and aberrant DNA hypermethylation in acute myeloid leukemia and suggest a potentially therapeutic use of synthetic miR-29b oligonucleotides as effective hypomethylating compounds.
LinkOut: [PMID: 19211935]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
79 hsa-miR-29b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000096 HDAC4 histone deacetylase 4 2 2
MIRT000097 CTNNBIP1 catenin, beta interacting protein 1 2 2
MIRT000098 COL5A3 collagen, type V, alpha 3 2 2
MIRT000099 COL4A2 collagen, type IV, alpha 2 1 1
MIRT000100 COL1A1 collagen, type I, alpha 1 5 6
MIRT000101 ACVR2A activin A receptor, type IIA 1 1
MIRT000445 SP1 Sp1 transcription factor 5 5
MIRT000684 CDK6 cyclin-dependent kinase 6 4 2
MIRT000930 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT002310 SFPQ splicing factor proline/glutamine-rich 3 1
MIRT002316 DNAJB11 DnaJ (Hsp40) homolog, subfamily B, member 11 3 1
MIRT003026 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 4
MIRT003029 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 5
MIRT003287 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 5 7
MIRT003290 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT003661 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 2 1
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet oncogene 1 4 1
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 (membrane-inserted) 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 (membrane-inserted) 3 1
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen, type III, alpha 1 4 2
MIRT005568 COL4A1 collagen, type IV, alpha 1 4 1
MIRT005570 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 4 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 4 2
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor, beta 2 2 1
MIRT006059 TGFB1 transforming growth factor, beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 4 1
MIRT006251 NASP nuclear autoantigenic sperm protein (histone-binding) 2 1
MIRT006486 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 3 1
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras-like 2 3 1
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon, gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 1 1
MIRT007254 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT027237 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT027238 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 2 2
MIRT027239 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT048359 SCAF8 RNA binding motif protein 16 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 low density lipoprotein receptor-related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT048365 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT048372 TPD52L2 tumor protein D52-like 2 1 1
MIRT048373 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT048374 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT048375 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT048377 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP chromosome 1 open reading frame 96 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP chromosome 5 open reading frame 13 1 1
MIRT048383 MKI67 antigen identified by monoclonal antibody Ki-67 1 1