Accession ID: MIRT003731 [miRNA, hsa-miR-519b-3p :: ELAVL1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-519bLinkOut: [miRBase ]
Description Homo sapiens miR-519b stem-loop
Comment The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-519b-3p
Mature Sequence 51| AAAGUGCAUCCUUUUAGAGGUU |72
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-519b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ELAVL1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ELAV1, HUR, Hua, MelG
Description ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Transcript NM_001419    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ELAVL1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ELAVL1
(miRNA target sites are highlighted)
>ELAVL1|NM_001419|3'UTR
   1 CTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACTCAT
  81 TTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCGACA
 161 TGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAAACA
 241 GAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCTGAAGCATGCTTTAACCTCTAAGACT
 321 GTCTAACACGCGTTTCATTCAATGTCTCCACAGACTGGGTAGCAAAAAAATCACCTTTTAGTTTTAGTTTTTAATCTAAA
 401 GATGTTAGACAGATGCTGAGTGTGCGTTTTCTCAACCGCTTCAACATTGTAAGCGATGTATGCTTTGGTTGACAGGAAGT
 481 TCCTTTTCCAGGCAGGTCCCGTTGCCACCTCCTGCTCACTCAGTCCCGGGCTCTGCCGAGTGGTCCTGGGAATGGCGGCG
 561 GGCCCGTCCAGCGTGGGCCACCACTGGGGCCGGGGGCCACGGGCTGCATGCTGGGCGGGCCCTCCAGAGAAGGACACAAA
 641 CGTGTTTCGTAAGCCCAGGCACCAATGGGAATGGACCAAAGAGTTTCAGGGAAACTCCAGTATATTCCAGAGTCAGATCT
 721 AAGCTCCAGGCACGCCTGAAGATGTGTTGCTACTCTGACATCCCGAGTTTCTGTCCACACATTGCATGCACAGCGCCCCA
 801 CACATTGGATACTGTTGTTCACGATAATTTCTCCCGTTTTCCAGAGCATTTAACATAGCTTGGAGGCGTAAAATGGCTCT
 881 GTATTTTAATAACACAGAAACATTTGAGCATTGTATTTCTCGCATCCCTTCTCGTGAGCGCTTAGACCTTTTTCTATTTT
 961 AGTCGGATTTTGTTTTGGAATTTTGCTTTTGTATGAACACTCAGCAGAAAAGTACTTACTTCTTGCCAGTTATCTATTAA
1041 CCAAAACCTTTGATTTGTAGTTTTAAAGATTAACCCTCAAAGTTCTCTTCATAACTGCCTTGACATTTTGGGTTGTTCTG
1121 TTCTGTTAATTTTCTTTTGCTTTTTTGTGTTTTTTGTTTGTTTTTACTTTTGCATTTAAGACCATTAAATTTGATTTTGT
1201 TTTGCTCGAATTTTGTTTTGTTTTTTATTTTACCTTTTCTTTCTTTTTGGCTAGGGAAGGTGCAGGTGGCCCAGCATTCA
1281 GGGAGGAGTCGTAAGATCTTAAGAAACCAATCCTTGCCTCAAGCAAAAGCATTTCTGAATCTGTGACGCAAGAATGTGCA
1361 GTTACAGGCTGGTGGCTTTTAAACCAGGAGCCCGGAGGAAGGGTGAAAGAGAAAGCCTGTGAAATAGGCAGGGCCAGATC
1441 ACCCAAAACTCCTCAGGACTGGGATCTGGCGTTTATAAATAACTAGTTTACAGAGAGAATCACAAACAGGATAACTTAGT
1521 ACCAGCAGTTTTTAACCTTGACGTGAGACTAAAACGTGACCGTAGGCTGTTTTTTAGTTATTGCTCTCATGAGATGATGG
1601 CTGTATTTATCTGTTTATTTATACCTATTTATGTATTTATTTATTGAAGTGTGAAATTGAGCAATAGGCAGGCACCACCG
1681 TCCCCAGAGCAGGTCAGCGTCTCGAGAGGCCCCTGGACAATTGAGGATGCCCATCCCCTCCCCTTTCCCTGATCTTTTAC
1761 TGAGGGGCTGTGTGCGCGATCCTTGCAAATTGATGATGTTGCCATCCGTACCCAGGCTGTGTCTCATAAAAGTCGGCCTG
1841 GTGCCAGAGAGGACCTCCTTTCTCCCACAGAATCCCAGATCCTCAGGAAAAGCCAAAACCGAGGCCCATTGCCCGGATTC
1921 GACACAAAAGAGGGTCCCTGCTCTGTTGCCCGAGAGCAGTCTGCATCCTGGGACCAGAATGCTTTCCTGGAAAAAGAAGC
2001 CTTTCAGGTTTCCCTGGGCCAGCATCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCAACAC
2081 CCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCA
2161 ACACCCTTCTGATGGAAGGCGGGATTCCCGCTTCTGAAACTCCCCCTGGAGTCTCACTCCCACACATGCCCATAGCTAGC
2241 ATTCAACAGAGAACTCTGTCTTAAGCTTCAACTGTGAAAATGATGACGGGCTTGTAGCACCTCAGCTTCTTTCCTCGCCC
2321 CCTTTTATCTGAATCCTATCAATTATTCTGATGCTGGGACAGGTGAGAAGAAACTGTGAAGTATATGAGCCTTTGAAAGT
2401 TCCCTGAAGTTTCTCAGTTCAGGAACATTCTCATTGTATGTGGTCTCCGCTGTTTGAACAGCCTTCTAGCTAAAAAATTC
2481 CAAAGCCTTTATTTGGGAGTCTTAGCTTGCAAGCTTGTGGAAGGATTTAGCTTAACAACTGTCACTCCTGAAAAGCAATC
2561 TCTGTTCCATCAAGGTTCTAGTTGCTGGCCCTGTGTCCTCAAAGTTCATTACATCTTATCAAGGCCTGTTTGCAAAGGGG
2641 AGATCCCTTTTCTTAAAAAAGGCTCAACCCAAAAGAAACCATTTCTTAAAAAATTTTACATAGATCAGTTGTATTTCTAT
2721 TTAGCAAAAATGAGTGCTCTGCTTTTATTTGGGAATTTCGATGAAAAAGCGTTCAGAGTAGATAATGTTCATTTATCAAA
2801 AATCTGGTTTGGGAAATACCAAAGAGGCTTTGATTGAATTCCCTTTTGACCCGTGTGTAACTTCCTCTGGTAGTTAGACC
2881 CCAGGCAGCTCCGAATTTGTGAACCTGCTTCCTGATGAATTCTCCCTTGTTCCCCCTTGGCTCTGCCATTATTTCGTTTT
2961 CAGTGTAATTTGCCAAGCCGCAGTTTTCTGTGCTGGCTGTGCCTCTAGTCGCAGCTCTGTGACTGATTCCCTCCCGGGTG
3041 CTGAGTCCCCTCCCCGGCCACCATCCTGCGTGAATATCCTGAAATTCATGGGCTTCCTCGGGGGCCCGCCCGCAGGTGGT
3121 GCTGGGTGGGTTCCGCCACCTTCTCCTGGAAGGTGAGCCTTTTCCTGGCCAAGGGCAGCTGCCTTAACCTCTGAGAGTCT
3201 GCGCTTGGCCTTAGTCCTGGAGACCCAGCCTCCAGGGACTGAACCGTGCTGCTGTTGGGAGCCAAGACCGGCCCTTTGGA
3281 GCCGGCAGCCCAGGGGTCCCTGCTGGATCAGAGAAATAGAAGCACCCGAAGACGGTTAGTGGCAATTCCTTGACCCGGTT
3361 TGCTTCCAAATGAAGGCCATTTGTCCACCAGGCATTGAAAAGACATGACTTACCCAGTCCGGCATCGGACTTGAAAAATC
3441 GAAATTGACATCACTCAGCTGTTACATTTCACATCCGATTCAGCCCCCTTTTATTTCCATGTGCTTTTCGCAGCCTTCCT
3521 GTGTTGGATGAAAGAGAATAAGAATTCAGCTGACAGGAGGCCTCTATCCTGTCCCTCCACCCCACCCTCCACCTCAATCC
3601 CCTCCCATCTTCCCCAGACCTACCTCACCTACTAGGACCTGAGGCAGCTCCTTAGCAGAGACCCCTGGGGTTTAGCTGAC
3681 TCTGGGGGTCAGGGGTTCCTGTCCCCAAACTTCGCAAGACAGCCCTGAAGTCACAAGTGCTTTCTTTTAAGTGGCATTGG
3761 CAATTGGCGTGTAATGATGGCAGTAGAATCTGAATCTCGGATCCCAGGCAGGGTTCACATTTCCAAACCTTTTTGATTTC
3841 CCCTGACCTCTAATGGCTGGATCCTATTTTTCTACAACCTTTCAGTGACATCGTTCAGGTTTCTTTCTTGGCCATTTAAA
3921 AAAACAAATTTTTTTTTTCTCACTTGTAAGTCACCGCCAGTACCTAAGTTAGGCTAACGGAGACTTTGACAGGACTGGAT
4001 TTTTCTTCCACCAGAAGAGAAGCCTTTTCCGTTGGTTTGGGGCCACCTCTTTGACCATGACCATGTGATGTTCCGTTTAC
4081 AGTGACTTGCTTTGGGGGAGGGGAGGCTCTCTTAACCGATTCCCATGTTGTACAGTAGATGGTTAGACCTTTTGTATATT
4161 AGTGTGTTTTAAGTTATTGATTTGTTTTATATAAAATAATTTATTTTTCAGGTGCCATTTTTCATTTTAACTTTGTTTTT
4241 ACATGGGTTTGTTTTCAATAAAGTCTGACACTGGTGTCCAAAAGTCAACAATAAAATGAATCCCATTGTGTTCTTTTGAA
4321 GATGCCTATGTAACTTTTAAGCTTTTTAAATTATTTTCAGAAAAAAAAAAAGAAAAGCCCTTATCAGTTTTCCATCAGCC
4401 CATTGCCTTTTTATTTTTTTTTTTTAATCCTTGTGAATAAATGTTCTTTAGTGTTTTAGGAGGAAAAAGCAAACCTAGAT
4481 TTTGATAACCCAGAAGACTTCAGATTAATAAAGAAGCTTTGAAAGAAGACCATTTTTCAAAATTTTAGTGAAGTGTGAAT
4561 ATTTTTTGTCAATGGCTTTCTCAAAGAGAATGAAACTTTTGCACCATTTTCAGAGTTTTTATAGAGATGCCAAATTGATA
4641 TATTTACATGTAATGGAAACATGAAAAAGTTTTATTAAACAATTGTTCATAGCTGTGTAGACATTTTAATTCAGTTTCCA
4721 AAGCTCTCAAAAAATCGTATTTTTGAAGTACGGAGTGATGCGGTTTGGGGCGTGGCTTACAGTTCCAACGACTCAATTGT
4801 CCCGATACTCAGTTCTTTCTACAGGTATCAGGTTCGTGTTAAACGCTGTATGTTAACTATGACTGGAATTCTGTGATATT
4881 TTGGTAATAAATGAAGTGGGATCATTGCGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGGAGAUUUUCCUACGUGAAa 5'
            |||||:|:||  |||:||| 
Target 5' aaCCTCTGAGAGTCTGCGCTTg 3'
3186 - 3207 160.00 -23.00
2
miRNA  3' uuggAGAUUU-UCCU-ACGUGAaa 5'
              |||||: || | ||||:|  
Target 5' gaaaTCTAAGTAGAACTGCATTga 3'
241 - 264 126.00 -8.50
3
miRNA  3' uuGGAG-AUUUU----CCUACGUGAAa 5'
            :||| |:|:|    || ||:|:|| 
Target 5' gcTCTCATGAGATGATGGCTGTATTTa 3'
1583 - 1609 126.00 -9.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-519b-3p :: ELAVL1    [ Functional MTI ]
Validation Method qRT-PCR , Western blot ,
Conditions HeLa , HCT116 , RKO
Location of target site CDS, 3'UTR
Tools used in this research RNA22
Original Description (Extracted from the article) ... The influence of miR-519 was recapitulated using heterologous reporter constructs that revealed a greater repressive effect on the HuR CR than the HuR 3-UTR target sequences. miR-519 did not alter HuR mRNA abundance, but reduced HuR biosynthesis, as determined by measuring nascent HuR translation and HuR mRNA association with polysomes. We describe the repression of HuR expression by miR-519. Our findings indicate that miR-519 reduces HuR translation and not HuR mRNA levels or stability, since miR-519 overexpression specifically lowered HuR nascent translation and miR-519 inhibi- tion elevated it. ...

- Abdelmohsen, K. Srikantan, S. Kuwano, Y. et al., 2008, Proc Natl Acad Sci U S A.

Article - Abdelmohsen, K. Srikantan, S. Kuwano, Y. et al.
- Proc Natl Acad Sci U S A, 2008
Gene expression is potently regulated through the action of RNA-binding proteins (RBPs) and microRNAs (miRNAs). Here, we present evidence of a miRNA regulating an RBP. The RBP HuR can stabilize and modulate the translation of numerous target mRNAs involved in cell proliferation, but little is known about the mechanisms that regulate HuR abundance. We identified two putative sites of miR-519 interaction on the HuR mRNA, one in its coding region (CR), one in its 3'-untranslated region (UTR). In several human carcinoma cell lines tested, HeLa (cervical), HCT116 and RKO (colon), and A2780 (ovarian), overexpression of a miR-519 precursor [(Pre)miR-519] reduced HuR abundance, while inhibiting miR-519 by using an antisense RNA [(AS)miR-519] elevated HuR levels. The influence of miR-519 was recapitulated using heterologous reporter constructs that revealed a greater repressive effect on the HuR CR than the HuR 3'-UTR target sequences. miR-519 did not alter HuR mRNA abundance, but reduced HuR biosynthesis, as determined by measuring nascent HuR translation and HuR mRNA association with polysomes. Modulation of miR-519 leading to altered HuR levels in turn affected the levels of proteins encoded by HuR target mRNAs. In keeping with HuR's proliferative influence, (AS)miR-519 significantly increased cell number and [(3)H]-thymidine incorporation, while (Pre)miR-519 reduced these parameters. Importantly, the growth-promoting effects of (AS)miR-519 required the presence of HuR, because downregulation of HuR by RNAi dramatically suppressed its proliferative action. In sum, miR-519 represses HuR translation, in turn reducing HuR-regulated gene expression and cell division.
LinkOut: [PMID: 19088191]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
319 hsa-miR-519b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000587 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT003731 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 3 1
MIRT055030 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT055395 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT056831 REEP3 receptor accessory protein 3 1 1
MIRT060506 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT061798 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT063355 ETNK1 ethanolamine kinase 1 1 1
MIRT064425 ARID4B AT rich interactive domain 4B (RBP1-like) 1 1
MIRT064722 CCND2 cyclin D2 1 1
MIRT064807 ZBTB18 zinc finger protein 238 1 2
MIRT065610 DAZAP2 DAZ associated protein 2 1 5
MIRT065623 CLIC4 chloride intracellular channel 4 1 2
MIRT065875 GDF11 growth differentiation factor 11 1 1
MIRT065894 RAB5B RAB5B, member RAS oncogene family 1 4
MIRT068753 RB1 retinoblastoma 1 1 1
MIRT070051 FANCM Fanconi anemia, complementation group M 1 1
MIRT071006 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071336 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 3
MIRT071914 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT072733 GLCE glucuronic acid epimerase 1 1
MIRT076029 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 3
MIRT076047 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT079355 CCDC137 coiled-coil domain containing 137 1 1
MIRT080229 SMAD4 SMAD family member 4 1 3
MIRT081124 LDLR low density lipoprotein receptor 1 4
MIRT081207 MIDN midnolin 1 5
MIRT085099 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 3
MIRT085151 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 2
MIRT086438 NABP1 nucleic acid binding protein 1 1 3
MIRT088039 UBXN2A UBX domain protein 2A 1 1
MIRT088134 SEPT2 septin 2 1 2
MIRT088345 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090647 U2SURP U2 snRNP-associated SURP domain containing 1 3
MIRT090806 MBNL1 muscleblind-like splicing regulator 1 1 2
MIRT091694 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 2
MIRT092691 C3ORF38 chromosome 3 open reading frame 38 1 4
MIRT093957 SLAIN2 SLAIN motif family, member 2 1 1
MIRT095729 ANKH ankylosis, progressive homolog (mouse) 1 4
MIRT097159 FCHO2 FCH domain only 2 1 1
MIRT099321 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099837 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100774 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 1
MIRT100957 CENPQ centromere protein Q 1 2
MIRT102231 HBP1 HMG-box transcription factor 1 1 1
MIRT102301 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 5
MIRT102622 UBN2 ubinuclein 2 1 4
MIRT103781 PURB purine-rich element binding protein B 1 1
MIRT104170 PHTF2 putative homeodomain transcription factor 2 1 3
MIRT107280 FAM73B family with sequence similarity 73, member B 1 1
MIRT107948 TMEM2 transmembrane protein 2 1 1
MIRT108266 HABP4 hyaluronan binding protein 4 1 1
MIRT124813 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT138709 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT139881 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT144314 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 4
MIRT145607 LASP1 LIM and SH3 protein 1 1 1
MIRT153353 MAVS mitochondrial antiviral signaling protein 1 2
MIRT153988 PRNP prion protein 1 1
MIRT159131 NRBP1 nuclear receptor binding protein 1 1 1
MIRT164535 MSMO1 methylsterol monooxygenase 1 1 1
MIRT165915 CREBRF CREB3 regulatory factor 1 1
MIRT170860 TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein 1 1 2
MIRT172158 FZD6 frizzled family receptor 6 1 4
MIRT173704 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT175004 ZBTB5 zinc finger and BTB domain containing 5 1 2
MIRT175403 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT178071 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT178677 FAM102B family with sequence similarity 102, member B 1 1
MIRT180848 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 2
MIRT194912 RBBP6 retinoblastoma binding protein 6 1 4
MIRT195756 ATMIN ATM interactor 1 3
MIRT196624 TAOK1 TAO kinase 1 1 3
MIRT205288 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT206200 RAB10 RAB10, member RAS oncogene family 1 2
MIRT208982 SKIL SKI-like oncogene 1 5
MIRT223638 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 2
MIRT224759 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT227996 NFIB nuclear factor I/B 1 2
MIRT230975 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT238185 ANKRD33B ankyrin repeat domain 33B 1 5
MIRT242426 HAS3 hyaluronan synthase 3 1 1
MIRT242668 SALL3 sal-like 3 (Drosophila) 1 2
MIRT242766 FNBP1L formin binding protein 1-like 1 3
MIRT243096 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT243439 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT243965 MAP1B microtubule-associated protein 1B 1 1
MIRT244778 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT246631 TMEM109 transmembrane protein 109 1 1
MIRT246970 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT266057 FJX1 four jointed box 1 (Drosophila) 1 2
MIRT266860 SLC25A44 solute carrier family 25, member 44 1 1
MIRT283186 C16ORF52 chromosome 16 open reading frame 52 1 1
MIRT286957 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT293653 PVR poliovirus receptor 1 2
MIRT295179 ZNF317 zinc finger protein 317 1 2
MIRT302456 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT303501 NAGK N-acetylglucosamine kinase 1 3
MIRT368756 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT383208 APH1A anterior pharynx defective 1 homolog A (C. elegans) 1 1
MIRT383612 POU2F1 POU class 2 homeobox 1 1 1
MIRT396104 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT441420 FAM9C family with sequence similarity 9, member C 1 1
MIRT446819 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT448308 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT461782 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT462817 NTN1 netrin 1 1 1
MIRT463614 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT464561 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT464843 RPS27A ribosomal protein S27a 1 6
MIRT465226 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT466447 TFAM transcription factor A, mitochondrial 1 4
MIRT466837 STX6 syntaxin 6 1 3
MIRT467186 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 1
MIRT468180 SGMS1 sphingomyelin synthase 1 1 1
MIRT469851 PXK PX domain containing serine/threonine kinase 1 4
MIRT471613 PAQR5 progestin and adipoQ receptor family member V 1 9
MIRT472009 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT472160 NIN ninein (GSK3B interacting protein) 1 2
MIRT472337 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 2
MIRT473163 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT473624 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT473683 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT473806 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT474417 KLHL28 kelch-like 28 (Drosophila) 1 4
MIRT474737 KIF13A kinesin family member 13A 1 3
MIRT474967 KCTD10 potassium channel tetramerisation domain containing 10 1 2
MIRT475465 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476121 GPR157 G protein-coupled receptor 157 1 1
MIRT476204 GNS glucosamine (N-acetyl)-6-sulfatase 1 3
MIRT477181 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT478104 DLG5 discs, large homolog 5 (Drosophila) 1 3
MIRT478714 CSNK1A1 casein kinase 1, alpha 1 1 3
MIRT479056 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 4
MIRT480009 CAPRIN2 caprin family member 2 1 2
MIRT480520 C11orf30 chromosome 11 open reading frame 30 1 5
MIRT480823 BLCAP bladder cancer associated protein 1 5
MIRT480945 BBX bobby sox homolog (Drosophila) 1 4
MIRT481337 ATL3 atlastin GTPase 3 1 1
MIRT481599 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT481878 ANKRD50 ankyrin repeat domain 50 1 1
MIRT482472 ADAR adenosine deaminase, RNA-specific 1 2
MIRT484876 ZNF652 zinc finger protein 652 1 1
MIRT485091 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT485580 FOXQ1 forkhead box Q1 1 1
MIRT485619 FBXL5 F-box and leucine-rich repeat protein 5 1 5
MIRT486752 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT489600 ZDHHC20 zinc finger, DHHC-type containing 20 1 5
MIRT489890 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT491655 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT492039 TSG101 tumor susceptibility gene 101 1 2
MIRT492362 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT492777 PDGFB platelet-derived growth factor beta polypeptide 1 1
MIRT493337 LAPTM4A lysosomal protein transmembrane 4 alpha 1 6
MIRT493612 HMGB3 high mobility group box 3 1 3
MIRT497469 DDR2 discoidin domain receptor tyrosine kinase 2 1 1
MIRT498060 SNX5 sorting nexin 5 1 3
MIRT499902 KIAA1191 KIAA1191 1 2
MIRT500490 ZBTB4 zinc finger and BTB domain containing 4 1 3
MIRT500686 TRIM37 tripartite motif containing 37 1 1
MIRT500761 TMEM127 transmembrane protein 127 1 3
MIRT501457 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 4
MIRT501560 POC1B-GALNT4 POC1B-GALNT4 readthrough 1 1
MIRT501984 MAPK1 mitogen-activated protein kinase 1 1 5
MIRT502001 MAP7 microtubule-associated protein 7 1 4
MIRT502050 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 3
MIRT502424 GALNT4 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) 1 1
MIRT503045 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT503822 TMEM242 transmembrane protein 242 1 2
MIRT504291 PARP1 poly (ADP-ribose) polymerase 1 1 3
MIRT504561 ZNF417 zinc finger protein 417 1 3
MIRT505055 ZNF202 zinc finger protein 202 1 3
MIRT505487 SRSF2 serine/arginine-rich splicing factor 2 1 2
MIRT505837 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT506373 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT506452 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506674 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT506835 KIF23 kinesin family member 23 1 2
MIRT506881 KIAA0101 KIAA0101 1 3
MIRT507360 FAM129A family with sequence similarity 129, member A 1 3
MIRT507958 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 1 3
MIRT509434 MCM7 minichromosome maintenance complex component 7 1 3
MIRT510873 RAN RAN, member RAS oncogene family 1 4
MIRT511077 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 2
MIRT511255 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT513700 RBM20 RNA binding motif protein 20 1 2
MIRT513743 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT513982 CEP97 centrosomal protein 97kDa 1 1
MIRT514093 EPS15L1 epidermal growth factor receptor pathway substrate 15-like 1 1 3
MIRT515929 MFAP2 microfibrillar-associated protein 2 1 2
MIRT519575 ZNFX1 zinc finger, NFX1-type containing 1 1 2
MIRT521298 RRAGD Ras-related GTP binding D 1 2
MIRT521349 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT521694 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 4
MIRT521779 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 4
MIRT522192 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 3
MIRT524697 BTG3 BTG family, member 3 1 4
MIRT525664 NHSL2 NHS-like 2 1 1
MIRT527253 TMEM196 transmembrane protein 196 1 1
MIRT527467 CLEC12B C-type lectin domain family 12, member B 1 1
MIRT529536 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT530147 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT530852 RAG1 recombination activating gene 1 1 2
MIRT531110 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT534264 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT534757 RASGEF1A RasGEF domain family, member 1A 1 1
MIRT535176 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT535247 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT535402 PER1 period homolog 1 (Drosophila) 1 1
MIRT536037 MCUR1 coiled-coil domain containing 90A 1 1
MIRT536348 LEFTY1 left-right determination factor 1 1 1
MIRT536414 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT536438 KMT2B myeloid/lymphoid or mixed-lineage leukemia 4 1 3
MIRT536605 IRF2 interferon regulatory factor 2 1 1
MIRT536643 INO80D INO80 complex subunit D 1 1
MIRT536861 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 1 1
MIRT537242 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT537729 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT537989 DPP8 dipeptidyl-peptidase 8 1 1
MIRT538038 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT538256 CUL3 cullin 3 1 2
MIRT538526 CLCN3 chloride channel, voltage-sensitive 3 1 1
MIRT538660 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT538780 C7orf60 chromosome 7 open reading frame 60 1 2
MIRT538850 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT538924 BRI3BP BRI3 binding protein 1 3
MIRT539115 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT539455 ADARB2 adenosine deaminase, RNA-specific, B2 1 1
MIRT541086 RLIM ring finger protein, LIM domain interacting 1 1
MIRT543118 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT543182 FICD FIC domain containing 1 1
MIRT543576 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544114 IPMK inositol polyphosphate multikinase 1 1
MIRT544626 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT544700 ZNF224 zinc finger protein 224 1 2
MIRT544993 MFF mitochondrial fission factor 1 2
MIRT546249 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT546283 TMEM30A transmembrane protein 30A 1 2
MIRT546291 TMEM200C transmembrane protein 200C 1 2
MIRT546559 SATB2 SATB homeobox 2 1 1
MIRT546816 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT547047 POGZ pogo transposable element with ZNF domain 1 1
MIRT547475 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT547762 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT547893 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT548316 EPHA4 EPH receptor A4 1 1
MIRT548384 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548461 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548580 DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 1 1
MIRT548859 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT548897 CHEK2 checkpoint kinase 2 1 2
MIRT549320 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT550301 ZNF681 zinc finger protein 681 1 1
MIRT551121 ZNF107 zinc finger protein 107 1 1
MIRT551407 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT552174 DAD1 defender against cell death 1 1 1
MIRT552857 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552893 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553076 UEVLD UEV and lactate/malate dehyrogenase domains 1 1
MIRT553669 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 2
MIRT553701 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT554609 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT554861 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT556158 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT556180 MCC mutated in colorectal cancers 1 1
MIRT556530 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT556724 KLHL21 kelch-like 21 (Drosophila) 1 2
MIRT557055 HOXB3 homeobox B3 1 1
MIRT557588 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT557662 GATA6 GATA binding protein 6 1 1
MIRT557754 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT557882 FEM1B fem-1 homolog b (C. elegans) 1 2
MIRT558216 EFCAB14 KIAA0494 1 2
MIRT558265 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT558328 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 2
MIRT558767 CFL2 cofilin 2 (muscle) 1 1
MIRT561038 ASB6 ankyrin repeat and SOCS box containing 6 1 1
MIRT561325 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT561642 RUNX3 runt-related transcription factor 3 1 1
MIRT562556 CCDC71L coiled-coil domain containing 71-like 1 2
MIRT562962 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT564681 ZNF35 zinc finger protein 35 1 1
MIRT565695 SESN3 sestrin 3 1 1
MIRT565911 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT566142 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT567048 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567077 KBTBD2 kelch repeat and BTB (POZ) domain containing 2 1 1
MIRT567540 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567625 FAM210A family with sequence similarity 210, member A 1 1
MIRT570322 ZNF70 zinc finger protein 70 1 1
MIRT571760 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT571858 NKIRAS1 NFKB inhibitor interacting Ras-like 1 1 1
MIRT573373 LIMA1 LIM domain and actin binding 1 1 1
MIRT574562 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT614730 ATAT1 alpha tubulin acetyltransferase 1 1 2
MIRT617878 ESR1 estrogen receptor 1 1 1
MIRT624422 CBX8 chromobox homolog 8 1 1
MIRT625866 SLC35C2 solute carrier family 35, member C2 1 1
MIRT630704 DICER1 dicer 1, ribonuclease type III 1 2
MIRT632515 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT641798 USP32 ubiquitin specific peptidase 32 1 1
MIRT663626 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT680136 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT702389 KLF10 Kruppel-like factor 10 1 1
MIRT707831 TMEM133 transmembrane protein 133 1 1
MIRT708886 MOCS2 molybdenum cofactor synthesis 2 1 1
MIRT709123 C3orf18 chromosome 3 open reading frame 18 1 1
MIRT709636 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT710597 CDCA4 cell division cycle associated 4 1 1
MIRT710803 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT711783 RFXAP regulatory factor X-associated protein 1 1
MIRT713345 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT713641 MED8 mediator complex subunit 8 1 1
MIRT713917 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT715069 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT715207 FKTN fukutin 1 1
MIRT717308 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT717820 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT720544 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*