Accession ID: MIRT003732 [miRNA, hsa-miR-519c-3p :: ELAVL1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-519cLinkOut: [miRBase ]
Description Homo sapiens miR-519c stem-loop
Comment The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-519c-3p
Mature Sequence 54| AAAGUGCAUCUUUUUAGAGGAU |75
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-519c-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ELAVL1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ELAV1, HUR, Hua, MelG
Description ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Transcript NM_001419    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ELAVL1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ELAVL1
(miRNA target sites are highlighted)
>ELAVL1|NM_001419|3'UTR
   1 CTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACTCAT
  81 TTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCGACA
 161 TGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAAACA
 241 GAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCTGAAGCATGCTTTAACCTCTAAGACT
 321 GTCTAACACGCGTTTCATTCAATGTCTCCACAGACTGGGTAGCAAAAAAATCACCTTTTAGTTTTAGTTTTTAATCTAAA
 401 GATGTTAGACAGATGCTGAGTGTGCGTTTTCTCAACCGCTTCAACATTGTAAGCGATGTATGCTTTGGTTGACAGGAAGT
 481 TCCTTTTCCAGGCAGGTCCCGTTGCCACCTCCTGCTCACTCAGTCCCGGGCTCTGCCGAGTGGTCCTGGGAATGGCGGCG
 561 GGCCCGTCCAGCGTGGGCCACCACTGGGGCCGGGGGCCACGGGCTGCATGCTGGGCGGGCCCTCCAGAGAAGGACACAAA
 641 CGTGTTTCGTAAGCCCAGGCACCAATGGGAATGGACCAAAGAGTTTCAGGGAAACTCCAGTATATTCCAGAGTCAGATCT
 721 AAGCTCCAGGCACGCCTGAAGATGTGTTGCTACTCTGACATCCCGAGTTTCTGTCCACACATTGCATGCACAGCGCCCCA
 801 CACATTGGATACTGTTGTTCACGATAATTTCTCCCGTTTTCCAGAGCATTTAACATAGCTTGGAGGCGTAAAATGGCTCT
 881 GTATTTTAATAACACAGAAACATTTGAGCATTGTATTTCTCGCATCCCTTCTCGTGAGCGCTTAGACCTTTTTCTATTTT
 961 AGTCGGATTTTGTTTTGGAATTTTGCTTTTGTATGAACACTCAGCAGAAAAGTACTTACTTCTTGCCAGTTATCTATTAA
1041 CCAAAACCTTTGATTTGTAGTTTTAAAGATTAACCCTCAAAGTTCTCTTCATAACTGCCTTGACATTTTGGGTTGTTCTG
1121 TTCTGTTAATTTTCTTTTGCTTTTTTGTGTTTTTTGTTTGTTTTTACTTTTGCATTTAAGACCATTAAATTTGATTTTGT
1201 TTTGCTCGAATTTTGTTTTGTTTTTTATTTTACCTTTTCTTTCTTTTTGGCTAGGGAAGGTGCAGGTGGCCCAGCATTCA
1281 GGGAGGAGTCGTAAGATCTTAAGAAACCAATCCTTGCCTCAAGCAAAAGCATTTCTGAATCTGTGACGCAAGAATGTGCA
1361 GTTACAGGCTGGTGGCTTTTAAACCAGGAGCCCGGAGGAAGGGTGAAAGAGAAAGCCTGTGAAATAGGCAGGGCCAGATC
1441 ACCCAAAACTCCTCAGGACTGGGATCTGGCGTTTATAAATAACTAGTTTACAGAGAGAATCACAAACAGGATAACTTAGT
1521 ACCAGCAGTTTTTAACCTTGACGTGAGACTAAAACGTGACCGTAGGCTGTTTTTTAGTTATTGCTCTCATGAGATGATGG
1601 CTGTATTTATCTGTTTATTTATACCTATTTATGTATTTATTTATTGAAGTGTGAAATTGAGCAATAGGCAGGCACCACCG
1681 TCCCCAGAGCAGGTCAGCGTCTCGAGAGGCCCCTGGACAATTGAGGATGCCCATCCCCTCCCCTTTCCCTGATCTTTTAC
1761 TGAGGGGCTGTGTGCGCGATCCTTGCAAATTGATGATGTTGCCATCCGTACCCAGGCTGTGTCTCATAAAAGTCGGCCTG
1841 GTGCCAGAGAGGACCTCCTTTCTCCCACAGAATCCCAGATCCTCAGGAAAAGCCAAAACCGAGGCCCATTGCCCGGATTC
1921 GACACAAAAGAGGGTCCCTGCTCTGTTGCCCGAGAGCAGTCTGCATCCTGGGACCAGAATGCTTTCCTGGAAAAAGAAGC
2001 CTTTCAGGTTTCCCTGGGCCAGCATCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCAACAC
2081 CCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCA
2161 ACACCCTTCTGATGGAAGGCGGGATTCCCGCTTCTGAAACTCCCCCTGGAGTCTCACTCCCACACATGCCCATAGCTAGC
2241 ATTCAACAGAGAACTCTGTCTTAAGCTTCAACTGTGAAAATGATGACGGGCTTGTAGCACCTCAGCTTCTTTCCTCGCCC
2321 CCTTTTATCTGAATCCTATCAATTATTCTGATGCTGGGACAGGTGAGAAGAAACTGTGAAGTATATGAGCCTTTGAAAGT
2401 TCCCTGAAGTTTCTCAGTTCAGGAACATTCTCATTGTATGTGGTCTCCGCTGTTTGAACAGCCTTCTAGCTAAAAAATTC
2481 CAAAGCCTTTATTTGGGAGTCTTAGCTTGCAAGCTTGTGGAAGGATTTAGCTTAACAACTGTCACTCCTGAAAAGCAATC
2561 TCTGTTCCATCAAGGTTCTAGTTGCTGGCCCTGTGTCCTCAAAGTTCATTACATCTTATCAAGGCCTGTTTGCAAAGGGG
2641 AGATCCCTTTTCTTAAAAAAGGCTCAACCCAAAAGAAACCATTTCTTAAAAAATTTTACATAGATCAGTTGTATTTCTAT
2721 TTAGCAAAAATGAGTGCTCTGCTTTTATTTGGGAATTTCGATGAAAAAGCGTTCAGAGTAGATAATGTTCATTTATCAAA
2801 AATCTGGTTTGGGAAATACCAAAGAGGCTTTGATTGAATTCCCTTTTGACCCGTGTGTAACTTCCTCTGGTAGTTAGACC
2881 CCAGGCAGCTCCGAATTTGTGAACCTGCTTCCTGATGAATTCTCCCTTGTTCCCCCTTGGCTCTGCCATTATTTCGTTTT
2961 CAGTGTAATTTGCCAAGCCGCAGTTTTCTGTGCTGGCTGTGCCTCTAGTCGCAGCTCTGTGACTGATTCCCTCCCGGGTG
3041 CTGAGTCCCCTCCCCGGCCACCATCCTGCGTGAATATCCTGAAATTCATGGGCTTCCTCGGGGGCCCGCCCGCAGGTGGT
3121 GCTGGGTGGGTTCCGCCACCTTCTCCTGGAAGGTGAGCCTTTTCCTGGCCAAGGGCAGCTGCCTTAACCTCTGAGAGTCT
3201 GCGCTTGGCCTTAGTCCTGGAGACCCAGCCTCCAGGGACTGAACCGTGCTGCTGTTGGGAGCCAAGACCGGCCCTTTGGA
3281 GCCGGCAGCCCAGGGGTCCCTGCTGGATCAGAGAAATAGAAGCACCCGAAGACGGTTAGTGGCAATTCCTTGACCCGGTT
3361 TGCTTCCAAATGAAGGCCATTTGTCCACCAGGCATTGAAAAGACATGACTTACCCAGTCCGGCATCGGACTTGAAAAATC
3441 GAAATTGACATCACTCAGCTGTTACATTTCACATCCGATTCAGCCCCCTTTTATTTCCATGTGCTTTTCGCAGCCTTCCT
3521 GTGTTGGATGAAAGAGAATAAGAATTCAGCTGACAGGAGGCCTCTATCCTGTCCCTCCACCCCACCCTCCACCTCAATCC
3601 CCTCCCATCTTCCCCAGACCTACCTCACCTACTAGGACCTGAGGCAGCTCCTTAGCAGAGACCCCTGGGGTTTAGCTGAC
3681 TCTGGGGGTCAGGGGTTCCTGTCCCCAAACTTCGCAAGACAGCCCTGAAGTCACAAGTGCTTTCTTTTAAGTGGCATTGG
3761 CAATTGGCGTGTAATGATGGCAGTAGAATCTGAATCTCGGATCCCAGGCAGGGTTCACATTTCCAAACCTTTTTGATTTC
3841 CCCTGACCTCTAATGGCTGGATCCTATTTTTCTACAACCTTTCAGTGACATCGTTCAGGTTTCTTTCTTGGCCATTTAAA
3921 AAAACAAATTTTTTTTTTCTCACTTGTAAGTCACCGCCAGTACCTAAGTTAGGCTAACGGAGACTTTGACAGGACTGGAT
4001 TTTTCTTCCACCAGAAGAGAAGCCTTTTCCGTTGGTTTGGGGCCACCTCTTTGACCATGACCATGTGATGTTCCGTTTAC
4081 AGTGACTTGCTTTGGGGGAGGGGAGGCTCTCTTAACCGATTCCCATGTTGTACAGTAGATGGTTAGACCTTTTGTATATT
4161 AGTGTGTTTTAAGTTATTGATTTGTTTTATATAAAATAATTTATTTTTCAGGTGCCATTTTTCATTTTAACTTTGTTTTT
4241 ACATGGGTTTGTTTTCAATAAAGTCTGACACTGGTGTCCAAAAGTCAACAATAAAATGAATCCCATTGTGTTCTTTTGAA
4321 GATGCCTATGTAACTTTTAAGCTTTTTAAATTATTTTCAGAAAAAAAAAAAGAAAAGCCCTTATCAGTTTTCCATCAGCC
4401 CATTGCCTTTTTATTTTTTTTTTTTAATCCTTGTGAATAAATGTTCTTTAGTGTTTTAGGAGGAAAAAGCAAACCTAGAT
4481 TTTGATAACCCAGAAGACTTCAGATTAATAAAGAAGCTTTGAAAGAAGACCATTTTTCAAAATTTTAGTGAAGTGTGAAT
4561 ATTTTTTGTCAATGGCTTTCTCAAAGAGAATGAAACTTTTGCACCATTTTCAGAGTTTTTATAGAGATGCCAAATTGATA
4641 TATTTACATGTAATGGAAACATGAAAAAGTTTTATTAAACAATTGTTCATAGCTGTGTAGACATTTTAATTCAGTTTCCA
4721 AAGCTCTCAAAAAATCGTATTTTTGAAGTACGGAGTGATGCGGTTTGGGGCGTGGCTTACAGTTCCAACGACTCAATTGT
4801 CCCGATACTCAGTTCTTTCTACAGGTATCAGGTTCGTGTTAAACGCTGTATGTTAACTATGACTGGAATTCTGTGATATT
4881 TTGGTAATAAATGAAGTGGGATCATTGCGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uaGGAGAUUUUUCUACGUGAAa 5'
            |||||:|:|:  |||:||| 
Target 5' aaCCTCTGAGAGTCTGCGCTTg 3'
3186 - 3207 156.00 -20.80
2
miRNA  3' uaggAGAUUUUUCU--ACGUGAaa 5'
              |||||: |||  ||||:|  
Target 5' gaaaTCTAAGTAGAACTGCATTga 3'
241 - 264 132.00 -10.20
3
miRNA  3' uaggagaUUUUUCUACGUGAAa 5'
                 ||:|| :|||| || 
Target 5' gtgacgcAAGAATGTGCAGTTa 3'
1343 - 1364 127.00 -6.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-519c-3p :: ELAVL1    [ Functional MTI ]
Validation Method qRT-PCR , Western blot ,
Conditions HeLa , HCT116 , RKO
Location of target site CDS, 3'UTR
Tools used in this research RNA22
Original Description (Extracted from the article) ... The influence of miR-519 was recapitulated using heterologous reporter constructs that revealed a greater repressive effect on the HuR CR than the HuR 3-UTR target sequences. miR-519 did not alter HuR mRNA abundance, but reduced HuR biosynthesis, as determined by measuring nascent HuR translation and HuR mRNA association with polysomes. We describe the repression of HuR expression by miR-519. Our findings indicate that miR-519 reduces HuR translation and not HuR mRNA levels or stability, since miR-519 overexpression specifically lowered HuR nascent translation and miR-519 inhibi- tion elevated it. ...

- Abdelmohsen, K. Srikantan, S. Kuwano, Y. et al., 2008, Proc Natl Acad Sci U S A.

Article - Abdelmohsen, K. Srikantan, S. Kuwano, Y. et al.
- Proc Natl Acad Sci U S A, 2008
Gene expression is potently regulated through the action of RNA-binding proteins (RBPs) and microRNAs (miRNAs). Here, we present evidence of a miRNA regulating an RBP. The RBP HuR can stabilize and modulate the translation of numerous target mRNAs involved in cell proliferation, but little is known about the mechanisms that regulate HuR abundance. We identified two putative sites of miR-519 interaction on the HuR mRNA, one in its coding region (CR), one in its 3'-untranslated region (UTR). In several human carcinoma cell lines tested, HeLa (cervical), HCT116 and RKO (colon), and A2780 (ovarian), overexpression of a miR-519 precursor [(Pre)miR-519] reduced HuR abundance, while inhibiting miR-519 by using an antisense RNA [(AS)miR-519] elevated HuR levels. The influence of miR-519 was recapitulated using heterologous reporter constructs that revealed a greater repressive effect on the HuR CR than the HuR 3'-UTR target sequences. miR-519 did not alter HuR mRNA abundance, but reduced HuR biosynthesis, as determined by measuring nascent HuR translation and HuR mRNA association with polysomes. Modulation of miR-519 leading to altered HuR levels in turn affected the levels of proteins encoded by HuR target mRNAs. In keeping with HuR's proliferative influence, (AS)miR-519 significantly increased cell number and [(3)H]-thymidine incorporation, while (Pre)miR-519 reduced these parameters. Importantly, the growth-promoting effects of (AS)miR-519 required the presence of HuR, because downregulation of HuR by RNAi dramatically suppressed its proliferative action. In sum, miR-519 represses HuR translation, in turn reducing HuR-regulated gene expression and cell division.
LinkOut: [PMID: 19088191]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
325 hsa-miR-519c-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000496 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 4 1
MIRT000998 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 4 3
MIRT003732 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 3 1
MIRT006639 TIMP2 TIMP metallopeptidase inhibitor 2 3 1
MIRT006640 PTEN phosphatase and tensin homolog 3 1
MIRT006641 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 3 1
MIRT055028 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT055393 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT056828 REEP3 receptor accessory protein 3 1 1
MIRT060504 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT061796 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT063354 ETNK1 ethanolamine kinase 1 1 1
MIRT064424 ARID4B AT rich interactive domain 4B (RBP1-like) 1 1
MIRT064719 CCND2 cyclin D2 1 1
MIRT064805 ZBTB18 zinc finger protein 238 1 2
MIRT065609 DAZAP2 DAZ associated protein 2 1 5
MIRT065622 CLIC4 chloride intracellular channel 4 1 2
MIRT065872 GDF11 growth differentiation factor 11 1 1
MIRT065892 RAB5B RAB5B, member RAS oncogene family 1 4
MIRT068751 RB1 retinoblastoma 1 1 1
MIRT070050 FANCM Fanconi anemia, complementation group M 1 1
MIRT071004 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071334 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 3
MIRT071912 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT072732 GLCE glucuronic acid epimerase 1 1
MIRT076028 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 3
MIRT076046 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT079353 CCDC137 coiled-coil domain containing 137 1 1
MIRT080227 SMAD4 SMAD family member 4 1 3
MIRT081122 LDLR low density lipoprotein receptor 1 4
MIRT081205 MIDN midnolin 1 5
MIRT085098 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 3
MIRT085149 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 2
MIRT086436 NABP1 nucleic acid binding protein 1 1 3
MIRT088037 UBXN2A UBX domain protein 2A 1 1
MIRT088132 SEPT2 septin 2 1 2
MIRT088343 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090645 U2SURP U2 snRNP-associated SURP domain containing 1 3
MIRT090805 MBNL1 muscleblind-like splicing regulator 1 1 2
MIRT091692 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 2
MIRT092689 C3ORF38 chromosome 3 open reading frame 38 1 4
MIRT093954 SLAIN2 SLAIN motif family, member 2 1 1
MIRT095727 ANKH ankylosis, progressive homolog (mouse) 1 4
MIRT097158 FCHO2 FCH domain only 2 1 1
MIRT099319 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099835 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100773 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 1
MIRT100955 CENPQ centromere protein Q 1 2
MIRT102229 HBP1 HMG-box transcription factor 1 1 1
MIRT102299 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 5
MIRT102621 UBN2 ubinuclein 2 1 4
MIRT103780 PURB purine-rich element binding protein B 1 1
MIRT104168 PHTF2 putative homeodomain transcription factor 2 1 3
MIRT107279 FAM73B family with sequence similarity 73, member B 1 1
MIRT107945 TMEM2 transmembrane protein 2 1 1
MIRT108265 HABP4 hyaluronan binding protein 4 1 1
MIRT124812 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT138707 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT139880 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT144312 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 4
MIRT145605 LASP1 LIM and SH3 protein 1 1 1
MIRT153350 MAVS mitochondrial antiviral signaling protein 1 2
MIRT153986 PRNP prion protein 1 1
MIRT159129 NRBP1 nuclear receptor binding protein 1 1 1
MIRT164533 MSMO1 methylsterol monooxygenase 1 1 1
MIRT165912 CREBRF CREB3 regulatory factor 1 1
MIRT170858 TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein 1 1 2
MIRT172157 FZD6 frizzled family receptor 6 1 4
MIRT173701 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT175003 ZBTB5 zinc finger and BTB domain containing 5 1 2
MIRT175400 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT178069 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT178675 FAM102B family with sequence similarity 102, member B 1 1
MIRT180847 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 2
MIRT194911 RBBP6 retinoblastoma binding protein 6 1 4
MIRT195755 ATMIN ATM interactor 1 3
MIRT196623 TAOK1 TAO kinase 1 1 3
MIRT205286 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT206051 PPARA peroxisome proliferator-activated receptor alpha 1 1
MIRT206198 RAB10 RAB10, member RAS oncogene family 1 2
MIRT208980 SKIL SKI-like oncogene 1 5
MIRT223637 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 2
MIRT224757 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT227995 NFIB nuclear factor I/B 1 2
MIRT230973 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT238183 ANKRD33B ankyrin repeat domain 33B 1 5
MIRT242425 HAS3 hyaluronan synthase 3 1 1
MIRT242666 SALL3 sal-like 3 (Drosophila) 1 2
MIRT242765 FNBP1L formin binding protein 1-like 1 3
MIRT243095 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT243437 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT243964 MAP1B microtubule-associated protein 1B 1 1
MIRT244776 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT246630 TMEM109 transmembrane protein 109 1 1
MIRT246968 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT266055 FJX1 four jointed box 1 (Drosophila) 1 2
MIRT266858 SLC25A44 solute carrier family 25, member 44 1 1
MIRT283184 C16ORF52 chromosome 16 open reading frame 52 1 1
MIRT286955 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT293651 PVR poliovirus receptor 1 2
MIRT295178 ZNF317 zinc finger protein 317 1 2
MIRT302453 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT303499 NAGK N-acetylglucosamine kinase 1 3
MIRT368755 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT383207 APH1A anterior pharynx defective 1 homolog A (C. elegans) 1 1
MIRT383610 POU2F1 POU class 2 homeobox 1 1 1
MIRT396102 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT441419 FAM9C family with sequence similarity 9, member C 1 1
MIRT446818 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT448307 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT461781 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT462816 NTN1 netrin 1 1 1
MIRT463613 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT464560 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT464842 RPS27A ribosomal protein S27a 1 6
MIRT465225 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT466446 TFAM transcription factor A, mitochondrial 1 4
MIRT466836 STX6 syntaxin 6 1 3
MIRT467185 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 1
MIRT468179 SGMS1 sphingomyelin synthase 1 1 1
MIRT469850 PXK PX domain containing serine/threonine kinase 1 4
MIRT471612 PAQR5 progestin and adipoQ receptor family member V 1 9
MIRT472008 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT472159 NIN ninein (GSK3B interacting protein) 1 2
MIRT472336 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 2
MIRT473162 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT473623 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT473682 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT473805 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT474416 KLHL28 kelch-like 28 (Drosophila) 1 4
MIRT474736 KIF13A kinesin family member 13A 1 3
MIRT474966 KCTD10 potassium channel tetramerisation domain containing 10 1 2
MIRT475464 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476120 GPR157 G protein-coupled receptor 157 1 1
MIRT476203 GNS glucosamine (N-acetyl)-6-sulfatase 1 3
MIRT477180 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT478103 DLG5 discs, large homolog 5 (Drosophila) 1 3
MIRT478713 CSNK1A1 casein kinase 1, alpha 1 1 3
MIRT479055 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 4
MIRT480008 CAPRIN2 caprin family member 2 1 2
MIRT480519 C11orf30 chromosome 11 open reading frame 30 1 5
MIRT480822 BLCAP bladder cancer associated protein 1 5
MIRT480944 BBX bobby sox homolog (Drosophila) 1 4
MIRT481336 ATL3 atlastin GTPase 3 1 1
MIRT481598 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT481877 ANKRD50 ankyrin repeat domain 50 1 1
MIRT482471 ADAR adenosine deaminase, RNA-specific 1 2
MIRT484875 ZNF652 zinc finger protein 652 1 1
MIRT485090 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT485579 FOXQ1 forkhead box Q1 1 1
MIRT485618 FBXL5 F-box and leucine-rich repeat protein 5 1 5
MIRT486751 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT489599 ZDHHC20 zinc finger, DHHC-type containing 20 1 5
MIRT489889 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT491654 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT492038 TSG101 tumor susceptibility gene 101 1 2
MIRT492361 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT492776 PDGFB platelet-derived growth factor beta polypeptide 1 1
MIRT493336 LAPTM4A lysosomal protein transmembrane 4 alpha 1 6
MIRT493611 HMGB3 high mobility group box 3 1 3
MIRT497468 DDR2 discoidin domain receptor tyrosine kinase 2 1 1
MIRT498059 SNX5 sorting nexin 5 1 3
MIRT499901 KIAA1191 KIAA1191 1 2
MIRT500489 ZBTB4 zinc finger and BTB domain containing 4 1 3
MIRT500685 TRIM37 tripartite motif containing 37 1 1
MIRT500760 TMEM127 transmembrane protein 127 1 3
MIRT501456 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 4
MIRT501559 POC1B-GALNT4 POC1B-GALNT4 readthrough 1 1
MIRT501983 MAPK1 mitogen-activated protein kinase 1 1 5
MIRT502000 MAP7 microtubule-associated protein 7 1 4
MIRT502049 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 3
MIRT502423 GALNT4 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) 1 1
MIRT503044 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT503821 TMEM242 transmembrane protein 242 1 2
MIRT504290 PARP1 poly (ADP-ribose) polymerase 1 1 3
MIRT504560 ZNF417 zinc finger protein 417 1 3
MIRT505054 ZNF202 zinc finger protein 202 1 3
MIRT505486 SRSF2 serine/arginine-rich splicing factor 2 1 2
MIRT505836 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT506372 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT506451 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506673 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT506834 KIF23 kinesin family member 23 1 2
MIRT506880 KIAA0101 KIAA0101 1 3
MIRT507359 FAM129A family with sequence similarity 129, member A 1 3
MIRT507957 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 1 3
MIRT509433 MCM7 minichromosome maintenance complex component 7 1 3
MIRT510872 RAN RAN, member RAS oncogene family 1 4
MIRT511078 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 2
MIRT511254 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT513699 RBM20 RNA binding motif protein 20 1 2
MIRT513742 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT513981 CEP97 centrosomal protein 97kDa 1 1
MIRT514092 EPS15L1 epidermal growth factor receptor pathway substrate 15-like 1 1 3
MIRT515928 MFAP2 microfibrillar-associated protein 2 1 2
MIRT519574 ZNFX1 zinc finger, NFX1-type containing 1 1 2
MIRT521297 RRAGD Ras-related GTP binding D 1 2
MIRT521348 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT521693 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 4
MIRT521778 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 4
MIRT522191 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 3
MIRT524696 BTG3 BTG family, member 3 1 4
MIRT525663 NHSL2 NHS-like 2 1 1
MIRT527252 TMEM196 transmembrane protein 196 1 1
MIRT527466 CLEC12B C-type lectin domain family 12, member B 1 1
MIRT529535 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT530146 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT530851 RAG1 recombination activating gene 1 1 2
MIRT531109 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT534263 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT534756 RASGEF1A RasGEF domain family, member 1A 1 1
MIRT535175 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT535246 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT535401 PER1 period homolog 1 (Drosophila) 1 1
MIRT536036 MCUR1 coiled-coil domain containing 90A 1 1
MIRT536347 LEFTY1 left-right determination factor 1 1 1
MIRT536413 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT536437 KMT2B myeloid/lymphoid or mixed-lineage leukemia 4 1 3
MIRT536604 IRF2 interferon regulatory factor 2 1 1
MIRT536642 INO80D INO80 complex subunit D 1 1
MIRT536860 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 1 1
MIRT537241 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT537728 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT537988 DPP8 dipeptidyl-peptidase 8 1 1
MIRT538037 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT538255 CUL3 cullin 3 1 2
MIRT538525 CLCN3 chloride channel, voltage-sensitive 3 1 1
MIRT538659 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT538779 C7orf60 chromosome 7 open reading frame 60 1 2
MIRT538849 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT538923 BRI3BP BRI3 binding protein 1 3
MIRT539114 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT539454 ADARB2 adenosine deaminase, RNA-specific, B2 1 1
MIRT541085 RLIM ring finger protein, LIM domain interacting 1 1
MIRT543117 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT543181 FICD FIC domain containing 1 1
MIRT543575 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544113 IPMK inositol polyphosphate multikinase 1 1
MIRT544625 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT544699 ZNF224 zinc finger protein 224 1 2
MIRT544992 MFF mitochondrial fission factor 1 2
MIRT546248 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT546282 TMEM30A transmembrane protein 30A 1 2
MIRT546290 TMEM200C transmembrane protein 200C 1 2
MIRT546558 SATB2 SATB homeobox 2 1 1
MIRT546815 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT547046 POGZ pogo transposable element with ZNF domain 1 1
MIRT547474 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT547761 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT547892 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT548315 EPHA4 EPH receptor A4 1 1
MIRT548383 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548460 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548579 DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 1 1
MIRT548858 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT548896 CHEK2 checkpoint kinase 2 1 2
MIRT549319 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT550302 ZNF681 zinc finger protein 681 1 1
MIRT551120 ZNF107 zinc finger protein 107 1 1
MIRT551406 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT552173 DAD1 defender against cell death 1 1 1
MIRT552856 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552892 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553075 UEVLD UEV and lactate/malate dehyrogenase domains 1 1
MIRT553668 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 2
MIRT553700 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT554608 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT554860 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT556157 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT556179 MCC mutated in colorectal cancers 1 1
MIRT556529 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT556723 KLHL21 kelch-like 21 (Drosophila) 1 2
MIRT557054 HOXB3 homeobox B3 1 1
MIRT557587 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT557661 GATA6 GATA binding protein 6 1 1
MIRT557753 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT557881 FEM1B fem-1 homolog b (C. elegans) 1 2
MIRT558215 EFCAB14 KIAA0494 1 2
MIRT558264 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT558327 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 2
MIRT558766 CFL2 cofilin 2 (muscle) 1 1
MIRT561037 ASB6 ankyrin repeat and SOCS box containing 6 1 1
MIRT561324 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT561641 RUNX3 runt-related transcription factor 3 1 1
MIRT562555 CCDC71L coiled-coil domain containing 71-like 1 2
MIRT562961 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT564680 ZNF35 zinc finger protein 35 1 1
MIRT565694 SESN3 sestrin 3 1 1
MIRT565910 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT566141 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT567047 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567076 KBTBD2 kelch repeat and BTB (POZ) domain containing 2 1 1
MIRT567539 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567624 FAM210A family with sequence similarity 210, member A 1 1
MIRT570321 ZNF70 zinc finger protein 70 1 1
MIRT571759 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT571857 NKIRAS1 NFKB inhibitor interacting Ras-like 1 1 1
MIRT573372 LIMA1 LIM domain and actin binding 1 1 1
MIRT574561 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT614729 ATAT1 alpha tubulin acetyltransferase 1 1 2
MIRT617877 ESR1 estrogen receptor 1 1 1
MIRT624421 CBX8 chromobox homolog 8 1 1
MIRT625865 SLC35C2 solute carrier family 35, member C2 1 1
MIRT630703 DICER1 dicer 1, ribonuclease type III 1 2
MIRT632514 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT641797 USP32 ubiquitin specific peptidase 32 1 1
MIRT663625 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT680135 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT702388 KLF10 Kruppel-like factor 10 1 1
MIRT707830 TMEM133 transmembrane protein 133 1 1
MIRT708885 MOCS2 molybdenum cofactor synthesis 2 1 1
MIRT709122 C3orf18 chromosome 3 open reading frame 18 1 1
MIRT709635 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT710596 CDCA4 cell division cycle associated 4 1 1
MIRT710802 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT711782 RFXAP regulatory factor X-associated protein 1 1
MIRT713344 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT713640 MED8 mediator complex subunit 8 1 1
MIRT713916 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT715068 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT715206 FKTN fukutin 1 1
MIRT717819 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT720543 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT720636 ELF5 E74-like factor 5 (ets domain transcription factor) 1 1
MIRT721703 ISY1 ISY1 splicing factor homolog (S. cerevisiae) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*