Accession ID: MIRT003732 [miRNA, hsa-miR-519c-3p :: ELAVL1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-519cLinkOut: [miRBase ]
Description Homo sapiens miR-519c stem-loop
Comment The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-519c-3p
Mature Sequence 54| AAAGUGCAUCUUUUUAGAGGAU |75
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-519c-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ELAVL1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ELAV1, HUR, Hua, MelG
Description ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Transcript NM_0014    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ELAVL1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ELAVL1
(miRNA target sites are highlighted)
>ELAVL1|NM_0014|3'UTR
   1 TAACTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACT
  81 CATTTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCG
 161 ACATGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAA
 241 ACAGAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCTGAAGCATGCTTTAACCTCTAAG
 321 ACTGTCTAACACGCGTTTCATTCAATGTCTCCACAGACTGGGTAGCAAAAAAATCACCTTTTAGTTTTAGTTTTTAATCT
 401 AAAGATGTTAGACAGATGCTGAGTGTGCGTTTTCTCAACCGCTTCAACATTGTAAGCGATGTATGCTTTGGTTGACAGGA
 481 AGTTCCTTTTCCAGGCAGGTCCCGTTGCCACCTCCTGCTCACTCAGTCCCGGGCTCTGCCGAGTGGTCCTGGGAATGGCG
 561 GCGGGCCCGTCCAGCGTGGGCCACCACTGGGGCCGGGGGCCACGGGCTGCATGCTGGGCGGGCCCTCCAGAGAAGGACAC
 641 AAACGTGTTTCGTAAGCCCAGGCACCAATGGGAATGGACCAAAGAGTTTCAGGGAAACTCCAGTATATTCCAGAGTCAGA
 721 TCTAAGCTCCAGGCACGCCTGAAGATGTGTTGCTACTCTGACATCCCGAGTTTCTGTCCACACATTGCATGCACAGCGCC
 801 CCACACATTGGATACTGTTGTTCACGATAATTTCTCCCGTTTTCCAGAGCATTTAACATAGCTTGGAGGCGTAAAATGGC
 881 TCTGTATTTTAATAACACAGAAACATTTGAGCATTGTATTTCTCGCATCCCTTCTCGTGAGCGCTTAGACCTTTTTCTAT
 961 TTTAGTCGGATTTTGTTTTGGAATTTTGCTTTTGTATGAACACTCAGCAGAAAAGTACTTACTTCTTGCCAGTTATCTAT
1041 TAACCAAAACCTTTGATTTGTAGTTTTAAAGATTAACCCTCAAAGTTCTCTTCATAACTGCCTTGACATTTTGGGTTGTT
1121 CTGTTCTGTTAATTTTCTTTTGCTTTTTTGTGTTTTTTGTTTGTTTTTACTTTTGCATTTAAGACCATTAAATTTGATTT
1201 TGTTTTGCTCGAATTTTGTTTTGTTTTTTATTTTACCTTTTCTTTCTTTTTGGCTAGGGAAGGTGCAGGTGGCCCAGCAT
1281 TCAGGGAGGAGTCGTAAGATCTTAAGAAACCAATCCTTGCCTCAAGCAAAAGCATTTCTGAATCTGTGACGCAAGAATGT
1361 GCAGTTACAGGCTGGTGGCTTTTAAACCAGGAGCCCGGAGGAAGGGTGAAAGAGAAAGCCTGTGAAATAGGCAGGGCCAG
1441 ATCACCCAAAACTCCTCAGGACTGGGATCTGGCGTTTATAAATAACTAGTTTACAGAGAGAATCACAAACAGGATAACTT
1521 AGTACCAGCAGTTTTTAACCTTGACGTGAGACTAAAACGTGACCGTAGGCTGTTTTTTAGTTATTGCTCTCATGAGATGA
1601 TGGCTGTATTTATCTGTTTATTTATACCTATTTATGTATTTATTTATTGAAGTGTGAAATTGAGCAATAGGCAGGCACCA
1681 CCGTCCCCAGAGCAGGTCAGCGTCTCGAGAGGCCCCTGGACAATTGAGGATGCCCATCCCCTCCCCTTTCCCTGATCTTT
1761 TACTGAGGGGCTGTGTGCGCGATCCTTGCAAATTGATGATGTTGCCATCCGTACCCAGGCTGTGTCTCATAAAAGTCGGC
1841 CTGGTGCCAGAGAGGACCTCCTTTCTCCCACAGAATCCCAGATCCTCAGGAAAAGCCAAAACCGAGGCCCATTGCCCGGA
1921 TTCGACACAAAAGAGGGTCCCTGCTCTGTTGCCCGAGAGCAGTCTGCATCCTGGGACCAGAATGCTTTCCTGGAAAAAGA
2001 AGCCTTTCAGGTTTCCCTGGGCCAGCATCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCAA
2081 CACCCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAG
2161 CCAACACCCTTCTGATGGAAGGCGGGATTCCCGCTTCTGAAACTCCCCCTGGAGTCTCACTCCCACACATGCCCATAGCT
2241 AGCATTCAACAGAGAACTCTGTCTTAAGCTTCAACTGTGAAAATGATGACGGGCTTGTAGCACCTCAGCTTCTTTCCTCG
2321 CCCCCTTTTATCTGAATCCTATCAATTATTCTGATGCTGGGACAGGTGAGAAGAAACTGTGAAGTATATGAGCCTTTGAA
2401 AGTTCCCTGAAGTTTCTCAGTTCAGGAACATTCTCATTGTATGTGGTCTCCGCTGTTTGAACAGCCTTCTAGCTAAAAAA
2481 TTCCAAAGCCTTTATTTGGGAGTCTTAGCTTGCAAGCTTGTGGAAGGATTTAGCTTAACAACTGTCACTCCTGAAAAGCA
2561 ATCTCTGTTCCATCAAGGTTCTAGTTGCTGGCCCTGTGTCCTCAAAGTTCATTACATCTTATCAAGGCCTGTTTGCAAAG
2641 GGGAGATCCCTTTTCTTAAAAAAGGCTCAACCCAAAAGAAACCATTTCTTAAAAAATTTTACATAGATCAGTTGTATTTC
2721 TATTTAGCAAAAATGAGTGCTCTGCTTTTATTTGGGAATTTCGATGAAAAAGCGTTCAGAGTAGATAATGTTCATTTATC
2801 AAAAATCTGGTTTGGGAAATACCAAAGAGGCTTTGATTGAATTCCCTTTTGACCCGTGTGTAACTTCCTCTGGTAGTTAG
2881 ACCCCAGGCAGCTCCGAATTTGTGAACCTGCTTCCTGATGAATTCTCCCTTGTTCCCCCTTGGCTCTGCCATTATTTCGT
2961 TTTCAGTGTAATTTGCCAAGCCGCAGTTTTCTGTGCTGGCTGTGCCTCTAGTCGCAGCTCTGTGACTGATTCCCTCCCGG
3041 GTGCTGAGTCCCCTCCCCGGCCACCATCCTGCGTGAATATCCTGAAATTCATGGGCTTCCTCGGGGGCCCGCCCGCAGGT
3121 GGTGCTGGGTGGGTTCCGCCACCTTCTCCTGGAAGGTGAGCCTTTTCCTGGCCAAGGGCAGCTGCCTTAACCTCTGAGAG
3201 TCTGCGCTTGGCCTTAGTCCTGGAGACCCAGCCTCCAGGGACTGAACCGTGCTGCTGTTGGGAGCCAAGACCGGCCCTTT
3281 GGAGCCGGCAGCCCAGGGGTCCCTGCTGGATCAGAGAAATAGAAGCACCCGAAGACGGTTAGTGGCAATTCCTTGACCCG
3361 GTTTGCTTCCAAATGAAGGCCATTTGTCCACCAGGCATTGAAAAGACATGACTTACCCAGTCCGGCATCGGACTTGAAAA
3441 ATCGAAATTGACATCACTCAGCTGTTACATTTCACATCCGATTCAGCCCCCTTTTATTTCCATGTGCTTTTCGCAGCCTT
3521 CCTGTGTTGGATGAAAGAGAATAAGAATTCAGCTGACAGGAGGCCTCTATCCTGTCCCTCCACCCCACCCTCCACCTCAA
3601 TCCCCTCCCATCTTCCCCAGACCTACCTCACCTACTAGGACCTGAGGCAGCTCCTTAGCAGAGACCCCTGGGGTTTAGCT
3681 GACTCTGGGGGTCAGGGGTTCCTGTCCCCAAACTTCGCAAGACAGCCCTGAAGTCACAAGTGCTTTCTTTTAAGTGGCAT
3761 TGGCAATTGGCGTGTAATGATGGCAGTAGAATCTGAATCTCGGATCCCAGGCAGGGTTCACATTTCCAAACCTTTTTGAT
3841 TTCCCCTGACCTCTAATGGCTGGATCCTATTTTTCTACAACCTTTCAGTGACATCGTTCAGGTTTCTTTCTTGGCCATTT
3921 AAAAAAACAAATTTTTTTTTTCTCACTTGTAAGTCACCGCCAGTACCTAAGTTAGGCTAACGGAGACTTTGACAGGACTG
4001 GATTTTTCTTCCACCAGAAGAGAAGCCTTTTCCGTTGGTTTGGGGCCACCTCTTTGACCATGACCATGTGATGTTCCGTT
4081 TACAGTGACTTGCTTTGGGGGAGGGGAGGCTCTCTTAACCGATTCCCATGTTGTACAGTAGATGGTTAGACCTTTTGTAT
4161 ATTAGTGTGTTTTAAGTTATTGATTTGTTTTATATAAAATAATTTATTTTTCAGGTGCCATTTTTCATTTTAACTTTGTT
4241 TTTACATGGGTTTGTTTTCAATAAAGTCTGACACTGGTGTCCAAAAGTCAACAATAAAATGAATCCCATTGTGTTCTTTT
4321 GAAGATGCCTATGTAACTTTTAAGCTTTTTAAATTATTTTCAGAAAAAAAAAAAGAAAAGCCCTTATCAGTTTTCCATCA
4401 GCCCATTGCCTTTTTATTTTTTTTTTTTAATCCTTGTGAATAAATGTTCTTTAGTGTTTTAGGAGGAAAAAGCAAACCTA
4481 GATTTTGATAACCCAGAAGACTTCAGATTAATAAAGAAGCTTTGAAAGAAGACCATTTTTCAAAATTTTAGTGAAGTGTG
4561 AATATTTTTTGTCAATGGCTTTCTCAAAGAGAATGAAACTTTTGCACCATTTTCAGAGTTTTTATAGAGATGCCAAATTG
4641 ATATATTTACATGTAATGGAAACATGAAAAAGTTTTATTAAACAATTGTTCATAGCTGTGTAGACATTTTAATTCAGTTT
4721 CCAAAGCTCTCAAAAAATCGTATTTTTGAAGTACGGAGTGATGCGGTTTGGGGCGTGGCTTACAGTTCCAACGACTCAAT
4801 TGTCCCGATACTCAGTTCTTTCTACAGGTATCAGGTTCGTGTTAAACGCTGTATGTTAACTATGACTGGAATTCTGTGAT
4881 ATTTTGGTAATAAATGAAGTGGGATCATTGCGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uaGGAGAUUUUUCUACGUGAAa 5'
            |||||:|:|:  |||:||| 
Target 5' aaCCTCTGAGAGTCTGCGCTTg 3'
3189 - 3210 156.00 -20.80
2
miRNA  3' uaggAGAUUUUUCU--ACGUGAaa 5'
              |||||: |||  ||||:|  
Target 5' gaaaTCTAAGTAGAACTGCATTga 3'
244 - 267 132.00 -10.20
3
miRNA  3' uaggagaUUUUUCUACGUGAAa 5'
                 ||:|| :|||| || 
Target 5' gtgacgcAAGAATGTGCAGTTa 3'
1346 - 1367 127.00 -6.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-519c-3p :: ELAVL1    [ Functional MTI ]
Validation Method qRT-PCR , Western blot ,
Conditions HeLa , HCT116 , RKO
Location of target site CDS, 3'UTR
Tools used in this research RNA22
Original Description (Extracted from the article) ... The influence of miR-519 was recapitulated using heterologous reporter constructs that revealed a greater repressive effect on the HuR CR than the HuR 3-UTR target sequences. miR-519 did not alter HuR mRNA abundance, but reduced HuR biosynthesis, as determined by measuring nascent HuR translation and HuR mRNA association with polysomes. We describe the repression of HuR expression by miR-519. Our findings indicate that miR-519 reduces HuR translation and not HuR mRNA levels or stability, since miR-519 overexpression specifically lowered HuR nascent translation and miR-519 inhibi- tion elevated it. ...

- Abdelmohsen, K. Srikantan, S. Kuwano, Y. et al., 2008, Proc Natl Acad Sci U S A.

Article - Abdelmohsen, K. Srikantan, S. Kuwano, Y. et al.
- Proc Natl Acad Sci U S A, 2008
Gene expression is potently regulated through the action of RNA-binding proteins (RBPs) and microRNAs (miRNAs). Here, we present evidence of a miRNA regulating an RBP. The RBP HuR can stabilize and modulate the translation of numerous target mRNAs involved in cell proliferation, but little is known about the mechanisms that regulate HuR abundance. We identified two putative sites of miR-519 interaction on the HuR mRNA, one in its coding region (CR), one in its 3'-untranslated region (UTR). In several human carcinoma cell lines tested, HeLa (cervical), HCT116 and RKO (colon), and A2780 (ovarian), overexpression of a miR-519 precursor [(Pre)miR-519] reduced HuR abundance, while inhibiting miR-519 by using an antisense RNA [(AS)miR-519] elevated HuR levels. The influence of miR-519 was recapitulated using heterologous reporter constructs that revealed a greater repressive effect on the HuR CR than the HuR 3'-UTR target sequences. miR-519 did not alter HuR mRNA abundance, but reduced HuR biosynthesis, as determined by measuring nascent HuR translation and HuR mRNA association with polysomes. Modulation of miR-519 leading to altered HuR levels in turn affected the levels of proteins encoded by HuR target mRNAs. In keeping with HuR's proliferative influence, (AS)miR-519 significantly increased cell number and [(3)H]-thymidine incorporation, while (Pre)miR-519 reduced these parameters. Importantly, the growth-promoting effects of (AS)miR-519 required the presence of HuR, because downregulation of HuR by RNAi dramatically suppressed its proliferative action. In sum, miR-519 represses HuR translation, in turn reducing HuR-regulated gene expression and cell division.
LinkOut: [PMID: 19088191]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
6 hsa-miR-519c-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000496 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 4 1
MIRT000998 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 4 3
MIRT003732 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 3 1
MIRT006639 TIMP2 TIMP metallopeptidase inhibitor 2 3 1
MIRT006640 PTEN phosphatase and tensin homolog 3 1
MIRT006641 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 3 1