Accession ID: MIRT003733 [miRNA, hsa-miR-519a-3p :: ELAVL1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-519a-1LinkOut: [miRBase ]
Synonyms MIRN519A-1, MIRN519A1, MIR519A1
Description Homo sapiens miR-519a-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-519a-3p
Mature Sequence 53| AAAGUGCAUCCUUUUAGAGUGU |74
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-519a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ELAVL1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ELAV1, HUR, Hua, MelG
Description ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Transcript NM_001419    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ELAVL1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ELAVL1
(miRNA target sites are highlighted)
>ELAVL1|NM_001419|3'UTR
   1 CTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACTCAT
  81 TTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCGACA
 161 TGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAAACA
 241 GAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCTGAAGCATGCTTTAACCTCTAAGACT
 321 GTCTAACACGCGTTTCATTCAATGTCTCCACAGACTGGGTAGCAAAAAAATCACCTTTTAGTTTTAGTTTTTAATCTAAA
 401 GATGTTAGACAGATGCTGAGTGTGCGTTTTCTCAACCGCTTCAACATTGTAAGCGATGTATGCTTTGGTTGACAGGAAGT
 481 TCCTTTTCCAGGCAGGTCCCGTTGCCACCTCCTGCTCACTCAGTCCCGGGCTCTGCCGAGTGGTCCTGGGAATGGCGGCG
 561 GGCCCGTCCAGCGTGGGCCACCACTGGGGCCGGGGGCCACGGGCTGCATGCTGGGCGGGCCCTCCAGAGAAGGACACAAA
 641 CGTGTTTCGTAAGCCCAGGCACCAATGGGAATGGACCAAAGAGTTTCAGGGAAACTCCAGTATATTCCAGAGTCAGATCT
 721 AAGCTCCAGGCACGCCTGAAGATGTGTTGCTACTCTGACATCCCGAGTTTCTGTCCACACATTGCATGCACAGCGCCCCA
 801 CACATTGGATACTGTTGTTCACGATAATTTCTCCCGTTTTCCAGAGCATTTAACATAGCTTGGAGGCGTAAAATGGCTCT
 881 GTATTTTAATAACACAGAAACATTTGAGCATTGTATTTCTCGCATCCCTTCTCGTGAGCGCTTAGACCTTTTTCTATTTT
 961 AGTCGGATTTTGTTTTGGAATTTTGCTTTTGTATGAACACTCAGCAGAAAAGTACTTACTTCTTGCCAGTTATCTATTAA
1041 CCAAAACCTTTGATTTGTAGTTTTAAAGATTAACCCTCAAAGTTCTCTTCATAACTGCCTTGACATTTTGGGTTGTTCTG
1121 TTCTGTTAATTTTCTTTTGCTTTTTTGTGTTTTTTGTTTGTTTTTACTTTTGCATTTAAGACCATTAAATTTGATTTTGT
1201 TTTGCTCGAATTTTGTTTTGTTTTTTATTTTACCTTTTCTTTCTTTTTGGCTAGGGAAGGTGCAGGTGGCCCAGCATTCA
1281 GGGAGGAGTCGTAAGATCTTAAGAAACCAATCCTTGCCTCAAGCAAAAGCATTTCTGAATCTGTGACGCAAGAATGTGCA
1361 GTTACAGGCTGGTGGCTTTTAAACCAGGAGCCCGGAGGAAGGGTGAAAGAGAAAGCCTGTGAAATAGGCAGGGCCAGATC
1441 ACCCAAAACTCCTCAGGACTGGGATCTGGCGTTTATAAATAACTAGTTTACAGAGAGAATCACAAACAGGATAACTTAGT
1521 ACCAGCAGTTTTTAACCTTGACGTGAGACTAAAACGTGACCGTAGGCTGTTTTTTAGTTATTGCTCTCATGAGATGATGG
1601 CTGTATTTATCTGTTTATTTATACCTATTTATGTATTTATTTATTGAAGTGTGAAATTGAGCAATAGGCAGGCACCACCG
1681 TCCCCAGAGCAGGTCAGCGTCTCGAGAGGCCCCTGGACAATTGAGGATGCCCATCCCCTCCCCTTTCCCTGATCTTTTAC
1761 TGAGGGGCTGTGTGCGCGATCCTTGCAAATTGATGATGTTGCCATCCGTACCCAGGCTGTGTCTCATAAAAGTCGGCCTG
1841 GTGCCAGAGAGGACCTCCTTTCTCCCACAGAATCCCAGATCCTCAGGAAAAGCCAAAACCGAGGCCCATTGCCCGGATTC
1921 GACACAAAAGAGGGTCCCTGCTCTGTTGCCCGAGAGCAGTCTGCATCCTGGGACCAGAATGCTTTCCTGGAAAAAGAAGC
2001 CTTTCAGGTTTCCCTGGGCCAGCATCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCAACAC
2081 CCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTGGGAGCCA
2161 ACACCCTTCTGATGGAAGGCGGGATTCCCGCTTCTGAAACTCCCCCTGGAGTCTCACTCCCACACATGCCCATAGCTAGC
2241 ATTCAACAGAGAACTCTGTCTTAAGCTTCAACTGTGAAAATGATGACGGGCTTGTAGCACCTCAGCTTCTTTCCTCGCCC
2321 CCTTTTATCTGAATCCTATCAATTATTCTGATGCTGGGACAGGTGAGAAGAAACTGTGAAGTATATGAGCCTTTGAAAGT
2401 TCCCTGAAGTTTCTCAGTTCAGGAACATTCTCATTGTATGTGGTCTCCGCTGTTTGAACAGCCTTCTAGCTAAAAAATTC
2481 CAAAGCCTTTATTTGGGAGTCTTAGCTTGCAAGCTTGTGGAAGGATTTAGCTTAACAACTGTCACTCCTGAAAAGCAATC
2561 TCTGTTCCATCAAGGTTCTAGTTGCTGGCCCTGTGTCCTCAAAGTTCATTACATCTTATCAAGGCCTGTTTGCAAAGGGG
2641 AGATCCCTTTTCTTAAAAAAGGCTCAACCCAAAAGAAACCATTTCTTAAAAAATTTTACATAGATCAGTTGTATTTCTAT
2721 TTAGCAAAAATGAGTGCTCTGCTTTTATTTGGGAATTTCGATGAAAAAGCGTTCAGAGTAGATAATGTTCATTTATCAAA
2801 AATCTGGTTTGGGAAATACCAAAGAGGCTTTGATTGAATTCCCTTTTGACCCGTGTGTAACTTCCTCTGGTAGTTAGACC
2881 CCAGGCAGCTCCGAATTTGTGAACCTGCTTCCTGATGAATTCTCCCTTGTTCCCCCTTGGCTCTGCCATTATTTCGTTTT
2961 CAGTGTAATTTGCCAAGCCGCAGTTTTCTGTGCTGGCTGTGCCTCTAGTCGCAGCTCTGTGACTGATTCCCTCCCGGGTG
3041 CTGAGTCCCCTCCCCGGCCACCATCCTGCGTGAATATCCTGAAATTCATGGGCTTCCTCGGGGGCCCGCCCGCAGGTGGT
3121 GCTGGGTGGGTTCCGCCACCTTCTCCTGGAAGGTGAGCCTTTTCCTGGCCAAGGGCAGCTGCCTTAACCTCTGAGAGTCT
3201 GCGCTTGGCCTTAGTCCTGGAGACCCAGCCTCCAGGGACTGAACCGTGCTGCTGTTGGGAGCCAAGACCGGCCCTTTGGA
3281 GCCGGCAGCCCAGGGGTCCCTGCTGGATCAGAGAAATAGAAGCACCCGAAGACGGTTAGTGGCAATTCCTTGACCCGGTT
3361 TGCTTCCAAATGAAGGCCATTTGTCCACCAGGCATTGAAAAGACATGACTTACCCAGTCCGGCATCGGACTTGAAAAATC
3441 GAAATTGACATCACTCAGCTGTTACATTTCACATCCGATTCAGCCCCCTTTTATTTCCATGTGCTTTTCGCAGCCTTCCT
3521 GTGTTGGATGAAAGAGAATAAGAATTCAGCTGACAGGAGGCCTCTATCCTGTCCCTCCACCCCACCCTCCACCTCAATCC
3601 CCTCCCATCTTCCCCAGACCTACCTCACCTACTAGGACCTGAGGCAGCTCCTTAGCAGAGACCCCTGGGGTTTAGCTGAC
3681 TCTGGGGGTCAGGGGTTCCTGTCCCCAAACTTCGCAAGACAGCCCTGAAGTCACAAGTGCTTTCTTTTAAGTGGCATTGG
3761 CAATTGGCGTGTAATGATGGCAGTAGAATCTGAATCTCGGATCCCAGGCAGGGTTCACATTTCCAAACCTTTTTGATTTC
3841 CCCTGACCTCTAATGGCTGGATCCTATTTTTCTACAACCTTTCAGTGACATCGTTCAGGTTTCTTTCTTGGCCATTTAAA
3921 AAAACAAATTTTTTTTTTCTCACTTGTAAGTCACCGCCAGTACCTAAGTTAGGCTAACGGAGACTTTGACAGGACTGGAT
4001 TTTTCTTCCACCAGAAGAGAAGCCTTTTCCGTTGGTTTGGGGCCACCTCTTTGACCATGACCATGTGATGTTCCGTTTAC
4081 AGTGACTTGCTTTGGGGGAGGGGAGGCTCTCTTAACCGATTCCCATGTTGTACAGTAGATGGTTAGACCTTTTGTATATT
4161 AGTGTGTTTTAAGTTATTGATTTGTTTTATATAAAATAATTTATTTTTCAGGTGCCATTTTTCATTTTAACTTTGTTTTT
4241 ACATGGGTTTGTTTTCAATAAAGTCTGACACTGGTGTCCAAAAGTCAACAATAAAATGAATCCCATTGTGTTCTTTTGAA
4321 GATGCCTATGTAACTTTTAAGCTTTTTAAATTATTTTCAGAAAAAAAAAAAGAAAAGCCCTTATCAGTTTTCCATCAGCC
4401 CATTGCCTTTTTATTTTTTTTTTTTAATCCTTGTGAATAAATGTTCTTTAGTGTTTTAGGAGGAAAAAGCAAACCTAGAT
4481 TTTGATAACCCAGAAGACTTCAGATTAATAAAGAAGCTTTGAAAGAAGACCATTTTTCAAAATTTTAGTGAAGTGTGAAT
4561 ATTTTTTGTCAATGGCTTTCTCAAAGAGAATGAAACTTTTGCACCATTTTCAGAGTTTTTATAGAGATGCCAAATTGATA
4641 TATTTACATGTAATGGAAACATGAAAAAGTTTTATTAAACAATTGTTCATAGCTGTGTAGACATTTTAATTCAGTTTCCA
4721 AAGCTCTCAAAAAATCGTATTTTTGAAGTACGGAGTGATGCGGTTTGGGGCGTGGCTTACAGTTCCAACGACTCAATTGT
4801 CCCGATACTCAGTTCTTTCTACAGGTATCAGGTTCGTGTTAAACGCTGTATGTTAACTATGACTGGAATTCTGTGATATT
4881 TTGGTAATAAATGAAGTGGGATCATTGCGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uguGAGAUUUUCCUACGUGAAa 5'
             ||||:|:||  |||:||| 
Target 5' aacCTCTGAGAGTCTGCGCTTg 3'
3186 - 3207 155.00 -19.00
2
miRNA  3' ugUGAGAUUU-UCCU-ACGUGAaa 5'
            | |||||: || | ||||:|  
Target 5' gaAATCTAAGTAGAACTGCATTga 3'
241 - 264 128.00 -8.50
3
miRNA  3' ugUGAGAUUUUCCU-ACGUGAAa 5'
            |||:|:| |||| || |:|| 
Target 5' agACTTTGACAGGACTGGATTTt 3'
3981 - 4003 128.00 -14.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-519a-3p :: ELAVL1    [ Functional MTI ]
Validation Method qRT-PCR , Western blot ,
Conditions HeLa , HCT116 , RKO
Location of target site CDS, 3'UTR
Tools used in this research RNA22
Original Description (Extracted from the article) ... The influence of miR-519 was recapitulated using heterologous reporter constructs that revealed a greater repressive effect on the HuR CR than the HuR 3-UTR target sequences. miR-519 did not alter HuR mRNA abundance, but reduced HuR biosynthesis, as determined by measuring nascent HuR translation and HuR mRNA association with polysomes. We describe the repression of HuR expression by miR-519. Our findings indicate that miR-519 reduces HuR translation and not HuR mRNA levels or stability, since miR-519 overexpression specifically lowered HuR nascent translation and miR-519 inhibi- tion elevated it. ...

- Abdelmohsen, K. Srikantan, S. Kuwano, Y. et al., 2008, Proc Natl Acad Sci U S A.

Article - Abdelmohsen, K. Srikantan, S. Kuwano, Y. et al.
- Proc Natl Acad Sci U S A, 2008
Gene expression is potently regulated through the action of RNA-binding proteins (RBPs) and microRNAs (miRNAs). Here, we present evidence of a miRNA regulating an RBP. The RBP HuR can stabilize and modulate the translation of numerous target mRNAs involved in cell proliferation, but little is known about the mechanisms that regulate HuR abundance. We identified two putative sites of miR-519 interaction on the HuR mRNA, one in its coding region (CR), one in its 3'-untranslated region (UTR). In several human carcinoma cell lines tested, HeLa (cervical), HCT116 and RKO (colon), and A2780 (ovarian), overexpression of a miR-519 precursor [(Pre)miR-519] reduced HuR abundance, while inhibiting miR-519 by using an antisense RNA [(AS)miR-519] elevated HuR levels. The influence of miR-519 was recapitulated using heterologous reporter constructs that revealed a greater repressive effect on the HuR CR than the HuR 3'-UTR target sequences. miR-519 did not alter HuR mRNA abundance, but reduced HuR biosynthesis, as determined by measuring nascent HuR translation and HuR mRNA association with polysomes. Modulation of miR-519 leading to altered HuR levels in turn affected the levels of proteins encoded by HuR target mRNAs. In keeping with HuR's proliferative influence, (AS)miR-519 significantly increased cell number and [(3)H]-thymidine incorporation, while (Pre)miR-519 reduced these parameters. Importantly, the growth-promoting effects of (AS)miR-519 required the presence of HuR, because downregulation of HuR by RNAi dramatically suppressed its proliferative action. In sum, miR-519 represses HuR translation, in turn reducing HuR-regulated gene expression and cell division.
LinkOut: [PMID: 19088191]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
322 hsa-miR-519a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003733 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 3 1
MIRT005569 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 3 1
MIRT005571 DICER1 dicer 1, ribonuclease type III 4 3
MIRT006233 PTEN phosphatase and tensin homolog 3 2
MIRT006234 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 3 2
MIRT006638 TIMP1 TIMP metallopeptidase inhibitor 1 3 1
MIRT055032 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT055397 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT056836 REEP3 receptor accessory protein 3 1 1
MIRT060508 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT061800 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT063356 ETNK1 ethanolamine kinase 1 1 1
MIRT064426 ARID4B AT rich interactive domain 4B (RBP1-like) 1 1
MIRT064729 CCND2 cyclin D2 1 1
MIRT064809 ZBTB18 zinc finger protein 238 1 2
MIRT065611 DAZAP2 DAZ associated protein 2 1 5
MIRT065624 CLIC4 chloride intracellular channel 4 1 2
MIRT065880 GDF11 growth differentiation factor 11 1 1
MIRT065896 RAB5B RAB5B, member RAS oncogene family 1 4
MIRT068755 RB1 retinoblastoma 1 4 2
MIRT070052 FANCM Fanconi anemia, complementation group M 1 1
MIRT071008 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071340 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 3
MIRT071917 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT072734 GLCE glucuronic acid epimerase 1 1
MIRT076030 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 3
MIRT076048 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT079357 CCDC137 coiled-coil domain containing 137 1 1
MIRT080231 SMAD4 SMAD family member 4 1 3
MIRT081128 LDLR low density lipoprotein receptor 1 4
MIRT081209 MIDN midnolin 1 5
MIRT085100 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 3
MIRT085155 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 2
MIRT086440 NABP1 nucleic acid binding protein 1 1 3
MIRT088041 UBXN2A UBX domain protein 2A 1 1
MIRT088136 SEPT2 septin 2 1 2
MIRT088347 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090649 U2SURP U2 snRNP-associated SURP domain containing 1 3
MIRT090807 MBNL1 muscleblind-like splicing regulator 1 1 2
MIRT091697 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 2
MIRT092693 C3ORF38 chromosome 3 open reading frame 38 1 4
MIRT093962 SLAIN2 SLAIN motif family, member 2 1 1
MIRT095731 ANKH ankylosis, progressive homolog (mouse) 1 4
MIRT097160 FCHO2 FCH domain only 2 1 1
MIRT099323 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099839 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100775 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 1
MIRT100959 CENPQ centromere protein Q 1 2
MIRT102233 HBP1 HMG-box transcription factor 1 1 1
MIRT102303 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 5
MIRT102623 UBN2 ubinuclein 2 1 4
MIRT103782 PURB purine-rich element binding protein B 1 1
MIRT104172 PHTF2 putative homeodomain transcription factor 2 1 3
MIRT107281 FAM73B family with sequence similarity 73, member B 1 1
MIRT107955 TMEM2 transmembrane protein 2 1 1
MIRT108267 HABP4 hyaluronan binding protein 4 1 1
MIRT124815 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT138713 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT139882 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT144316 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 4
MIRT145609 LASP1 LIM and SH3 protein 1 1 1
MIRT153358 MAVS mitochondrial antiviral signaling protein 1 2
MIRT153992 PRNP prion protein 1 1
MIRT159135 NRBP1 nuclear receptor binding protein 1 1 1
MIRT164538 MSMO1 methylsterol monooxygenase 1 1 1
MIRT165922 CREBRF CREB3 regulatory factor 1 1
MIRT170862 TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein 1 1 2
MIRT172159 FZD6 frizzled family receptor 6 1 4
MIRT173709 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT175005 ZBTB5 zinc finger and BTB domain containing 5 1 2
MIRT175408 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT178075 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT178681 FAM102B family with sequence similarity 102, member B 1 1
MIRT180849 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 2
MIRT194913 RBBP6 retinoblastoma binding protein 6 1 4
MIRT195758 ATMIN ATM interactor 1 3
MIRT196625 TAOK1 TAO kinase 1 1 3
MIRT205290 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT206202 RAB10 RAB10, member RAS oncogene family 1 2
MIRT208984 SKIL SKI-like oncogene 1 5
MIRT223639 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 2
MIRT224761 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT227997 NFIB nuclear factor I/B 1 2
MIRT230980 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT238187 ANKRD33B ankyrin repeat domain 33B 1 5
MIRT242427 HAS3 hyaluronan synthase 3 1 1
MIRT242670 SALL3 sal-like 3 (Drosophila) 1 2
MIRT242767 FNBP1L formin binding protein 1-like 1 3
MIRT243097 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT243443 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT243966 MAP1B microtubule-associated protein 1B 1 1
MIRT244782 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT246632 TMEM109 transmembrane protein 109 1 1
MIRT246972 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT266059 FJX1 four jointed box 1 (Drosophila) 1 2
MIRT266864 SLC25A44 solute carrier family 25, member 44 1 1
MIRT283188 C16ORF52 chromosome 16 open reading frame 52 1 1
MIRT286961 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT293655 PVR poliovirus receptor 1 2
MIRT295180 ZNF317 zinc finger protein 317 1 2
MIRT302461 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT303503 NAGK N-acetylglucosamine kinase 1 3
MIRT368757 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT383209 APH1A anterior pharynx defective 1 homolog A (C. elegans) 1 1
MIRT383616 POU2F1 POU class 2 homeobox 1 1 1
MIRT396113 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT441421 FAM9C family with sequence similarity 9, member C 1 1
MIRT446821 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT448309 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT461783 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT462818 NTN1 netrin 1 1 1
MIRT463615 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT464563 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT464844 RPS27A ribosomal protein S27a 1 6
MIRT465227 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT466448 TFAM transcription factor A, mitochondrial 1 4
MIRT466838 STX6 syntaxin 6 1 3
MIRT467187 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 1
MIRT468181 SGMS1 sphingomyelin synthase 1 1 1
MIRT469852 PXK PX domain containing serine/threonine kinase 1 4
MIRT471614 PAQR5 progestin and adipoQ receptor family member V 1 9
MIRT472010 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT472162 NIN ninein (GSK3B interacting protein) 1 2
MIRT472338 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 2
MIRT473164 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT473625 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT473684 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT473807 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT474418 KLHL28 kelch-like 28 (Drosophila) 1 4
MIRT474738 KIF13A kinesin family member 13A 1 3
MIRT474968 KCTD10 potassium channel tetramerisation domain containing 10 1 2
MIRT475466 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476122 GPR157 G protein-coupled receptor 157 1 1
MIRT476205 GNS glucosamine (N-acetyl)-6-sulfatase 1 3
MIRT477182 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT478105 DLG5 discs, large homolog 5 (Drosophila) 1 3
MIRT478715 CSNK1A1 casein kinase 1, alpha 1 1 3
MIRT479057 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 4
MIRT480010 CAPRIN2 caprin family member 2 1 2
MIRT480521 C11orf30 chromosome 11 open reading frame 30 1 5
MIRT480824 BLCAP bladder cancer associated protein 1 5
MIRT480946 BBX bobby sox homolog (Drosophila) 1 4
MIRT481338 ATL3 atlastin GTPase 3 1 1
MIRT481600 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT481879 ANKRD50 ankyrin repeat domain 50 1 1
MIRT482473 ADAR adenosine deaminase, RNA-specific 1 2
MIRT484877 ZNF652 zinc finger protein 652 1 1
MIRT485092 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT485581 FOXQ1 forkhead box Q1 1 1
MIRT485620 FBXL5 F-box and leucine-rich repeat protein 5 1 5
MIRT486753 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT489602 ZDHHC20 zinc finger, DHHC-type containing 20 1 5
MIRT489891 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT491656 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT492040 TSG101 tumor susceptibility gene 101 1 2
MIRT492363 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT492778 PDGFB platelet-derived growth factor beta polypeptide 1 1
MIRT493338 LAPTM4A lysosomal protein transmembrane 4 alpha 1 6
MIRT493613 HMGB3 high mobility group box 3 1 3
MIRT497470 DDR2 discoidin domain receptor tyrosine kinase 2 1 1
MIRT498061 SNX5 sorting nexin 5 1 3
MIRT499903 KIAA1191 KIAA1191 1 2
MIRT500492 ZBTB4 zinc finger and BTB domain containing 4 1 3
MIRT500687 TRIM37 tripartite motif containing 37 1 1
MIRT500762 TMEM127 transmembrane protein 127 1 3
MIRT501458 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 4
MIRT501561 POC1B-GALNT4 POC1B-GALNT4 readthrough 1 1
MIRT501985 MAPK1 mitogen-activated protein kinase 1 1 5
MIRT502002 MAP7 microtubule-associated protein 7 1 4
MIRT502051 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 3
MIRT502425 GALNT4 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) 1 1
MIRT503046 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT503823 TMEM242 transmembrane protein 242 1 2
MIRT504292 PARP1 poly (ADP-ribose) polymerase 1 1 3
MIRT504562 ZNF417 zinc finger protein 417 1 3
MIRT505056 ZNF202 zinc finger protein 202 1 3
MIRT505488 SRSF2 serine/arginine-rich splicing factor 2 1 2
MIRT505838 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT506374 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT506453 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506675 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT506836 KIF23 kinesin family member 23 1 2
MIRT506882 KIAA0101 KIAA0101 1 3
MIRT507361 FAM129A family with sequence similarity 129, member A 1 3
MIRT507959 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 1 3
MIRT509435 MCM7 minichromosome maintenance complex component 7 1 3
MIRT510874 RAN RAN, member RAS oncogene family 1 4
MIRT511079 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 2
MIRT511256 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT513701 RBM20 RNA binding motif protein 20 1 2
MIRT513744 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT513983 CEP97 centrosomal protein 97kDa 1 1
MIRT514094 EPS15L1 epidermal growth factor receptor pathway substrate 15-like 1 1 3
MIRT515930 MFAP2 microfibrillar-associated protein 2 1 2
MIRT519576 ZNFX1 zinc finger, NFX1-type containing 1 1 2
MIRT521299 RRAGD Ras-related GTP binding D 1 2
MIRT521350 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT521695 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 4
MIRT521780 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 4
MIRT522193 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 3
MIRT524698 BTG3 BTG family, member 3 1 4
MIRT525665 NHSL2 NHS-like 2 1 1
MIRT527254 TMEM196 transmembrane protein 196 1 1
MIRT527468 CLEC12B C-type lectin domain family 12, member B 1 1
MIRT529537 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT530148 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT530853 RAG1 recombination activating gene 1 1 2
MIRT531111 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT534265 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT534758 RASGEF1A RasGEF domain family, member 1A 1 1
MIRT535177 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT535248 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT535403 PER1 period homolog 1 (Drosophila) 1 1
MIRT536038 MCUR1 coiled-coil domain containing 90A 1 1
MIRT536349 LEFTY1 left-right determination factor 1 1 1
MIRT536415 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT536439 KMT2B myeloid/lymphoid or mixed-lineage leukemia 4 1 3
MIRT536606 IRF2 interferon regulatory factor 2 1 1
MIRT536644 INO80D INO80 complex subunit D 1 1
MIRT536862 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 1 1
MIRT537243 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT537730 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT537990 DPP8 dipeptidyl-peptidase 8 1 1
MIRT538039 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT538257 CUL3 cullin 3 1 2
MIRT538527 CLCN3 chloride channel, voltage-sensitive 3 1 1
MIRT538661 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT538781 C7orf60 chromosome 7 open reading frame 60 1 2
MIRT538851 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT538925 BRI3BP BRI3 binding protein 1 3
MIRT539116 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT539456 ADARB2 adenosine deaminase, RNA-specific, B2 1 1
MIRT541087 RLIM ring finger protein, LIM domain interacting 1 1
MIRT543119 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT543183 FICD FIC domain containing 1 1
MIRT543577 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544115 IPMK inositol polyphosphate multikinase 1 1
MIRT544627 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT544701 ZNF224 zinc finger protein 224 1 2
MIRT544994 MFF mitochondrial fission factor 1 2
MIRT546250 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT546284 TMEM30A transmembrane protein 30A 1 2
MIRT546292 TMEM200C transmembrane protein 200C 1 2
MIRT546560 SATB2 SATB homeobox 2 1 1
MIRT546817 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT547048 POGZ pogo transposable element with ZNF domain 1 1
MIRT547476 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT547763 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT547894 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT548317 EPHA4 EPH receptor A4 1 1
MIRT548385 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548462 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548581 DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 1 1
MIRT548860 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT548898 CHEK2 checkpoint kinase 2 1 2
MIRT549321 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT550303 ZNF681 zinc finger protein 681 1 1
MIRT551122 ZNF107 zinc finger protein 107 1 1
MIRT551408 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT552175 DAD1 defender against cell death 1 1 1
MIRT552858 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552894 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553077 UEVLD UEV and lactate/malate dehyrogenase domains 1 1
MIRT553670 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 2
MIRT553702 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT554610 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT554862 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT556159 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT556181 MCC mutated in colorectal cancers 1 1
MIRT556531 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT556726 KLHL21 kelch-like 21 (Drosophila) 1 2
MIRT557056 HOXB3 homeobox B3 1 1
MIRT557589 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT557663 GATA6 GATA binding protein 6 1 1
MIRT557755 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT557883 FEM1B fem-1 homolog b (C. elegans) 1 2
MIRT558217 EFCAB14 KIAA0494 1 2
MIRT558266 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT558329 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 2
MIRT558768 CFL2 cofilin 2 (muscle) 1 1
MIRT561039 ASB6 ankyrin repeat and SOCS box containing 6 1 1
MIRT561326 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT561643 RUNX3 runt-related transcription factor 3 1 1
MIRT562557 CCDC71L coiled-coil domain containing 71-like 1 2
MIRT562963 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT564682 ZNF35 zinc finger protein 35 1 1
MIRT565696 SESN3 sestrin 3 1 1
MIRT565913 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT566143 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT567049 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567078 KBTBD2 kelch repeat and BTB (POZ) domain containing 2 1 1
MIRT567541 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567626 FAM210A family with sequence similarity 210, member A 1 1
MIRT570323 ZNF70 zinc finger protein 70 1 1
MIRT571761 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT571859 NKIRAS1 NFKB inhibitor interacting Ras-like 1 1 1
MIRT573374 LIMA1 LIM domain and actin binding 1 1 1
MIRT574563 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT614731 ATAT1 alpha tubulin acetyltransferase 1 1 2
MIRT617879 ESR1 estrogen receptor 1 1 1
MIRT624423 CBX8 chromobox homolog 8 1 1
MIRT625867 SLC35C2 solute carrier family 35, member C2 1 1
MIRT632516 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT641799 USP32 ubiquitin specific peptidase 32 1 1
MIRT663627 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT680137 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT702390 KLF10 Kruppel-like factor 10 1 1
MIRT707832 TMEM133 transmembrane protein 133 1 1
MIRT708887 MOCS2 molybdenum cofactor synthesis 2 1 1
MIRT709124 C3orf18 chromosome 3 open reading frame 18 1 1
MIRT709637 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT710598 CDCA4 cell division cycle associated 4 1 1
MIRT710804 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT711784 RFXAP regulatory factor X-associated protein 1 1
MIRT713346 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT713642 MED8 mediator complex subunit 8 1 1
MIRT713918 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT715070 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT715208 FKTN fukutin 1 1
MIRT717309 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT717821 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT720545 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*