Accession ID: MIRT003819 [miRNA, hsa-miR-197-3p :: RAD51, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-197LinkOut: [miRBase ]
Synonyms MIRN197, miR-197, miRNA197, MIR197
Description Homo sapiens miR-197 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-197-3p
Mature Sequence 48| UUCACCACCUUCUCCACCCAGC |69
Evidence Experimental
Experiments Cloned
Putative hsa-miR-197-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RAD51 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BRCC5, HRAD51, HsRad51, HsT16930, RAD51A, RECA
Description RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)
Transcript NM_0011642    LinkOut: [ RefSeq ]
Other Transcripts NM_0011642 , NM_0028 , NM_1334   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RAD51 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RAD51
(miRNA target sites are highlighted)
>RAD51|NM_0011642|3'UTR
   1 AACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTTCCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGG
  81 GAGATGCCAAAGACTGAATCATTGGGTTTTTCCTCTGTTAAAAACCTTAAGTGCTGCAGCCTAATGAGAGTGCACTGCTC
 161 CCTGGGGTTCTCTACAGGCCTCTTCCTGTTGTGACTGCCAGGATAAAGCTTCCGGGAAAACAGCTATTATATCAGCTTTT
 241 CTGATGGTATAAACAGGAGACAGGTCAGTAGTCACAAACTGATCTAAAATGTTTATTCCTTCTGTAGTGTATTAATCTCT
 321 GTGTGTTTTCTTTGGTTTTGGAGGAGGGGTATGAAGTATCTTTGACATGGTGCCTTAGGAATGACTTGGGTTTAACAAGC
 401 TGTCTACTGGACAATCTTATGTTTCCAAGAGAACTAAAGCTGGAGAGACCTGACCCTTCTCTCACTTCTAAATTAATGGT
 481 AAAATAAAATGCCTCAGCTATGTAGCAAAGGGAATGGGTCTGCACAGATTCTTTTTTTCTGTCAGTAAAACTCTCAAGCA
 561 GGTTTTTAAGTTGTCTGTCTGAATGATCTTGTGTAAGGTTTTGGTTATGGAGTCTTGTGCCAAACCTACTAGGCCATTAG
 641 CCCTTCACCATCTACCTGCTTGGTCTTTCATTGCTAAGACTAACTCAAGATAATCCTAGAGTCTTAAAGCATTTCAGGCC
 721 AGTGTGGTGTCTTGCGCCTGTACTCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCGCTTGAGCCCAGGAGTTTTAAGT
 801 CCAGCTTGGCCAAGGTGGTGAAATCCCATCTCTACAAAAAATGCAGAACTTAATCTGGACACACTGTTACACGTGCCTGT
 881 AGTCCCAGCTACTCGATAGCCTGAGGTGGGAGAATCACTTAAGCCTGGAAGGTGGAAGTTGCAGTGAGTCGAGATTGCAC
 961 TGCTGCATTCCAGCCAGGGTGACAGAGTGAGACCATGTTTCAAACAAGAAACATTTCAGAGGGTAAGTAAACAGATTTGA
1041 TTGTGAGGCTTCTAATAAAGTAGTTATTAGTAGTGAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgacccACCUCUUCCACCACUu 5'
                |||  |||||||||| 
Target 5' ccagctTGGCCAAGGTGGTGAa 3'
801 - 822 164.00 -21.70
2
miRNA  3' cgacccaCCUCUUCCACCACuu 5'
                 ||  |: ||||||  
Target 5' catttcaGGCCAGTGTGGTGtc 3'
710 - 731 127.00 -11.30
3
miRNA  3' cgACCCAC---CUCU-UCCACCacuu 5'
            |||| |   |||: ||||||    
Target 5' ttTGGGAGGCCGAGGCAGGTGGatcg 3'
753 - 778 108.00 -19.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-197-3p :: RAD51    [ Functional MTI ]
Validation Method Microarray , Other
Conditions 293T
Original Description (Extracted from the article) ... Predicted miR-197 target genes differentially expressed between FTC and FA ...

- Weber, F. Teresi, R. E. Broelsch, C. E. et al., 2006, J Clin Endocrinol Metab.

Article - Weber, F. Teresi, R. E. Broelsch, C. E. et al.
- J Clin Endocrinol Metab, 2006
CONTEXT: Although the pathogenesis of follicular thyroid carcinoma (FTC) and its relation to follicular adenoma (FA) remains unclear, detailed understanding of FTC carcinogenesis would facilitate addressing the scientific and clinical challenges, given that there are morphological and molecular similarities between FTC and the frequently occurring FA. Micro-RNAs (miRNAs) are a new class of small, noncoding RNAs implicated in development and cancer and may lend novel clues to FTC genesis. For the latter process, a deregulated miRNA can orchestrate the aberrant expression of several hundred target genes. OBJECTIVE: The objective of the study was to identify deregulated miRNAs in FTC. DESIGN: We used two high-density expression arrays to identify miRNAs and their target genes that are differentially expressed between FTC and FA. Validation was done by quantitative RT-PCR. We further functionally characterized the effect of deregulated miRNAs in vitro using HEK293T, FTC133, and K5 cell lines. PATIENTS: In total, 45 primary thyroid samples (23 FTC, 20 FA, four normal control thyroid) were analyzed. RESULTS: Two specific miRNAs, miR-197 and miR-346, were significantly overexpressed in FTC. In vitro overexpression of either miRNA induced proliferation, whereas inhibition led to growth arrest. Overexpression of miR-197 and miR-346 repressed the expression of their predicted target genes in vitro and in vivo. CONCLUSIONS: Our observations show that miR-197 and miR-346 contribute to FTC carcinogenesis. Both miRNAs and their target genes might potentially provide for novel molecular markers and act as novel targets for treatment by interference, which could potentially normalize the deregulated profile of many downstream target genes.
LinkOut: [PMID: 16822819]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
162 hsa-miR-197-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000215 TSPAN3 tetraspanin 3 4 2
MIRT000216 ACVR1 activin A receptor, type I 3 1
MIRT003818 PIPOX pipecolic acid oxidase 2 1
MIRT003819 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 2 1
MIRT003820 PEX13 peroxisomal biogenesis factor 13 2 1
MIRT003821 CPNE6 copine VI (neuronal) 2 1
MIRT003822 HNF4A hepatocyte nuclear factor 4, alpha 2 1
MIRT003823 WDR6 WD repeat domain 6 2 1
MIRT003824 ABCC3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 2 1
MIRT003825 USO1 USO1 vesicle docking protein homolog (yeast) 2 1
MIRT003826 ZNF302 zinc finger protein 302 2 1
MIRT003827 FBXW7 F-box and WD repeat domain containing 7 2 1
MIRT004146 CHIC2 cysteine-rich hydrophobic domain 2 2 1
MIRT004175 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 2 1
MIRT004176 RXRB retinoid X receptor, beta 2 1
MIRT004177 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 2 1
MIRT004178 MMP23A matrix metallopeptidase 23A (pseudogene) 2 1
MIRT004179 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 2 1
MIRT004180 DPH1 DPH1 homolog (S. cerevisiae) 2 1
MIRT004181 RAB28 RAB28, member RAS oncogene family 2 1
MIRT004182 DCBLD2 discoidin, CUB and LCCL domain containing 2 2 1
MIRT004183 AGR2 anterior gradient homolog 2 (Xenopus laevis) 2 1
MIRT004184 MED16 mediator complex subunit 16 2 1
MIRT004185 HMGN1 high-mobility group nucleosome binding domain 1 2 1
MIRT004186 CLIC1 chloride intracellular channel 1 2 1
MIRT004187 PRKD2 protein kinase D2 2 1
MIRT004188 ISYNA1 inositol-3-phosphate synthase 1 2 1
MIRT004189 KLC1 kinesin light chain 1 2 1
MIRT004190 TSPYL1 TSPY-like 1 2 1
MIRT004191 ATF6B activating transcription factor 6 beta 2 1
MIRT004192 ALMS1 Alstrom syndrome 1 2 1
MIRT004193 RBM4 RNA binding motif protein 4 2 1
MIRT004194 LRP4 low density lipoprotein receptor-related protein 4 3 2
MIRT004195 DPYSL3 dihydropyrimidinase-like 3 2 1
MIRT004196 FUS fused in sarcoma 2 1
MIRT004197 HPN hepsin 2 1
MIRT004198 FOXO3 forkhead box O3 2 1
MIRT004199 EHD2 EH-domain containing 2 2 1
MIRT004200 IER3 immediate early response 3 2 1
MIRT004201 SNX1 sorting nexin 1 2 1
MIRT004202 GOLGB1 golgin B1 2 1
MIRT004203 ZNF175 zinc finger protein 175 2 1
MIRT004204 IGF2-AS insulin-like growth factor 2 antisense 2 1
MIRT004205 PHF20 PHD finger protein 20 2 1
MIRT004206 CES1 carboxylesterase 1 (monocyte/macrophage serine esterase 1) 1 1
MIRT004207 GORASP2 golgi reassembly stacking protein 2, 55kDa 2 1
MIRT004208 CDK10 cyclin-dependent kinase 10 2 1
MIRT004209 RFX1 regulatory factor X, 1 (influences HLA class II expression) 2 1
MIRT004210 GALT galactose-1-phosphate uridylyltransferase 2 1
MIRT004211 CYLD cylindromatosis (turban tumor syndrome) 2 1
MIRT004212 KLF10 Kruppel-like factor 10 2 1
MIRT004213 UMPS uridine monophosphate synthetase 2 1
MIRT004214 ZNF208 zinc finger protein 208 2 1
MIRT004215 NEK4 NIMA (never in mitosis gene a)-related kinase 4 2 1
MIRT004216 THEMIS2 chromosome 1 open reading frame 38 2 1
MIRT004217 IL1R1 interleukin 1 receptor, type I 2 1
MIRT004218 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 2 1
MIRT004412 TUSC2 tumor suppressor candidate 2 3 2
MIRT007211 NSUN5 NOP2/Sun domain family, member 5 2 1
MIRT048047 ADIPOR1 adiponectin receptor 1 1 1
MIRT048048 GSTO1 glutathione S-transferase omega 1 1 1
MIRT048049 BCR breakpoint cluster region 1 1
MIRT048050 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT048051 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT048052 STMN3 stathmin-like 3 1 1
MIRT048053 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT048054 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT048055 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 1 1
MIRT048056 SOD1 superoxide dismutase 1, soluble 1 1
MIRT048057 PLCB3 phospholipase C, beta 3 (phosphatidylinositol-specific) 1 1
MIRT048058 NCL nucleolin 1 1
MIRT048059 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT048060 SPG20 spastic paraplegia 20 (Troyer syndrome) 1 1
MIRT048061 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT048062 H2AFZ H2A histone family, member Z 1 1
MIRT048063 DNLZ DNL-type zinc finger 1 1
MIRT048064 ATP11A ATPase, class VI, type 11A 1 1
MIRT048065 MPP6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 1 1
MIRT048066 MSI1 musashi homolog 1 (Drosophila) 1 1
MIRT048067 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT048068 DGCR8 DiGeorge syndrome critical region gene 8 1 1
MIRT048069 ACTG1 actin, gamma 1 1 1
MIRT048070 FASN fatty acid synthase 1 1
MIRT048071 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT048072 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT048073 JTB jumping translocation breakpoint 1 1
MIRT048074 OVCH2 ovochymase 2 (gene/pseudogene) 1 1
MIRT048075 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT048076 CEP152 centrosomal protein 152kDa 1 1
MIRT048077 STRN striatin, calmodulin binding protein 1 1
MIRT048078 STEAP2 six transmembrane epithelial antigen of the prostate 2 1 1
MIRT048079 PPP2CA protein phosphatase 2, catalytic subunit, alpha isozyme 1 1
MIRT048080 CKS1B CDC28 protein kinase regulatory subunit 1B 1 1
MIRT048081 SETD1B SET domain containing 1B 1 1
MIRT048082 RBM15B RNA binding motif protein 15B 1 1
MIRT048083 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT048084 ZNF318 zinc finger protein 318 1 1
MIRT048085 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT048086 FOXJ3 forkhead box J3 1 1
MIRT048087 C1orf115 chromosome 1 open reading frame 115 1 1
MIRT048088 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT048089 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT048090 CHTOP chromosome 1 open reading frame 77 1 1
MIRT048091 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT048092 TMX4 thioredoxin-related transmembrane protein 4 1 1
MIRT048093 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT048094 METTL4 methyltransferase like 4 1 1
MIRT048095 MCM7 minichromosome maintenance complex component 7 1 1
MIRT048096 RSRC2 arginine/serine-rich coiled-coil 2 1 1
MIRT048097 SUDS3 suppressor of defective silencing 3 homolog (S. cerevisiae) 1 1
MIRT048098 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT048099 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT048100 ACTL9 actin-like 9 1 1
MIRT048101 CCNG1 cyclin G1 1 1
MIRT048102 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT048103 AK3 adenylate kinase 3 1 1
MIRT048104 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT048105 MAML1 mastermind-like 1 (Drosophila) 1 1
MIRT048106 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT048107 MORN2 MORN repeat containing 2 1 1
MIRT048108 ACVR1B activin A receptor, type IB 1 1
MIRT048109 ADAR adenosine deaminase, RNA-specific 1 1
MIRT048110 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT048111 RNFT2 ring finger protein, transmembrane 2 1 1
MIRT048112 MEGF9 multiple EGF-like-domains 9 1 1
MIRT048113 PDZRN3 PDZ domain containing ring finger 3 1 1
MIRT048114 GDF7 growth differentiation factor 7 1 1
MIRT048115 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT048116 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT048117 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT048118 TRAP1 TNF receptor-associated protein 1 1 1
MIRT048119 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT048120 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT048121 SH3BP2 SH3-domain binding protein 2 1 1
MIRT048122 RGS16 regulator of G-protein signaling 16 1 1
MIRT048123 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT048124 TTC8 tetratricopeptide repeat domain 8 1 1
MIRT048125 HSPA4 heat shock 70kDa protein 4 1 1
MIRT048126 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT048127 PALD1 KIAA1274 1 1
MIRT048128 RUVBL1 RuvB-like 1 (E. coli) 1 1
MIRT048129 MED24 mediator complex subunit 24 1 1
MIRT048130 MKRN1 makorin ring finger protein 1 1 1
MIRT048131 ZNF354A zinc finger protein 354A 1 1
MIRT048132 NME2 non-metastatic cells 2, protein (NM23B) expressed in 1 1
MIRT048133 LDHB lactate dehydrogenase B 1 1
MIRT048134 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT048135 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT048136 CCNA2 cyclin A2 1 1
MIRT048137 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT048138 TSEN34 tRNA splicing endonuclease 34 homolog (S. cerevisiae) 1 1
MIRT048139 RPL7A ribosomal protein L7a 1 1
MIRT048140 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT048141 INTS4 integrator complex subunit 4 1 1
MIRT048142 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT048143 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT048144 TRAPPC1 trafficking protein particle complex 1 1 1
MIRT048145 RPL13A ribosomal protein L13a 1 1
MIRT048146 RPL22 ribosomal protein L22 1 1
MIRT048147 COL4A6 collagen, type IV, alpha 6 1 1
MIRT048148 NOA1 chromosome 4 open reading frame 14 1 1
MIRT048149 VDAC1 voltage-dependent anion channel 1 1 1