Accession ID: MIRT003856 [miRNA, hsa-miR-23a-3p :: POU4F2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-23aLinkOut: [miRBase ]
Synonyms MIRN23A, hsa-mir-23a, miRNA23A, MIR23A
Description Homo sapiens miR-23a stem-loop
Comment This miRNA was previously named miR-23 . This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-23a-3p
Mature Sequence 45| AUCACAUUGCCAGGGAUUUCC |65
Evidence Experimental
Experiments Cloned
Putative hsa-miR-23a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol POU4F2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BRN3.2, BRN3B, Brn-3b
Description POU class 4 homeobox 2
Transcript NM_0045    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on POU4F2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of POU4F2
(miRNA target sites are highlighted)
>POU4F2|NM_0045|3'UTR
   1 TAGAAGACTCTTGGCCTCTCCAGAGACGCCCCTTTCCTCGTCCGCTCTTTTCTCTCCTCTCTTCTGCCTCTTTTCACTTT
  81 TGGCGACTAGAAACAATTCCAGTAAATGTGAATCTCGACAAATCGAGGACTGAAGAGGGAGCGAACGAGCGAACAACTGA
 161 GCCCAAGCCGGTGAGAATGTGAAACAGTTTCTCAAAGGAAAGAATAACAAAAGATGGTATTTGTCTGTTGTAGCAAAGTT
 241 GTCCCTTTGAACCCCACCTCGGCTTCTTCAGAGGAAGTGTGGAGATGGCTGTTTGCAGGAAGGCAGACGAGACAGTGTTT
 321 AAAAAGTCCACAAGAATGATCAAGTAAGATTTGTTTTTATTCTTACAGACATCACCCGTGTTCAAGTTTAAAAGTACACT
 401 TTGCAACTATTTTTCAGAAATAGAAATTGATTCAGGACTAAAACTTTAAACTAGAGTTGATGCTTAATGTGATAGAGACA
 481 TCTCTAAAGTATTTTGAATTTTAAAAAAAGATGGCAGATTTTCTGCATTTACACTGTATATTATATATATATTTTTATTG
 561 TGGTTCTTACCCCCTTTTCCTTCTCTGAAGTGTTAATGCTTAAGAAAAGAGTTGCGCCTGCTGTGTTCACTGATCTTGAA
 641 AGCTATTATTAGATTATTGCAGAACAACCCTCTGTAAATTATTAATTTATCTCTCTAGCAACTTAATTTTGTGCACATTC
 721 TAATTAATTAAACTTCTTCCGTCTAAAAAAAGTGGGGGAAATGTATAGCTAGTAACGTTCAAAAAATTTTGTTTGATGAG
 801 TTTACCGAATTTTTACAGCTTTCCTCCTATACTGTGTTCCTTTTGACCCATTTGTATATTCTCACTTGAATGAAGATTGT
 881 TTTTTTCTTTGTTTTTACTGGTAGTGTTCTGATTTGTGAGTCGACACTCAGTAATGGATGTCTTAATCGTGTAGACCTGA
 961 TTCACTGTCTGAAGTATTGTTTACTTCGTTACATATTTAATGGGGATTCCCACATTGTCCCCATGACACATGAGCGCTCT
1041 CACTTACCCTTACACACACACACACACACACACACACCTCTAACAGAAGGGAAGAAGCAGTTGGAAGCATGACCGATGCA
1121 CCATTTTCTAGTTTTAGGTGCATTTGCCACTTGGTGTTTGCCCTTCAGATTTTAGATTTCACCAAGGTATTTCAGTCTTC
1201 CAGTTTTCAATTGCTTTGTTGGCTACATGTTAATATTTATAGGAATACTTCAGTTTTTCCTTTTGGAGGTTTGTTTGTAG
1281 AAAAACTAATTTGAACTATAAGAAAGACAGTGCACTGCTTGTAAATTCACATTGTTTGGAAAAATTCTTTTGGAACAAAA
1361 AATTAGGTACATGATAACTGGTACCTTATCTACTGTAAATATTTCATTAAAAATGATGCACACATAGATATATTCTTACA
1441 AATTTTGCTGTATTGCTGTTCTCTTTGAGGCTCTCCAAAGTCTTGAGTTCTGTATATGGCCTGGTTTCTTGTTTTTATTA
1521 ATAGATGGTTTATTTACTATGGTAATGTATTAATTTATTTTTGGTGTTGTTCGATTGTCTTTCATTGAAGAGATAATTTT
1601 AATGTTTTATTGGCAACGTATGCTGCTTTTTCATTAAAATATGCTATTAAAATTAAATGGCTTTTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccuUUAGGGACCGUUACACUa 5'
             |||:|| |  ||||||| 
Target 5' aacAATTCCAGTAAATGTGAa 3'
92 - 112 162.00 -11.40
2
miRNA  3' ccUUUAGGGACCGUUACACUa 5'
            ||: |  ||  ||||||| 
Target 5' ccAAGCCGGTGAGAATGTGAa 3'
163 - 183 151.00 -10.00
3
miRNA  3' ccUUUAGGGAC-CGUUACACUa 5'
            :|:|:  ||  :||||||| 
Target 5' taGAGTTGATGCTTAATGTGAt 3'
452 - 473 147.00 -10.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-23a-3p :: POU4F2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... Experimental Support for Predicted Targets.//{These MTI shown in Fig. 3} ...

- Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al., 2003, Cell.

Article - Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al.
- Cell, 2003
MicroRNAs (miRNAs) can play important gene regulatory roles in nematodes, insects, and plants by basepairing to mRNAs to specify posttranscriptional repression of these messages. However, the mRNAs regulated by vertebrate miRNAs are all unknown. Here we predict more than 400 regulatory target genes for the conserved vertebrate miRNAs by identifying mRNAs with conserved pairing to the 5' region of the miRNA and evaluating the number and quality of these complementary sites. Rigorous tests using shuffled miRNA controls supported a majority of these predictions, with the fraction of false positives estimated at 31% for targets identified in human, mouse, and rat and 22% for targets identified in pufferfish as well as mammals. Eleven predicted targets (out of 15 tested) were supported experimentally using a HeLa cell reporter system. The predicted regulatory targets of mammalian miRNAs were enriched for genes involved in transcriptional regulation but also encompassed an unexpectedly broad range of other functions.
LinkOut: [PMID: 14697198]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-23a-3p :: POU4F2    [ Functional MTI ]
Validation Method
Article - Calissano, M. Latchman, D. S.
- Mol Cell Neurosci, 2010
We have previously shown that the Brn-3b transcription factor is subjected to post-transcriptional gene regulation by specific microRNAs (mir-23 and mir-214) in the ND7 and SHSY-5Y neuronal cell lines (Calissano et al., 2007). As Brn-3b plays an essential role in the survival of retinal ganglion cells in the rat (Erkman et al., 1996; Gan et al., 1996; Gan et al., 1999; Erkman et al., 2000), we wanted to investigate whether mir-23 and mir-214 are expressed and target Brn-3b mRNA in a retinal ganglion cell line (RGC-5) thus potentially killing the cells expressing it. Here we show that, possibly due to its pro-survival role, Brn-3b is protected from degradation by microRNAs in RGC-5 cells in contrast to its fate in other cell types. This seems to be accomplished by i) the lack of expression of one of the two microRNAs targeting its 3'UTR and by ii) the requirement of at least two distinct microRNAs to mediate its down-regulation in retinal ganglion cells. We speculate that this mechanism could have a widespread role in the regulation of mRNAs encoding for essential proteins.
LinkOut: [PMID: 20609388]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
84 hsa-miR-23a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000126 RING1 ring finger protein 1 1 1
MIRT001776 CXCL12 chemokine (C-X-C motif) ligand 12 2 1
MIRT002953 HES1 hairy and enhancer of split 1, (Drosophila) 3 2
MIRT003856 POU4F2 POU class 4 homeobox 2 4 2
MIRT004479 Celf1 CUGBP, Elav-like family member 1 4 1
MIRT004517 ATAT1 chromosome 6 open reading frame 134 2 1
MIRT005528 IL6R interleukin 6 receptor 5 1
MIRT006280 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1 1
MIRT006281 G6PC glucose-6-phosphatase, catalytic subunit 1 1
MIRT006284 FOXO3 forkhead box O3 2 2
MIRT006898 FANCG Fanconi anemia, complementation group G 3 1
MIRT006907 MYH1 myosin, heavy chain 1, skeletal muscle, adult 3 1
MIRT006908 MYH2 myosin, heavy chain 2, skeletal muscle, adult 3 1
MIRT006909 MYH4 myosin, heavy chain 4, skeletal muscle 3 1
MIRT006987 PTEN phosphatase and tensin homolog 3 1
MIRT007150 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT007264 HMGN2 high-mobility group nucleosomal binding domain 2 1 1
MIRT030632 C21orf33 chromosome 21 open reading frame 33 1 2
MIRT050384 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 1
MIRT050385 SLC27A4 solute carrier family 27 (fatty acid transporter), member 4 1 1
MIRT050386 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT050387 NLK nemo-like kinase 1 1
MIRT050388 FLNA filamin A, alpha 1 1
MIRT050389 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT050390 PKM pyruvate kinase, muscle 1 1
MIRT050391 KIAA1551 chromosome 12 open reading frame 35 1 1
MIRT050392 ACTN4 actinin, alpha 4 1 1
MIRT050393 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT050394 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 1 1
MIRT050395 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT050396 KLF12 Kruppel-like factor 12 1 1
MIRT050397 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT050398 BCAP29 B-cell receptor-associated protein 29 1 1
MIRT050399 PEX26 peroxisomal biogenesis factor 26 1 1
MIRT050400 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT050401 RPS5 ribosomal protein S5 1 1
MIRT050402 TCF25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT050403 RPS4X ribosomal protein S4, X-linked 1 1
MIRT050404 TRRAP transformation/transcription domain-associated protein 1 1
MIRT050405 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT050406 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT050407 MRPS34 mitochondrial ribosomal protein S34 1 1
MIRT050408 SSRP1 structure specific recognition protein 1 1 1
MIRT050409 GRTP1 growth hormone regulated TBC protein 1 1 1
MIRT050410 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT050411 KIF20A kinesin family member 20A 1 1
MIRT050412 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT050413 ITPKC inositol 1,4,5-trisphosphate 3-kinase C 1 1
MIRT050414 KIF22 kinesin family member 22 1 1
MIRT050415 CCT5 chaperonin containing TCP1, subunit 5 (epsilon) 1 1
MIRT050416 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT050417 PSMC3 proteasome (prosome, macropain) 26S subunit, ATPase, 3 1 1
MIRT050418 STT3B STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) 1 1
MIRT050419 TXNL4A thioredoxin-like 4A 1 1
MIRT050420 CD302 CD302 molecule 1 1
MIRT050421 LEMD2 LEM domain containing 2 1 1
MIRT050422 FASTKD1 FAST kinase domains 1 1 1
MIRT050423 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT050424 ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 1 1
MIRT050425 HIST1H3B histone cluster 1, H3b 1 1
MIRT050426 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT050427 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT050428 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 1 1
MIRT050429 FAU Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed 1 1
MIRT050430 LDHA lactate dehydrogenase A 1 1
MIRT050431 CCL8 chemokine (C-C motif) ligand 8 1 1
MIRT050432 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT050433 C2orf69 chromosome 2 open reading frame 69 1 1
MIRT050434 PDCD6IP programmed cell death 6 interacting protein 1 1
MIRT050435 SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT050436 PAFAH1B3 platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) 1 1
MIRT050437 SEPT2 septin 2 1 1
MIRT050438 GMPS guanine monphosphate synthetase 1 1
MIRT050439 PSAP prosaposin 1 1
MIRT050440 UBALD1 family with sequence similarity 100, member A 1 1
MIRT050441 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 1 1
MIRT050442 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT050443 MCU coiled-coil domain containing 109A 1 1
MIRT050444 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT050445 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT050446 NUP153 nucleoporin 153kDa 1 1
MIRT050447 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT050448 USP34 ubiquitin specific peptidase 34 1 1
MIRT050449 FASTKD5 FAST kinase domains 5 1 1