Accession ID: MIRT003856 [miRNA, hsa-miR-23a-3p :: POU4F2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-23aLinkOut: [miRBase ]
Synonyms MIRN23A, hsa-mir-23a, miRNA23A, MIR23A
Description Homo sapiens miR-23a stem-loop
Comment This miRNA was previously named miR-23 . This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-23a-3p
Mature Sequence 45| AUCACAUUGCCAGGGAUUUCC |65
Evidence Experimental
Experiments Cloned
Putative hsa-miR-23a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-23a-3p :: POU4F2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... Experimental Support for Predicted Targets.//{These MTI shown in Fig. 3} ...

- Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al., 2003, Cell.

Article - Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al.
- Cell, 2003
MicroRNAs (miRNAs) can play important gene regulatory roles in nematodes, insects, and plants by basepairing to mRNAs to specify posttranscriptional repression of these messages. However, the mRNAs regulated by vertebrate miRNAs are all unknown. Here we predict more than 400 regulatory target genes for the conserved vertebrate miRNAs by identifying mRNAs with conserved pairing to the 5' region of the miRNA and evaluating the number and quality of these complementary sites. Rigorous tests using shuffled miRNA controls supported a majority of these predictions, with the fraction of false positives estimated at 31% for targets identified in human, mouse, and rat and 22% for targets identified in pufferfish as well as mammals. Eleven predicted targets (out of 15 tested) were supported experimentally using a HeLa cell reporter system. The predicted regulatory targets of mammalian miRNAs were enriched for genes involved in transcriptional regulation but also encompassed an unexpectedly broad range of other functions.
LinkOut: [PMID: 14697198]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-23a-3p :: POU4F2    [ Functional MTI ]
Validation Method
Article - Calissano, M. Latchman, D. S.
- Mol Cell Neurosci, 2010
We have previously shown that the Brn-3b transcription factor is subjected to post-transcriptional gene regulation by specific microRNAs (mir-23 and mir-214) in the ND7 and SHSY-5Y neuronal cell lines (Calissano et al., 2007). As Brn-3b plays an essential role in the survival of retinal ganglion cells in the rat (Erkman et al., 1996; Gan et al., 1996; Gan et al., 1999; Erkman et al., 2000), we wanted to investigate whether mir-23 and mir-214 are expressed and target Brn-3b mRNA in a retinal ganglion cell line (RGC-5) thus potentially killing the cells expressing it. Here we show that, possibly due to its pro-survival role, Brn-3b is protected from degradation by microRNAs in RGC-5 cells in contrast to its fate in other cell types. This seems to be accomplished by i) the lack of expression of one of the two microRNAs targeting its 3'UTR and by ii) the requirement of at least two distinct microRNAs to mediate its down-regulation in retinal ganglion cells. We speculate that this mechanism could have a widespread role in the regulation of mRNAs encoding for essential proteins.
LinkOut: [PMID: 20609388]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
222 hsa-miR-23a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000126 RING1 ring finger protein 1 1 1
MIRT001776 CXCL12 chemokine (C-X-C motif) ligand 12 2 1
MIRT002953 HES1 hairy and enhancer of split 1, (Drosophila) 3 2
MIRT003856 POU4F2 POU class 4 homeobox 2 4 2
MIRT004479 Celf1 CUGBP, Elav-like family member 1 4 1
MIRT004517 ATAT1 alpha tubulin acetyltransferase 1 2 1
MIRT005528 IL6R interleukin 6 receptor 5 1
MIRT006280 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1 1
MIRT006281 G6PC glucose-6-phosphatase, catalytic subunit 1 1
MIRT006284 FOXO3 forkhead box O3 2 2
MIRT006898 FANCG Fanconi anemia, complementation group G 3 1
MIRT006907 MYH1 myosin, heavy chain 1, skeletal muscle, adult 3 1
MIRT006908 MYH2 myosin, heavy chain 2, skeletal muscle, adult 3 1
MIRT006909 MYH4 myosin, heavy chain 4, skeletal muscle 3 1
MIRT006987 PTEN phosphatase and tensin homolog 3 3
MIRT007150 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT007264 HMGN2 high mobility group nucleosomal binding domain 2 1 1
MIRT030632 C21orf33 chromosome 21 open reading frame 33 1 2
MIRT050384 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 1
MIRT050385 SLC27A4 solute carrier family 27 (fatty acid transporter), member 4 1 1
MIRT050386 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT050387 NLK nemo-like kinase 1 1
MIRT050388 FLNA filamin A, alpha 1 1
MIRT050389 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT050390 PKM pyruvate kinase, muscle 1 1
MIRT050391 KIAA1551 KIAA1551 1 1
MIRT050392 ACTN4 actinin, alpha 4 1 1
MIRT050393 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT050394 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 1
MIRT050395 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT050396 KLF12 Kruppel-like factor 12 1 1
MIRT050397 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT050398 BCAP29 B-cell receptor-associated protein 29 1 1
MIRT050399 PEX26 peroxisomal biogenesis factor 26 1 1
MIRT050400 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT050401 RPS5 ribosomal protein S5 1 1
MIRT050402 TCF25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT050403 RPS4X ribosomal protein S4, X-linked 1 1
MIRT050404 TRRAP transformation/transcription domain-associated protein 1 1
MIRT050405 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT050406 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT050407 MRPS34 mitochondrial ribosomal protein S34 1 1
MIRT050408 SSRP1 structure specific recognition protein 1 1 1
MIRT050409 GRTP1 growth hormone regulated TBC protein 1 1 1
MIRT050410 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT050411 KIF20A kinesin family member 20A 1 1
MIRT050412 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT050413 ITPKC inositol-trisphosphate 3-kinase C 1 1
MIRT050414 KIF22 kinesin family member 22 1 1
MIRT050415 CCT5 chaperonin containing TCP1, subunit 5 (epsilon) 1 1
MIRT050416 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT050417 PSMC3 proteasome (prosome, macropain) 26S subunit, ATPase, 3 1 1
MIRT050418 STT3B STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) 1 1
MIRT050419 TXNL4A thioredoxin-like 4A 1 1
MIRT050420 CD302 CD302 molecule 1 1
MIRT050421 LEMD2 LEM domain containing 2 1 1
MIRT050422 FASTKD1 FAST kinase domains 1 1 1
MIRT050423 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT050424 ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 1 1
MIRT050425 HIST1H3B histone cluster 1, H3b 1 1
MIRT050426 TNRC6A trinucleotide repeat containing 6A 1 4
MIRT050427 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT050428 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 1 1
MIRT050429 FAU Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed 1 1
MIRT050430 LDHA lactate dehydrogenase A 3 2
MIRT050431 CCL8 chemokine (C-C motif) ligand 8 1 1
MIRT050432 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT050433 C2orf69 chromosome 2 open reading frame 69 1 2
MIRT050434 PDCD6IP programmed cell death 6 interacting protein 1 1
MIRT050435 SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT050436 PAFAH1B3 platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) 1 1
MIRT050437 SEPT2 septin 2 1 1
MIRT050438 GMPS guanine monphosphate synthetase 1 1
MIRT050439 PSAP prosaposin 1 1
MIRT050440 UBALD1 family with sequence similarity 100, member A 1 1
MIRT050441 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT050442 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT050443 MCU mitochondrial calcium uniporter 1 1
MIRT050444 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT050445 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT050446 NUP153 nucleoporin 153kDa 1 1
MIRT050447 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT050448 USP34 ubiquitin specific peptidase 34 1 1
MIRT050449 FASTKD5 FAST kinase domains 5 1 1
MIRT053083 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 2 1
MIRT053306 KLF3 Kruppel-like factor 3 (basic) 2 1
MIRT053354 IRF1 interferon regulatory factor 1 3 1
MIRT053381 FAS Fas (TNF receptor superfamily, member 6) 3 1
MIRT053519 MT2A metallothionein 2A 3 1
MIRT054034 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 3 1
MIRT054322 LDHB lactate dehydrogenase B 2 1
MIRT054472 IL8 interleukin 8 3 1
MIRT054514 APAF1 apoptotic peptidase activating factor 1 3 2
MIRT054809 NEK6 NIMA (never in mitosis gene a)-related kinase 6 1 1
MIRT054919 LPAR1 lysophosphatidic acid receptor 1 3 1
MIRT064146 TSNAX translin-associated factor X 1 1
MIRT066947 ATXN7L3B ataxin 7-like 3B 1 4
MIRT067319 SESN2 sestrin 2 1 2
MIRT097053 TNPO1 transportin 1 1 1
MIRT110336 ADD3 adducin 3 (gamma) 1 1
MIRT133654 ETNK1 ethanolamine kinase 1 1 1
MIRT134653 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT213994 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT235217 ZNF257 zinc finger protein 257 1 4
MIRT266429 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT269203 FUT4 fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific) 1 1
MIRT281196 SEMA6D sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D 1 1
MIRT322935 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT326649 ZNF275 zinc finger protein 275 1 2
MIRT332708 QSER1 glutamine and serine rich 1 1 1
MIRT399755 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT437443 TOP1 topoisomerase (DNA) I 3 2
MIRT437889 HOXB4 homeobox B4 2 1
MIRT438535 LAMP1 lysosomal-associated membrane protein 1 2 1
MIRT438692 HMGB2 high mobility group box 2 4 3
MIRT438903 SPRY2 sprouty homolog 2 (Drosophila) 4 1
MIRT439101 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT448267 ZNF704 zinc finger protein 704 1 4
MIRT461718 ZNF426 zinc finger protein 426 1 1
MIRT462564 STS steroid sulfatase (microsomal), isozyme S 1 1
MIRT466130 TMEM170A transmembrane protein 170A 1 1
MIRT466153 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT466971 STARD7 StAR-related lipid transfer (START) domain containing 7 1 2
MIRT467174 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 1
MIRT468568 SERINC3 serine incorporator 3 1 6
MIRT468706 SDHD succinate dehydrogenase complex, subunit D, integral membrane protein 1 1
MIRT471440 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT471790 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT472551 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 2
MIRT473489 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT474687 KLF10 Kruppel-like factor 10 1 1
MIRT479113 CNN2 calponin 2 1 1
MIRT480260 C8orf58 chromosome 8 open reading frame 58 1 1
MIRT485407 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 2
MIRT493596 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT499306 ZNF485 zinc finger protein 485 1 5
MIRT499481 ZNF669 zinc finger protein 669 1 3
MIRT500385 ZNF281 zinc finger protein 281 1 3
MIRT500592 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 1 2
MIRT501537 POM121C POM121 transmembrane nucleoporin C 1 3
MIRT502718 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT504208 VAV3 vav 3 guanine nucleotide exchange factor 1 6
MIRT504352 VCAM1 vascular cell adhesion molecule 1 1 4
MIRT507520 DSTN destrin (actin depolymerizing factor) 1 2
MIRT510411 ZNF268 zinc finger protein 268 1 2
MIRT513495 SSR1 signal sequence receptor, alpha 1 3
MIRT514677 ZNF701 zinc finger protein 701 1 2
MIRT515106 ZNF578 zinc finger protein 578 1 3
MIRT515367 ZNF208 zinc finger protein 208 1 3
MIRT523135 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 3
MIRT524024 DOCK4 dedicator of cytokinesis 4 1 2
MIRT526727 ZNF138 zinc finger protein 138 1 2
MIRT527298 KIAA1210 KIAA1210 1 1
MIRT527775 DNAJC21 DnaJ (Hsp40) homolog, subfamily C, member 21 1 1
MIRT527958 MTAP methylthioadenosine phosphorylase 1 1
MIRT528477 STAMBPL1 STAM binding protein-like 1 1 1
MIRT528678 CEP57L1 centrosomal protein 57kDa-like 1 1 1
MIRT529969 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) 1 1
MIRT530629 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 2
MIRT531701 ADAM28 ADAM metallopeptidase domain 28 1 1
MIRT532127 NOL11 nucleolar protein 11 1 1
MIRT533566 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT534696 RNF111 ring finger protein 111 1 1
MIRT535235 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT535674 NLGN4X neuroligin 4, X-linked 1 1
MIRT536167 MAP1B microtubule-associated protein 1B 1 1
MIRT536573 JMJD1C jumonji domain containing 1C 1 1
MIRT537661 ERBB2IP erbb2 interacting protein 1 1
MIRT539514 ACSS3 acyl-CoA synthetase short-chain family member 3 1 1
MIRT549739 ZNF273 zinc finger protein 273 1 1
MIRT549946 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT551462 TRIM59 tripartite motif containing 59 1 1
MIRT552501 ZIK1 zinc finger protein interacting with K protein 1 homolog (mouse) 1 1
MIRT552598 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT553490 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT557972 FAM222B family with sequence similarity 222, member B 1 1
MIRT562011 LMNB1 lamin B1 1 1
MIRT564155 ZNF117 zinc finger protein 117 1 1
MIRT565002 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT565259 TPM3 tropomyosin 3 1 1
MIRT565967 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT566187 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT566921 LMAN2 lectin, mannose-binding 2 1 1
MIRT573021 SWAP70 SWAP switching B-cell complex 70kDa subunit 1 1
MIRT574867 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT574947 Vav3 vav 3 oncogene 1 1
MIRT611160 BTLA B and T lymphocyte associated 1 1
MIRT611239 ZNF550 zinc finger protein 550 1 2
MIRT611620 SLC35G3 solute carrier family 35, member G3 1 1
MIRT617563 RPSAP58 ribosomal protein SA pseudogene 58 1 2
MIRT623717 HAPLN1 hyaluronan and proteoglycan link protein 1 1 1
MIRT623971 FBN2 fibrillin 2 1 1
MIRT624024 EN2 engrailed homeobox 2 1 1
MIRT625209 TNFAIP8 tumor necrosis factor, alpha-induced protein 8 1 2
MIRT630783 CRLS1 cardiolipin synthase 1 1 1
MIRT631659 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT642822 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT642995 SNTG1 syntrophin, gamma 1 1 1
MIRT646026 S100A7A S100 calcium binding protein A7A 1 1
MIRT651177 ZNF319 zinc finger protein 319 1 1
MIRT652570 TLR6 toll-like receptor 6 1 1
MIRT652690 THUMPD3 THUMP domain containing 3 1 1
MIRT652806 TBL2 transducin (beta)-like 2 1 1
MIRT658075 FOXR2 forkhead box R2 1 1
MIRT668318 FNIP1 folliculin interacting protein 1 1 1
MIRT669081 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT683293 ZNF253 zinc finger protein 253 1 1
MIRT683828 ZNF682 zinc finger protein 682 1 1
MIRT686222 ZNF267 zinc finger protein 267 1 1
MIRT687153 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT687165 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT697751 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT698111 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT700087 RNF38 ring finger protein 38 1 1
MIRT701908 MMGT1 membrane magnesium transporter 1 1 1
MIRT702054 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT705920 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT707571 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 1 1
MIRT709247 CENPM centromere protein M 1 1
MIRT710506 BSDC1 BSD domain containing 1 1 1
MIRT720194 MPP6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 1 1
MIRT723230 FAM91A1 family with sequence similarity 91, member A1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*