Accession ID: MIRT003897 [miRNA, hsa-miR-212-3p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-212LinkOut: [miRBase ]
Synonyms MIRN212, mir-212, MIR212
Description Homo sapiens miR-212 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences . Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 17, but its expression has not been experimentally verified in human.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-212-3p
Mature Sequence 71| UAACAGUCUCCAGUCACGGCC |91
Evidence Not_experimental
Experiments
Putative hsa-miR-212-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-212-3p :: MECP2    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , Microarray , qRT-PCR , Western blot , Reporter assay;Western blot;Microarray;Other
Conditions MKN7 , MKN45/MKN74 , NUGC3 , NUGC4 , KATO-III/GCIY , TGBC11TKB , HEK293
Location of target site 3'UTR
Tools used in this research microRNA.org , PicTar , TargetScan , Sanger
Original Description (Extracted from the article) ... As seen on reporter assaying, miR-212 repressed the construct with the MECP2 3'-UTR.// ...

- Wada, R. Akiyama, Y. Hashimoto, Y. et al., 2010, Int J Cancer.

Article - Wada, R. Akiyama, Y. Hashimoto, Y. et al.
- Int J Cancer, 2010
To clarify the role of micro (mi) RNAs in gastric carcinogenesis, we studied the expression and function of miRNAs in gastric carcinoma (GC) cells. Initially, we performed microarray analysis using total RNA from 3 human GC cell lines and noncancerous gastric tissue. Among the downregulated miRNAs in GC cells, miR-212 expression was decreased in all 8 GC cell lines examined and a significant decrease of miR-212 expression in human primary GC tissues was also observed in 6 of 11 cases. Transfection of the precursor miR-212 molecule induced decreased growth of 3 GC cell lines. Using 3 different databases, methyl-CpG-binding protein MeCP2 was postulated to be a target of miR-212. As seen on reporter assaying, miR-212 repressed the construct with the MECP2 3'-UTR. Ectopic expression of miR-212 repressed expression of the MeCP2 protein but not the MECP2 mRNA level. These data suggest that downregulation of miR-212 may be related to gastric carcinogenesis through its target genes, such as MECP2.
LinkOut: [PMID: 20020497]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
78 hsa-miR-212-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003897 MECP2 methyl CpG binding protein 2 (Rett syndrome) 5 1
MIRT003966 WT1 Wilms tumor 1 2 1
MIRT003967 BRCA1 breast cancer 1, early onset 2 1
MIRT004341 TJP1 tight junction protein 1 3 1
MIRT004501 PEA15 phosphoprotein enriched in astrocytes 15 4 1
MIRT006293 PTCH1 patched 1 3 2
MIRT006504 RB1 retinoblastoma 1 3 1
MIRT007044 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 2 1
MIRT024968 CCNA2 cyclin A2 2 1
MIRT024969 CCNB1 cyclin B1 2 1
MIRT047000 DPF1 D4, zinc and double PHD fingers family 1 1 1
MIRT047001 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT053351 RBP2 retinol binding protein 2, cellular 3 2
MIRT053469 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 1
MIRT091254 FXR1 fragile X mental retardation, autosomal homolog 1 1 2
MIRT100365 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT100692 TJAP1 tight junction associated protein 1 (peripheral) 1 1
MIRT106173 RRS1 RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) 1 1
MIRT149853 LDLR low density lipoprotein receptor 1 1
MIRT217678 ASF1A ASF1 anti-silencing function 1 homolog A (S. cerevisiae) 1 1
MIRT259586 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT289306 TNRC6C trinucleotide repeat containing 6C 1 1
MIRT368373 ARID2 AT rich interactive domain 2 (ARID, RFX-like) 1 1
MIRT437838 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT438683 ACHE acetylcholinesterase 3 1
MIRT438881 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT442188 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT449482 STAG1 stromal antigen 1 1 1
MIRT453130 HOXC4 homeobox C4 1 1
MIRT455371 KDM5C lysine (K)-specific demethylase 5C 1 1
MIRT455525 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT458881 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT464181 VMP1 vacuole membrane protein 1 1 10
MIRT467689 SLC38A2 solute carrier family 38, member 2 1 2
MIRT476655 FZD6 frizzled family receptor 6 1 2
MIRT477438 EML4 echinoderm microtubule associated protein like 4 1 2
MIRT479293 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT485290 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT495257 BMPER BMP binding endothelial regulator 1 1
MIRT497152 PRDM15 PR domain containing 15 1 1
MIRT500829 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT506947 HS3ST3B1 heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 1 2
MIRT507624 CRTC1 CREB regulated transcription coactivator 1 1 1
MIRT508136 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT521605 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 2
MIRT526270 CCDC169 coiled-coil domain containing 169 1 1
MIRT526866 PARP11 poly (ADP-ribose) polymerase family, member 11 1 1
MIRT532418 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 1 1
MIRT532507 TWISTNB TWIST neighbor 1 2
MIRT534832 RAB18 RAB18, member RAS oncogene family 1 1
MIRT542576 ZNF280B zinc finger protein 280B 1 1
MIRT546159 TSPAN12 tetraspanin 12 1 1
MIRT547254 NUP50 nucleoporin 50kDa 1 2
MIRT547613 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT547706 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 2
MIRT549142 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT549454 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT551639 TRUB1 TruB pseudouridine (psi) synthase homolog 1 (E. coli) 1 2
MIRT554984 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT555923 OCLN occludin 1 2
MIRT557609 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT571511 ZNF711 zinc finger protein 711 1 1
MIRT572927 PRAMEF1 PRAME family member 1 1 1
MIRT573616 ZNF724P zinc finger protein 724, pseudogene 1 1
MIRT574925 Vmp1 vacuole membrane protein 1 1 1
MIRT614464 ALKBH4 alkB, alkylation repair homolog 4 (E. coli) 1 1
MIRT623024 OLFML2A olfactomedin-like 2A 1 1
MIRT639079 CD226 CD226 molecule 1 1
MIRT642133 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT653733 SLC25A32 solute carrier family 25 (mitochondrial folate carrier) , member 32 1 1
MIRT655168 PHF20L1 PHD finger protein 20-like 1 1 1
MIRT680988 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT681563 UBXN2A UBX domain protein 2A 1 1
MIRT696293 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT697725 USP8 ubiquitin specific peptidase 8 1 1
MIRT703295 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 1
MIRT718421 CALN1 calneuron 1 1 1
MIRT719459 APBA1 amyloid beta (A4) precursor protein-binding, family A, member 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*