Accession ID: MIRT003897 [miRNA, hsa-miR-212-3p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-212LinkOut: [miRBase ]
Synonyms MIRN212, mir-212, MIR212
Description Homo sapiens miR-212 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences . Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 17, but its expression has not been experimentally verified in human.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-212-3p
Mature Sequence 71| UAACAGUCUCCAGUCACGGCC |91
Evidence Not_experimental
Experiments
Putative hsa-miR-212-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-212-3p :: MECP2    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , Microarray , qRT-PCR , Western blot , Reporter assay;Western blot;Microarray;Other
Conditions MKN7 , MKN45/MKN74 , NUGC3 , NUGC4 , KATO-III/GCIY , TGBC11TKB , HEK293
Location of target site 3'UTR
Tools used in this research microRNA.org , PicTar , TargetScan , Sanger
Original Description (Extracted from the article) ... As seen on reporter assaying, miR-212 repressed the construct with the MECP2 3'-UTR.// ...

- Wada, R. Akiyama, Y. Hashimoto, Y. et al., 2010, Int J Cancer.

Article - Wada, R. Akiyama, Y. Hashimoto, Y. et al.
- Int J Cancer, 2010
To clarify the role of micro (mi) RNAs in gastric carcinogenesis, we studied the expression and function of miRNAs in gastric carcinoma (GC) cells. Initially, we performed microarray analysis using total RNA from 3 human GC cell lines and noncancerous gastric tissue. Among the downregulated miRNAs in GC cells, miR-212 expression was decreased in all 8 GC cell lines examined and a significant decrease of miR-212 expression in human primary GC tissues was also observed in 6 of 11 cases. Transfection of the precursor miR-212 molecule induced decreased growth of 3 GC cell lines. Using 3 different databases, methyl-CpG-binding protein MeCP2 was postulated to be a target of miR-212. As seen on reporter assaying, miR-212 repressed the construct with the MECP2 3'-UTR. Ectopic expression of miR-212 repressed expression of the MeCP2 protein but not the MECP2 mRNA level. These data suggest that downregulation of miR-212 may be related to gastric carcinogenesis through its target genes, such as MECP2.
LinkOut: [PMID: 20020497]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
12 hsa-miR-212-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003897 MECP2 methyl CpG binding protein 2 (Rett syndrome) 5 1
MIRT003966 WT1 Wilms tumor 1 2 1
MIRT003967 BRCA1 breast cancer 1, early onset 2 1
MIRT004341 TJP1 tight junction protein 1 3 1
MIRT004501 PEA15 phosphoprotein enriched in astrocytes 15 4 1
MIRT006293 PTCH1 patched 1 3 1
MIRT006504 RB1 retinoblastoma 1 3 1
MIRT007044 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 2 1
MIRT024968 CCNA2 cyclin A2 2 1
MIRT024969 CCNB1 cyclin B1 2 1
MIRT047000 DPF1 D4, zinc and double PHD fingers family 1 1 1
MIRT047001 AGO1 eukaryotic translation initiation factor 2C, 1 1 1