Accession ID: MIRT003897 [miRNA, hsa-miR-212-3p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-212LinkOut: [miRBase ]
Synonyms MIRN212, mir-212, MIR212
Description Homo sapiens miR-212 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences . Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 17, but its expression has not been experimentally verified in human.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-212-3p
Mature Sequence 71| UAACAGUCUCCAGUCACGGCC |91
Evidence Not_experimental
Experiments
Putative hsa-miR-212-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MECP2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AUTSX3, DKFZp686A24160, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT
Description methyl CpG binding protein 2 (Rett syndrome)
Transcript NM_0049    LinkOut: [ RefSeq ]
Other Transcripts NM_0011107   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MECP2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MECP2
(miRNA target sites are highlighted)
>MECP2|NM_0049|3'UTR
   1 TGACTTTACACGGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCT
  81 CTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCAGGGT
 161 GGGAGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAG
 241 CTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCAC
 321 CTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACAGAGCGACAGAGCAGTTGAGAGGACACTCCCGTTTT
 401 CGGTGCCATCAGTGCCCCGTCTACAGCTCCCCCAGCTCCCCCCACCTCCCCCACTCCCAACCACGTTGGGACAGGGAGGT
 481 GTGAGGCAGGAGAGACAGTTGGATTCTTTAGAGAAGATGGATATGACCAGTGGCTATGGCCTGTGCGATCCCACCCGTGG
 561 TGGCTCAAGTCTGGCCCCACACCAGCCCCAATCCAAAACTGGCAAGGACGCTTCACAGGACAGGAAAGTGGCACCTGTCT
 641 GCTCCAGCTCTGGCATGGCTAGGAGGGGGGAGTCCCTTGAACTACTGGGTGTAGACTGGCCTGAACCACAGGAGAGGATG
 721 GCCCAGGGTGAGGTGGCATGGTCCATTCTCAAGGGACGTCCTCCAACGGGTGGCGCTAGAGGCCATGGAGGCAGTAGGAC
 801 AAGGTGCAGGCAGGCTGGCCTGGGGTCAGGCCGGGCAGAGCACAGCGGGGTGAGAGGGATTCCTAATCACTCAGAGCAGT
 881 CTGTGACTTAGTGGACAGGGGAGGGGGCAAAGGGGGAGGAGAAGAAAATGTTCTTCCAGTTACTTTCCAATTCTCCTTTA
 961 GGGACAGCTTAGAATTATTTGCACTATTGAGTCTTCATGTTCCCACTTCAAAACAAACAGATGCTCTGAGAGCAAACTGG
1041 CTTGAATTGGTGACATTTAGTCCCTCAAGCCACCAGATGTGACAGTGTTGAGAACTACCTGGATTTGTATATATACCTGC
1121 GCTTGTTTTAAAGTGGGCTCAGCACATAGGGTTCCCACGAAGCTCCGAAACTCTAAGTGTTTGCTGCAATTTTATAAGGA
1201 CTTCCTGATTGGTTTCTCTTCTCCCCTTCCATTTCTGCCTTTTGTTCATTTCATCCTTTCACTTCTTTCCCTTCCTCCGT
1281 CCTCCTCCTTCCTAGTTCATCCCTTCTCTTCCAGGCAGCCGCGGTGCCCAACCACACTTGTCGGCTCCAGTCCCCAGAAC
1361 TCTGCCTGCCCTTTGTCCTCCTGCTGCCAGTACCAGCCCCACCCTGTTTTGAGCCCTGAGGAGGCCTTGGGCTCTGCTGA
1441 GTCCGACCTGGCCTGTCTGTGAAGAGCAAGAGAGCAGCAAGGTCTTGCTCTCCTAGGTAGCCCCCTCTTCCCTGGTAAGA
1521 AAAAGCAAAAGGCATTTCCCACCCTGAACAACGAGCCTTTTCACCCTTCTACTCTAGAGAAGTGGACTGGAGGAGCTGGG
1601 CCCGATTTGGTAGTTGAGGAAAGCACAGAGGCCTCCTGTGGCCTGCCAGTCATCGAGTGGCCCAACAGGGGCTCCATGCC
1681 AGCCGACCTTGACCTCACTCAGAAGTCCAGAGTCTAGCGTAGTGCAGCAGGGCAGTAGCGGTACCAATGCAGAACTCCCA
1761 AGACCCGAGCTGGGACCAGTACCTGGGTCCCCAGCCCTTCCTCTGCTCCCCCTTTTCCCTCGGAGTTCTTCTTGAATGGC
1841 AATGTTTTGCTTTTGCTCGATGCAGACAGGGGGCCAGAACACCACACATTTCACTGTCTGTCTGGTCCATAGCTGTGGTG
1921 TAGGGGCTTAGAGGCATGGGCTTGCTGTGGGTTTTTAATTGATCAGTTTTCATGTGGGATCCCATCTTTTTAACCTCTGT
2001 TCAGGAAGTCCTTATCTAGCTGCATATCTTCATCATATTGGTATATCCTTTTCTGTGTTTACAGAGATGTCTCTTATATC
2081 TAAATCTGTCCAACTGAGAAGTACCTTATCAAAGTAGCAAATGAGACAGCAGTCTTATGCTTCCAGAAACACCCACAGGC
2161 ATGTCCCATGTGAGCTGCTGCCATGAACTGTCAAGTGTGTGTTGTCTTGTGTATTTCAGTTATTGTCCCTGGCTTCCTTA
2241 CTATGGTGTAATCATGAAGGAGTGAAACATCATAGAAACTGTCTAGCACTTCCTTGCCAGTCTTTAGTGATCAGGAACCA
2321 TAGTTGACAGTTCCAATCAGTAGCTTAAGAAAAAACCGTGTTTGTCTCTTCTGGAATGGTTAGAAGTGAGGGAGTTTGCC
2401 CCGTTCTGTTTGTAGAGTCTCATAGTTGGACTTTCTAGCATATATGTGTCCATTTCCTTATGCTGTAAAAGCAAGTCCTG
2481 CAACCAAACTCCCATCAGCCCAATCCCTGATCCCTGATCCCTTCCACCTGCTCTGCTGATGACCCCCCCAGCTTCACTTC
2561 TGACTCTTCCCCAGGAAGGGAAGGGGGGTCAGAAGAGAGGGTGAGTCCTCCAGAACTCTTCCTCCAAGGACAGAAGGCTC
2641 CTGCCCCCATAGTGGCCTCGAACTCCTGGCACTACCAAAGGACACTTATCCACGAGAGCGCAGCATCCGACCAGGTTGTC
2721 ACTGAGAAGATGTTTATTTTGGTCAGTTGGGTTTTTATGTATTATACTTAGTCAAATGTAATGTGGCTTCTGGAATCATT
2801 GTCCAGAGCTGCTTCCCCGTCACCTGGGCGTCATCTGGTCCTGGTAAGAGGAGTGCGTGGCCCACCAGGCCCCCCTGTCA
2881 CCCATGACAGTTCATTCAGGGCCGATGGGGCAGTCGTGGTTGGGAACACAGCATTTCAAGCGTCACTTTATTTCATTCGG
2961 GCCCCACCTGCAGCTCCCTCAAAGAGGCAGTTGCCCAGCCTCTTTCCCTTCCAGTTTATTCCAGAGCTGCCAGTGGGGCC
3041 TGAGGCTCCTTAGGGTTTTCTCTCTATTTCCCCCTTTCTTCCTCATTCCCTCGTCTTTCCCAAAGGCATCACGAGTCAGT
3121 CGCCTTTCAGCAGGCAGCCTTGGCGGTTTATCGCCCTGGCAGGCAGGGGCCCTGCAGCTCTCATGCTGCCCCTGCCTTGG
3201 GGTCAGGTTGACAGGAGGTTGGAGGGAAAGCCTTAAGCTGCAGGATTCTCACCAGCTGTGTCCGGCCCAGTTTTGGGGTG
3281 TGACCTCAATTTCAATTTTGTCTGTACTTGAACATTATGAAGATGGGGGCCTCTTTCAGTGAATTTGTGAACAGCAGAAT
3361 TGACCGACAGCTTTCCAGTACCCATGGGGCTAGGTCATTAAGGCCACATCCACAGTCTCCCCCACCCTTGTTCCAGTTGT
3441 TAGTTACTACCTCCTCTCCTGACAATACTGTATGTCGTCGAGCTCCCCCCAGGTCTACCCCTCCCGGCCCTGCCTGCTGG
3521 TGGGCTTGTCATAGCCAGTGGGATTGCCGGTCTTGACAGCTCAGTGAGCTGGAGATACTTGGTCACAGCCAGGCGCTAGC
3601 ACAGCTCCCTTCTGTTGATGCTGTATTCCCATATCAAAAGACACAGGGGACACCCAGAAACGCCACATCCCCCAATCCAT
3681 CAGTGCCAAACTAGCCAACGGCCCCAGCTTCTCAGCTCGCTGGATGGCGGAAGCTGCTACTCGTGAGCGCCAGTGCGGGT
3761 GCAGACAATCTTCTGTTGGGTGGCATCATTCCAGGCCCGAAGCATGAACAGTGCACCTGGGACAGGGAGCAGCCCCAAAT
3841 TGTCACCTGCTTCTCTGCCCAGCTTTTCATTGCTGTGACAGTGATGGCGAAAGAGGGTAATAACCAGACACAAACTGCCA
3921 AGTTGGGTGGAGAAAGGAGTTTCTTTAGCTGACAGAATCTCTGAATTTTAAATCACTTAGTAAGCGGCTCAAGCCCAGGA
4001 GGGAGCAGAGGGATACGAGCGGAGTCCCCTGCGCGGGACCATCTGGAATTGGTTTAGCCCAAGTGGAGCCTGACAGCCAG
4081 AACTCTGTGTCCCCCGTCTAACCACAGCTCCTTTTCCAGAGCATTCCAGTCAGGCTCTCTGGGCTGACTGGGCCAGGGGA
4161 GGTTACAGGTACCAGTTCTTTAAGAAGATCTTTGGGCATATACATTTTTAGCCTGTGTCATTGCCCCAAATGGATTCCTG
4241 TTTCAAGTTCACACCTGCAGATTCTAGGACCTGTGTCCTAGACTTCAGGGAGTCAGCTGTTTCTAGAGTTCCTACCATGG
4321 AGTGGGTCTGGAGGACCTGCCCGGTGGGGGGGCAGAGCCCTGCTCCCTCCGGGTCTTCCTACTCTTCTCTCTGCTCTGAC
4401 GGGATTTGTTGATTCTCTCCATTTTGGTGTCTTTCTCTTTTAGATATTGTATCAATCTTTAGAAAAGGCATAGTCTACTT
4481 GTTATAAATCGTTAGGATACTGCCTCCCCCAGGGTCTAAAATTACATATTAGAGGGGAAAAGCTGAACACTGAAGTCAGT
4561 TCTCAACAATTTAGAAGGAAAACCTAGAAAACATTTGGCAGAAAATTACATTTCGATGTTTTTGAATGAATACGAGCAAG
4641 CTTTTACAACAGTGCTGATCTAAAAATACTTAGCACTTGGCCTGAGATGCCTGGTGAGCATTACAGGCAAGGGGAATCTG
4721 GAGGTAGCCGACCTGAGGACATGGCTTCTGAACCTGTCTTTTGGGAGTGGTATGGAAGGTGGAGCGTTCACCAGTGACCT
4801 GGAAGGCCCAGCACCACCCTCCTTCCCACTCTTCTCATCTTGACAGAGCCTGCCCCAGCGCTGACGTGTCAGGAAAACAC
4881 CCAGGGAACTAGGAAGGCACTTCTGCCTGAGGGGCAGCCTGCCTTGCCCACTCCTGCTCTGCTCGCCTCGGATCAGCTGA
4961 GCCTTCTGAGCTGGCCTCTCACTGCCTCCCCAAGGCCCCCTGCCTGCCCTGTCAGGAGGCAGAAGGAAGCAGGTGTGAGG
5041 GCAGTGCAAGGAGGGAGCACAACCCCCAGCTCCCGCTCCGGGCTCCGACTTGTGCACAGGCAGAGCCCAGACCCTGGAGG
5121 AAATCCTACCTTTGAATTCAAGAACATTTGGGGAATTTGGAAATCTCTTTGCCCCCAAACCCCCATTCTGTCCTACCTTT
5201 AATCAGGTCCTGCTCAGCAGTGAGAGCAGATGAGGTGAAAAGGCCAAGAGGTTTGGCTCCTGCCCACTGATAGCCCCTCT
5281 CCCCGCAGTGTTTGTGTGTCAAGTGGCAAAGCTGTTCTTCCTGGTGACCCTGATTATATCCAGTAACACATAGACTGTGC
5361 GCATAGGCCTGCTTTGTCTCCTCTATCCTGGGCTTTTGTTTTGCTTTTTAGTTTTGCTTTTAGTTTTTCTGTCCCTTTTA
5441 TTTAACGCACCGACTAGACACACAAAGCAGTTGAATTTTTATATATATATCTGTATATTGCACAATTATAAACTCATTTT
5521 GCTTGTGGCTCCACACACACAAAAAAAGACCTGTTAAAATTATACCTGTTGCTTAATTACAATATTTCTGATAACCATAG
5601 CATAGGACAAGGGAAAATAAAAAAAGAAAAAAAAGAAAAAAAAACGACAAATCTGTCTGCTGGTCACTTCTTCTGTCCAA
5681 GCAGATTCGTGGTCTTTTCCTCGCTTCTTTCAAGGGCTTTCCTGTGCCAGGTGAAGGAGGCTCCAGGCAGCACCCAGGTT
5761 TTGCACTCTTGTTTCTCCCGTGCTTGTGAAAGAGGTCCCAAGGTTCTGGGTGCAGGAGCGCTCCCTTGACCTGCTGAAGT
5841 CCGGAACGTAGTCGGCACAGCCTGGTCGCCTTCCACCTCTGGGAGCTGGAGTCCACTGGGGTGGCCTGACTCCCCCAGTC
5921 CCCTTCCCGTGACCTGGTCAGGGTGAGCCCATGTGGAGTCAGCCTCGCAGGCCTCCCTGCCAGTAGGGTCCGAGTGTGTT
6001 TCATCCTTCCCACTCTGTCGAGCCTGGGGGCTGGAGCGGAGACGGGAGGCCTGGCCTGTCTCGGAACCTGTGAGCTGCAC
6081 CAGGTAGAACGCCAGGGACCCCAGAATCATGTGCGTCAGTCCAAGGGGTCCCCTCCAGGAGTAGTGAAGACTCCAGAAAT
6161 GTCCCTTTCTTCTCCCCCATCCTACGAGTAATTGCATTTGCTTTTGTAATTCTTAATGAGCAATATCTGCTAGAGAGTTT
6241 AGCTGTAACAGTTCTTTTTGATCATCTTTTTTTAATAATTAGAAACACCAAAAAAATCCAGAAACTTGTTCTTCCAAAGC
6321 AGAGAGCATTATAATCACCAGGGCCAAAAGCTTCCCTCCCTGCTGTCATTGCTTCTTCTGAGGCCTGAATCCAAAAGAAA
6401 AACAGCCATAGGCCCTTTCAGTGGCCGGGCTACCCGTGAGCCCTTCGGAGGACCAGGGCTGGGGCAGCCTCTGGGCCCAC
6481 ATCCGGGGCCAGCTCCGGCGTGTGTTCAGTGTTAGCAGTGGGTCATGATGCTCTTTCCCACCCAGCCTGGGATAGGGGCA
6561 GAGGAGGCGAGGAGGCCGTTGCCGCTGATGTTTGGCCGTGAACAGGTGGGTGTCTGCGTGCGTCCACGTGCGTGTTTTCT
6641 GACTGACATGAAATCGACGCCCGAGTTAGCCTCACCCGGTGACCTCTAGCCCTGCCCGGATGGAGCGGGGCCCACCCGGT
6721 TCAGTGTTTCTGGGGAGCTGGACAGTGGAGTGCAAAAGGCTTGCAGAACTTGAAGCCTGCTCCTTCCCTTGCTACCACGG
6801 CCTCCTTTCCGTTTGATTTGTCACTGCTTCAATCAATAACAGCCGCTCCAGAGTCAGTAGTCAATGAATATATGACCAAA
6881 TATCACCAGGACTGTTACTCAATGTGTGCCGAGCCCTTGCCCATGCTGGGCTCCCGTGTATCTGGACACTGTAACGTGTG
6961 CTGTGTTTGCTCCCCTTCCCCTTCCTTCTTTGCCCTTTACTTGTCTTTCTGGGGTTTTTCTGTTTGGGTTTGGTTTGGTT
7041 TTTATTTCTCCTTTTGTGTTCCAAACATGAGGTTCTCTCTACTGGTCCTCTTAACTGTGGTGTTGAGGCTTATATTTGTG
7121 TAATTTTTGGTGGGTGAAAGGAATTTTGCTAAGTAAATCTCTTCTGTGTTTGAACTGAAGTCTGTATTGTAACTATGTTT
7201 AAAGTAATTGTTCCAGAGACAAATATTTCTAGACACTTTTTCTTTACAAACAAAAGCATTCGGAGGGAGGGGGATGGTGA
7281 CTGAGATGAGAGGGGAGAGCTGAACAGATGACCCCTGCCCAGATCAGCCAGAAGCCACCCAAAGCAGTGGAGCCCAGGAG
7361 TCCCACTCCAAGCCAGCAAGCCGAATAGCTGATGTGTTGCCACTTTCCAAGTCACTGCAAAACCAGGTTTTGTTCCGCCC
7441 AGTGGATTCTTGTTTTGCTTCCCCTCCCCCCGAGATTATTACCACCATCCCGTGCTTTTAAGGAAAGGCAAGATTGATGT
7521 TTCCTTGAGGGGAGCCAGGAGGGGATGTGTGTGTGCAGAGCTGAAGAGCTGGGGAGAATGGGGCTGGGCCCACCCAAGCA
7601 GGAGGCTGGGACGCTCTGCTGTGGGCACAGGTCAGGCTAATGTTGGCAGATGCAGCTCTTCCTGGACAGGCCAGGTGGTG
7681 GGCATTCTCTCTCCAAGGTGTGCCCCGTGGGCATTACTGTTTAAGACACTTCCGTCACATCCCACCCCATCCTCCAGGGC
7761 TCAACACTGTGACATCTCTATTCCCCACCCTCCCCTTCCCAGGGCAATAAAATGACCATGGAGGGGGCTTGCACTCTCTT
7841 GGCTGTCACCCGATCGCCAGCAAAACTTAGATGTGAGAAAACCCCTTCCCATTCCATGGCGAAAACATCTCCTTAGAAAA
7921 GCCATTACCCTCATTAGGCATGGTTTTGGGCTCCCAAAACACCTGACAGCCCCTCCCTCCTCTGAGAGGCGGAGAGTGCT
8001 GACTGTAGTGACCATTGCATGCCGGGTGCAGCATCTGGAAGAGCTAGGCAGGGTGTCTGCCCCCTCCTGAGTTGAAGTCA
8081 TGCTCCCCTGTGCCAGCCCAGAGGCCGAGAGCTATGGACAGCATTGCCAGTAACACAGGCCACCCTGTGCAGAAGGGAGC
8161 TGGCTCCAGCCTGGAAACCTGTCTGAGGTTGGGAGAGGTGCACTTGGGGCACAGGGAGAGGCCGGGACACACTTAGCTGG
8241 AGATGTCTCTAAAAGCCCTGTATCGTATTCACCTTCAGTTTTTGTGTTTTGGGACAATTACTTTAGAAAATAAGTAGGTC
8321 GTTTTAAAAACAAAAATTATTGATTGCTTTTTTGTAGTGTTCAGAAAAAAGGTTCTTTGTGTATAGCCAAATGACTGAAA
8401 GCACTGATATATTTAAAAACAAAAGGCAATTTATTAAGGAAATTTGTACCATTTCAGTAAACCTGTCTGAATGTACCTGT
8481 ATACGTTTCAAAAACACCCCCCCCCCACTGAATCCCTGTAACCTATTTATTATATAAAGAGTTTGCCTTATAAATTT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccggcACUGACCUCUGACAAu 5'
               | ||  | ||||||| 
Target 5' aaataTCACCAG-GACTGTTa 3'
6878 - 6897 143.00 -9.60
2
miRNA  3' ccGGCACUGACCUCUGACAau 5'
            | | || ||  ||||||  
Target 5' ggCGGAGAGTGCTGACTGTag 3'
7988 - 8008 135.00 -16.80
3
miRNA  3' ccGGCACUG-ACCUCUGACAau 5'
            | || ||    |||||||  
Target 5' tcCAGTAACACATAGACTGTgc 3'
5339 - 5360 127.00 -10.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-212-3p :: MECP2    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , Microarray , qRT-PCR , Western blot , Reporter assay;Western blot;Microarray;Other
Conditions MKN7 , MKN45/MKN74 , NUGC3 , NUGC4 , KATO-III/GCIY , TGBC11TKB , HEK293
Location of target site 3'UTR
Tools used in this research microRNA.org , PicTar , TargetScan , Sanger
Original Description (Extracted from the article) ... As seen on reporter assaying, miR-212 repressed the construct with the MECP2 3'-UTR.// ...

- Wada, R. Akiyama, Y. Hashimoto, Y. et al., 2010, Int J Cancer.

Article - Wada, R. Akiyama, Y. Hashimoto, Y. et al.
- Int J Cancer, 2010
To clarify the role of micro (mi) RNAs in gastric carcinogenesis, we studied the expression and function of miRNAs in gastric carcinoma (GC) cells. Initially, we performed microarray analysis using total RNA from 3 human GC cell lines and noncancerous gastric tissue. Among the downregulated miRNAs in GC cells, miR-212 expression was decreased in all 8 GC cell lines examined and a significant decrease of miR-212 expression in human primary GC tissues was also observed in 6 of 11 cases. Transfection of the precursor miR-212 molecule induced decreased growth of 3 GC cell lines. Using 3 different databases, methyl-CpG-binding protein MeCP2 was postulated to be a target of miR-212. As seen on reporter assaying, miR-212 repressed the construct with the MECP2 3'-UTR. Ectopic expression of miR-212 repressed expression of the MeCP2 protein but not the MECP2 mRNA level. These data suggest that downregulation of miR-212 may be related to gastric carcinogenesis through its target genes, such as MECP2.
LinkOut: [PMID: 20020497]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
12 hsa-miR-212-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003897 MECP2 methyl CpG binding protein 2 (Rett syndrome) 5 1
MIRT003966 WT1 Wilms tumor 1 2 1
MIRT003967 BRCA1 breast cancer 1, early onset 2 1
MIRT004341 TJP1 tight junction protein 1 (zona occludens 1) 3 1
MIRT004501 PEA15 phosphoprotein enriched in astrocytes 15 4 1
MIRT006293 PTCH1 patched homolog 1 (Drosophila) 3 1
MIRT006504 RB1 retinoblastoma 1 3 1
MIRT007044 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 2 1
MIRT024968 CCNA2 cyclin A2 2 1
MIRT024969 CCNB1 cyclin B1 2 1
MIRT047000 DPF1 D4, zinc and double PHD fingers family 1 1 1
MIRT047001 AGO1 eukaryotic translation initiation factor 2C, 1 1 1