Accession ID: MIRT003899 [miRNA, hsa-miR-15a-5p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-15aLinkOut: [miRBase ]
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Mature Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-15a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_0004    LinkOut: [ RefSeq ]
Other Transcripts NM_0011361 , NM_0011361 , NM_2014 , NM_2014   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_0004|3'UTR
   1 TAGACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATA
  81 ATGTGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCT
 161 GAACTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGT
 241 TTTGTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCT
 321 TAGCCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGAT
 401 GCTTCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAA
 481 CATTTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTA
 561 TATTTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGA
 641 CTTCAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTT
 721 ACGGGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGT
 801 ACAGAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGAC
 881 TTTTCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTT
 961 AACCAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCC
1041 TGGACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGA
1121 GCAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... We found that miR-20a, miR-17-5p, and miRNA106b affected signi´Čücantly luciferase expression (Fig. 1B). In contrast, a scrambled miRNA sequence, as well as the other candidate miRNAs (miR-15a, miR-130a, let-7d and let-7a) showed no effect in this assay. Curiously, miR-106a, which is closely related to miR-106b, had in this assay an inconsistent effect. ...

- Hebert, S. S. Horre, K. Nicolai, L. et al., 2009, Neurobiol Dis.

Article - Hebert, S. S. Horre, K. Nicolai, L. et al.
- Neurobiol Dis, 2009
Gene dosage effects of Amyloid precursor protein (APP) can cause familial AD. Recent evidence suggest that microRNA (miRNA) pathways, implicated in gene transcriptional control, could be involved in the development of sporadic Alzheimer's disease (AD). We therefore investigated whether miRNAs could participate in the regulation of APP gene expression. We show that miRNAs belonging to the miR-20a family (that is, miR-20a, miR-17-5p and miR-106b) could regulate APP expression in vitro and at the endogenous level in neuronal cell lines. A tight correlation between these miRNAs and APP was found during brain development and in differentiating neurons. We thus identify miRNAs as novel endogenous regulators of APP expression, suggesting that variations in miRNA expression could contribute to changes in APP expression in the brain during development and disease. This possibility is further corroborated by the observation that a statistically significant decrease in miR-106b expression was found in sporadic AD patients.
LinkOut: [PMID: 19110058]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
132 hsa-miR-15a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 polycomb ring finger oncogene 3 1
MIRT000282 WNT3A wingless-type MMTV integration site family, member 3A 3 2
MIRT000283 MYB v-myb myeloblastosis viral oncogene homolog (avian) 5 3
MIRT000284 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT000285 CCND2 cyclin D2 3 3
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 B-cell CLL/lymphoma 2 5 12
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2 (Drosophila) 2 1
MIRT000823 TMEM251 chromosome 14 open reading frame 109 2 1
MIRT000825 CARD8 caspase recruitment domain family, member 8 2 1
MIRT000827 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63kDa 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein-like 2 2 1
MIRT000835 ECHDC1 enoyl CoA hydratase domain containing 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3-like 2 1
MIRT000851 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 2 1
MIRT000853 H3F3B H3 histone, family 3B (H3.3B) 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase-like hydrolase domain containing 2 2 1
MIRT000859 HERC6 hect domain and RLD 6 2 1
MIRT000863 HRSP12 heat-responsive protein 12 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock 70kDa protein 1A 2 1
MIRT000868 JUN jun oncogene 2 1
MIRT000878 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1
MIRT000880 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 2 1
MIRT000884 OMA1 OMA1 homolog, zinc metallopeptidase (S. cerevisiae) 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase-like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase, beta 2 1
MIRT000892 PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 primase, DNA, polypeptide 1 (49kDa) 2 1
MIRT000898 RAD51C RAD51 homolog C (S. cerevisiae) 2 1
MIRT000900 RHOT1 ras homolog gene family, member T1 2 1
MIRT000902 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 2 1
MIRT000906 SLC35A1 solute carrier family 35 (CMP-sialic acid transporter), member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35, member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 6
MIRT001228 CCNE1 cyclin E1 5 4
MIRT001802 BACE1 beta-site APP-cleaving enzyme 1 2 1
MIRT002946 DMTF1 cyclin D binding myb-like transcription factor 1 2 1
MIRT003333 BRCA1 breast cancer 1, early onset 2 2
MIRT003334 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT003872 WIPF1 WAS/WASL interacting protein family, member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 2 1
MIRT003874 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69, member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 coiled-coil domain containing 111 2 1
MIRT003883 C2orf43 chromosome 2 open reading frame 43 2 1
MIRT003884 C4orf27 chromosome 4 open reading frame 27 2 1
MIRT003885 NIPAL2 NIPA-like domain containing 2 2 1
MIRT003886 TRMT13 coiled-coil domain containing 76 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta (A4) precursor protein 2 1
MIRT004046 UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 4 3
MIRT004680 TSPYL2 TSPY-like 2 2 1
MIRT004829 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 (keratinocyte growth factor) 2 1
MIRT006176 CLCN3 chloride channel 3 4 1
MIRT006177 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 4 1
MIRT006181 MN1 meningioma (disrupted in balanced translocation) 1 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 3 1
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon, gamma 2 1
MIRT006998 PURA purine-rich element binding protein A 1 1
MIRT007090 RECK reversion-inducing-cysteine-rich protein with kazal motifs 2 1
MIRT032077 DLK1 delta-like 1 homolog (Drosophila) 2 1
MIRT051311 PLA2G2D phospholipase A2, group IID 1 1
MIRT051312 ACVR1B activin A receptor, type IB 1 1
MIRT051313 IKBKG inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT051315 PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) 1 1
MIRT051316 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y-like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3, acidic 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT051329 CCT6B chaperonin containing TCP1, subunit 6B (zeta 2) 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC-like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 1
MIRT051342 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 1 1
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif-containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT051349 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing 1 1