Accession ID: MIRT003900 [miRNA, hsa-miR-130a-3p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-130aLinkOut: [miRBase ]
Description Homo sapiens miR-130a stem-loop
Comment miR-130a was first identified by cloning studies in mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-130a-3p
Mature Sequence 55| CAGUGCAAUGUUAAAAGGGCAU |76
Evidence Experimental
Experiments Cloned
Putative hsa-miR-130a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_0004    LinkOut: [ RefSeq ]
Other Transcripts NM_0011361 , NM_0011361 , NM_2014 , NM_2014   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_0004|3'UTR
   1 TAGACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATA
  81 ATGTGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCT
 161 GAACTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGT
 241 TTTGTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCT
 321 TAGCCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGAT
 401 GCTTCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAA
 481 CATTTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTA
 561 TATTTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGA
 641 CTTCAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTT
 721 ACGGGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGT
 801 ACAGAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGAC
 881 TTTTCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTT
 961 AACCAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCC
1041 TGGACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGA
1121 GCAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uacgGGAAAAUUGU-AACGUGAc 5'
              ||||||:|||  ||::|| 
Target 5' atcgCCTTTTGACAGCTGTGCTg 3'
120 - 142 114.00 -17.30
2
miRNA  3' uacGGGAAA--AUU-GU-A-ACGUGAc 5'
             :|||||  |:| || | ||||:| 
Target 5' tatTCCTTTCCTGATCACTATGCATTt 3'
444 - 470 113.00 -8.00
3
miRNA  3' uaCGGGAAAAUUGU-AACGUGac 5'
            |||| || : || |||:|:  
Target 5' taGCCCCTTAGCCAGTTGTATat 3'
313 - 335 112.00 -10.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-130a-3p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... We found that miR-20a, miR-17-5p, and miRNA106b affected signi´Čücantly luciferase expression (Fig. 1B). In contrast, a scrambled miRNA sequence, as well as the other candidate miRNAs (miR-15a, miR-130a, let-7d and let-7a) showed no effect in this assay. Curiously, miR-106a, which is closely related to miR-106b, had in this assay an inconsistent effect. ...

- Hebert, S. S. Horre, K. Nicolai, L. et al., 2009, Neurobiol Dis.

Article - Hebert, S. S. Horre, K. Nicolai, L. et al.
- Neurobiol Dis, 2009
Gene dosage effects of Amyloid precursor protein (APP) can cause familial AD. Recent evidence suggest that microRNA (miRNA) pathways, implicated in gene transcriptional control, could be involved in the development of sporadic Alzheimer's disease (AD). We therefore investigated whether miRNAs could participate in the regulation of APP gene expression. We show that miRNAs belonging to the miR-20a family (that is, miR-20a, miR-17-5p and miR-106b) could regulate APP expression in vitro and at the endogenous level in neuronal cell lines. A tight correlation between these miRNAs and APP was found during brain development and in differentiating neurons. We thus identify miRNAs as novel endogenous regulators of APP expression, suggesting that variations in miRNA expression could contribute to changes in APP expression in the brain during development and disease. This possibility is further corroborated by the observation that a statistically significant decrease in miR-106b expression was found in sporadic AD patients.
LinkOut: [PMID: 19110058]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
26 hsa-miR-130a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000958 HOXA5 homeobox A5 4 2
MIRT001141 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 2 1
MIRT003005 TAC1 tachykinin, precursor 1 2 1
MIRT003782 ATXN1 ataxin 1 4 1
MIRT003900 APP amyloid beta (A4) precursor protein 2 1
MIRT004358 MEOX2 mesenchyme homeobox 2 4 2
MIRT004575 CSF1 colony stimulating factor 1 (macrophage) 3 2
MIRT005441 HOXA10 homeobox A10 3 1
MIRT005674 KLF4 Kruppel-like factor 4 (gut) 4 1
MIRT005957 PPARG peroxisome proliferator-activated receptor gamma 3 1
MIRT006258 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006259 ATG2B ATG2 autophagy related 2 homolog B (S. cerevisiae) 1 1
MIRT006356 ESR1 estrogen receptor 1 1 1
MIRT006992 IFITM1 interferon induced transmembrane protein 1 (9-27) 1 1
MIRT007055 RUNX3 runt-related transcription factor 3 2 1
MIRT007137 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT007138 RAB5A RAB5A, member RAS oncogene family 1 1
MIRT007139 DNM2 dynamin 2 1 1
MIRT007140 LDLR low density lipoprotein receptor 1 1
MIRT007141 ACVR1 activin A receptor, type I 1 1
MIRT007142 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT007143 SMAD5 SMAD family member 5 1 1
MIRT007144 SMAD4 SMAD family member 4 2 2
MIRT021867 ZFPM2 zinc finger protein, multitype 2 1 1
MIRT045849 STK38L serine/threonine kinase 38 like 1 1
MIRT045850 CTSA cathepsin A 1 1