Accession ID: MIRT003901 [miRNA, hsa-let-7d-5p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7dLinkOut: [miRBase ]
Synonyms LET7D, MIRNLET7D, hsa-let-7d, let-7d, MIRLET7D
Description Homo sapiens let-7d stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7d-5p
Mature Sequence 8| AGAGGUAGUAGGUUGCAUAGUU |29
Evidence Experimental
Experiments Cloned
Putative hsa-let-7d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_001136016    LinkOut: [ RefSeq ]
Other Transcripts NM_000484 , NM_001136129 , NM_001136130 , NM_001136131 , NM_201413 , NM_201414   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_001136016|3'UTR
   1 ACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATAATG
  81 TGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCTGAA
 161 CTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGTTTT
 241 GTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCTTAG
 321 CCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGATGCT
 401 TCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAACAT
 481 TTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTATAT
 561 TTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGACTT
 641 CAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTTACG
 721 GGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGTACA
 801 GAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGACTTT
 881 TCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTTAAC
 961 CAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCCTGG
1041 ACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGAGCA
1121 AAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugauaCGUUGGAU--GAUGGAGa 5'
                |:||: ||  |||:||| 
Target 5' acatcaGTAATGTATTCTATCTCt 3'
176 - 199 138.00 -12.30
2
miRNA  3' uuGAUACGUUGGAUGAUGGAGa 5'
            ||:| ||: :|:||:|:|| 
Target 5' taCTGTACAGATTGCTGCTTCt 3'
532 - 553 136.00 -18.80
3
miRNA  3' uuGAUAC---GUUGG---AUGAUGGAGa 5'
            :|:||   |||::   | ||||:|: 
Target 5' gtTTGTGACCCAATTAAGTCCTACTTTa 3'
343 - 370 120.00 -6.99
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7d-5p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , miRBase Target Database
Original Description (Extracted from the article) ... We found that miR-20a, miR-17-5p, and miRNA106b affected signi´Čücantly luciferase expression (Fig. 1B). In contrast, a scrambled miRNA sequence, as well as the other candidate miRNAs (miR-15a, miR-130a, let-7d and let-7a) showed no effect in this assay. Curiously, miR-106a, which is closely related to miR-106b, had in this assay an inconsistent effect. ...

- Hebert, S. S. Horre, K. Nicolai, L. et al., 2009, Neurobiol Dis.

Article - Hebert, S. S. Horre, K. Nicolai, L. et al.
- Neurobiol Dis, 2009
Gene dosage effects of Amyloid precursor protein (APP) can cause familial AD. Recent evidence suggest that microRNA (miRNA) pathways, implicated in gene transcriptional control, could be involved in the development of sporadic Alzheimer's disease (AD). We therefore investigated whether miRNAs could participate in the regulation of APP gene expression. We show that miRNAs belonging to the miR-20a family (that is, miR-20a, miR-17-5p and miR-106b) could regulate APP expression in vitro and at the endogenous level in neuronal cell lines. A tight correlation between these miRNAs and APP was found during brain development and in differentiating neurons. We thus identify miRNAs as novel endogenous regulators of APP expression, suggesting that variations in miRNA expression could contribute to changes in APP expression in the brain during development and disease. This possibility is further corroborated by the observation that a statistically significant decrease in miR-106b expression was found in sporadic AD patients.
LinkOut: [PMID: 19110058]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
367 hsa-let-7d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000401 BDNF brain-derived neurotrophic factor 1 1
MIRT000402 CDK6 cyclin-dependent kinase 6 1 1
MIRT000403 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000405 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT000406 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT002005 HMGA2 high mobility group AT-hook 2 5 6
MIRT003901 APP amyloid beta (A4) precursor protein 2 1
MIRT004347 DICER1 dicer 1, ribonuclease type III 3 1
MIRT004505 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 5 3
MIRT005549 PDGFA platelet-derived growth factor alpha polypeptide 3 1
MIRT006398 IL13 interleukin 13 2 1
MIRT006406 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT032101 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT032102 DRD3 dopamine receptor D3 1 1
MIRT032103 SMOX spermine oxidase 1 1
MIRT032104 DAD1 defender against cell death 1 1 1
MIRT032105 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 2 3
MIRT032106 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT032107 GPR63 G protein-coupled receptor 63 1 1
MIRT032108 FAM135A family with sequence similarity 135, member A 1 1
MIRT032109 CPNE1 copine I 1 1
MIRT032110 NR4A1 nuclear receptor subfamily 4, group A, member 1 1 1
MIRT032111 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 1 1
MIRT032112 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT032113 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT032114 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 2
MIRT032115 FBXO3 F-box protein 3 1 1
MIRT032116 ZNF763 zinc finger protein 763 1 1
MIRT032117 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT032118 HOMER1 homer homolog 1 (Drosophila) 1 1
MIRT032119 RBM12 RNA binding motif protein 12 1 1
MIRT032120 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT032121 CBR4 carbonyl reductase 4 1 1
MIRT032122 THBS1 thrombospondin 1 1 2
MIRT032123 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT032124 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT032125 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT032126 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT032127 TST thiosulfate sulfurtransferase (rhodanese) 1 1
MIRT032128 GPR137B G protein-coupled receptor 137B 1 1
MIRT032129 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT032130 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT032131 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT032132 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT032133 SPATA2 spermatogenesis associated 2 1 1
MIRT032134 GOLT1B golgi transport 1B 1 1
MIRT032135 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT032136 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT032137 RFX5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT032138 BIN3 bridging integrator 3 1 1
MIRT032139 CEP120 centrosomal protein 120kDa 1 2
MIRT032140 ZNF526 zinc finger protein 526 1 1
MIRT032141 ISL1 ISL LIM homeobox 1 1 1
MIRT032142 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 3
MIRT032143 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT032144 TMEM194A transmembrane protein 194A 1 1
MIRT032145 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT032146 C12orf4 chromosome 12 open reading frame 4 1 2
MIRT032147 TMEM2 transmembrane protein 2 1 1
MIRT032148 DLC1 deleted in liver cancer 1 1 1
MIRT032149 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT032150 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT032151 ZNF354B zinc finger protein 354B 1 1
MIRT032152 ZNF200 zinc finger protein 200 1 2
MIRT032153 ADCY9 adenylate cyclase 9 1 1
MIRT032154 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT032155 STK40 serine/threonine kinase 40 1 1
MIRT032156 PCGF3 polycomb group ring finger 3 1 3
MIRT032157 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT032158 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT032159 RAD9A RAD9 homolog A (S. pombe) 1 1
MIRT032160 ARRDC4 arrestin domain containing 4 1 1
MIRT032161 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT032162 LBR lamin B receptor 1 1
MIRT032163 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT032164 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 3
MIRT032165 ABT1 activator of basal transcription 1 1 5
MIRT032166 NHLRC3 NHL repeat containing 3 1 3
MIRT032167 GLMN glomulin, FKBP associated protein 1 1
MIRT032168 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT032169 ZNF644 zinc finger protein 644 1 2
MIRT032170 C11orf57 chromosome 11 open reading frame 57 1 3
MIRT032171 FAM104A family with sequence similarity 104, member A 1 1
MIRT032172 SPRYD4 SPRY domain containing 4 1 1
MIRT032173 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT032174 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT032175 ONECUT2 one cut homeobox 2 1 2
MIRT032176 USP24 ubiquitin specific peptidase 24 1 1
MIRT032177 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 2
MIRT032178 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT032179 HAND1 heart and neural crest derivatives expressed 1 1 2
MIRT032180 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT032181 IGF1R insulin-like growth factor 1 receptor 1 5
MIRT032182 TMEM135 transmembrane protein 135 1 1
MIRT032183 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 2
MIRT032184 ZNF280B zinc finger protein 280B 1 1
MIRT032185 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT032186 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 2
MIRT051710 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT051711 PRR13 proline rich 13 1 1
MIRT051712 ZNF746 zinc finger protein 746 1 1
MIRT051713 SLC35A4 solute carrier family 35, member A4 1 1
MIRT051714 RPL31 ribosomal protein L31 1 1
MIRT051715 TPD52L2 tumor protein D52-like 2 1 1
MIRT051716 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT051717 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT051718 RPS6 ribosomal protein S6 1 1
MIRT051719 SENP5 SUMO1/sentrin specific peptidase 5 1 1
MIRT051720 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT051721 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT051722 H2AFX H2A histone family, member X 1 1
MIRT051723 DSC3 desmocollin 3 1 1
MIRT051724 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT051725 NCOA1 nuclear receptor coactivator 1 1 1
MIRT051726 LRRC42 leucine rich repeat containing 42 1 1
MIRT051727 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT063194 ADIPOR2 adiponectin receptor 2 1 1
MIRT068153 TXLNA taxilin alpha 1 1
MIRT068788 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT073005 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 3
MIRT076222 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT083299 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084975 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT095765 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT112241 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118585 STK4 serine/threonine kinase 4 1 1
MIRT120920 PDE12 phosphodiesterase 12 1 4
MIRT123316 CALU calumenin 1 1
MIRT123975 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT152271 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153846 NCOA3 nuclear receptor coactivator 3 1 1
MIRT168582 HMGA1 high mobility group AT-hook 1 1 2
MIRT180602 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187716 SUOX sulfite oxidase 1 1
MIRT191403 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193100 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215719 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT218814 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT240329 UBXN2B UBX domain protein 2B 1 1
MIRT243472 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT244068 EDN1 endothelin 1 1 1
MIRT252329 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255313 CDV3 CDV3 homolog (mouse) 1 1
MIRT259276 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259478 TXLNG taxilin gamma 1 1
MIRT260706 CLDN12 claudin 12 1 3
MIRT266211 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266625 CHTOP chromatin target of PRMT1 1 1
MIRT268838 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT284527 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT294445 ZNF264 zinc finger protein 264 1 1
MIRT297012 RRM2 ribonucleotide reductase M2 1 1
MIRT300036 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300892 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303319 MXD1 MAX dimerization protein 1 1 1
MIRT309845 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT322427 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT324730 ACER2 alkaline ceramidase 2 1 1
MIRT402056 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437855 EIF2C1 eukaryotic translation initiation factor 2C, 1 3 1
MIRT438633 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT439136 ZEB2 zinc finger E-box binding homeobox 2 0 1
MIRT439137 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT442021 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445659 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447137 KIF27 kinesin family member 27 1 1
MIRT448263 ZNF774 zinc finger protein 774 1 1
MIRT449006 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449954 FMNL3 formin-like 3 1 1
MIRT451156 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451625 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451694 C1RL complement component 1, r subcomponent-like 1 1
MIRT452093 NUCB2 nucleobindin 2 1 1
MIRT452432 QDPR quinoid dihydropteridine reductase 1 1
MIRT452944 DISC1 disrupted in schizophrenia 1 1 1
MIRT453402 RHD Rh blood group, D antigen 1 3
MIRT454165 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454281 FXN frataxin 1 1
MIRT454540 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454855 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455677 GLO1 glyoxalase I 1 1
MIRT457249 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457678 ZNF587 zinc finger protein 587 1 1
MIRT457888 THEM6 thioesterase superfamily member 6 1 2
MIRT458017 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458280 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT459737 RRM1 ribonucleotide reductase M1 1 1
MIRT460454 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460501 FAM105A family with sequence similarity 105, member A 1 3
MIRT460939 NOA1 nitric oxide associated 1 1 2
MIRT461093 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461365 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462383 YAE1D1 Yae1 domain containing 1 1 1
MIRT462781 ZNF8 zinc finger protein 8 1 1
MIRT463418 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463663 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464266 VCL vinculin 1 1
MIRT465125 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466186 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466720 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469103 RNF144B ring finger protein 144B 1 1
MIRT469713 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT470424 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470860 PLXND1 plexin D1 1 1
MIRT471270 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471965 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472738 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473135 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473829 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473941 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474024 LRRC20 leucine rich repeat containing 20 1 1
MIRT474501 KLHDC8B kelch domain containing 8B 1 1
MIRT474760 KIAA0930 KIAA0930 1 1
MIRT474908 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475332 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475380 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475734 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476549 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476974 FAM83G family with sequence similarity 83, member G 1 2
MIRT477679 EFHD2 EF-hand domain family, member D2 1 1
MIRT479750 CCND1 cyclin D1 1 1
MIRT481194 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481239 ATXN7L3 ataxin 7-like 3 1 1
MIRT481364 ATG9A autophagy related 9A 1 1
MIRT481389 ATG12 autophagy related 12 1 1
MIRT481653 AREL1 KIAA0317 1 1
MIRT481853 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482185 AHR aryl hydrocarbon receptor 1 1
MIRT482221 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485297 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486660 ZNF28 zinc finger protein 28 1 1
MIRT489414 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491865 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492211 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT492625 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493322 LIMD2 LIM domain containing 2 1 1
MIRT493902 FAM43A family with sequence similarity 43, member A 1 2
MIRT495969 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496113 SNX17 sorting nexin 17 1 1
MIRT497876 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498118 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499406 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499494 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499654 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499943 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT499998 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500899 STRN striatin, calmodulin binding protein 1 2
MIRT501113 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501209 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501247 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501327 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501349 RNF44 ring finger protein 44 1 2
MIRT501388 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT501442 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501752 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501941 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502121 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502783 CEP135 centrosomal protein 135kDa 1 1
MIRT502840 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT505579 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT506360 NUP155 nucleoporin 155kDa 1 3
MIRT507243 FIGN fidgetin 1 4
MIRT507689 COIL coilin 1 3
MIRT508402 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508666 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508933 AK4 adenylate kinase 4 1 2
MIRT510392 ZNF566 zinc finger protein 566 1 3
MIRT510514 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511387 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512747 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515955 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516084 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT521390 RDX radixin 1 2
MIRT522349 NCKIPSD NCK interacting protein with SH3 domain 1 2
MIRT523627 FZD9 frizzled family receptor 9 1 2
MIRT523734 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523983 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524115 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525728 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527764 RRAD Ras-related associated with diabetes 1 1
MIRT529728 OPRL1 opiate receptor-like 1 1 1
MIRT533189 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536379 LEFTY1 left-right determination factor 1 1 1
MIRT543786 RBM12B RNA binding motif protein 12B 1 2
MIRT543869 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545388 PM20D2 peptidase M20 domain containing 2 1 1
MIRT546329 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547372 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547573 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT548266 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548346 EPHA4 EPH receptor A4 1 1
MIRT548535 DUSP1 dual specificity phosphatase 1 1 1
MIRT548564 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548780 COLEC12 collectin sub-family member 12 1 1
MIRT548972 CCNT2 cyclin T2 1 1
MIRT549022 CBX5 chromobox homolog 5 1 1
MIRT549207 BEND4 BEN domain containing 4 1 2
MIRT549764 ZNF611 zinc finger protein 611 1 3
MIRT549800 KIAA0391 KIAA0391 1 1
MIRT549848 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550727 PMPCA peptidase (mitochondrial processing) alpha 1 2
MIRT550899 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551284 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551319 GSG2 germ cell associated 2 (haspin) 1 3
MIRT552004 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552411 ZNF460 zinc finger protein 460 1 2
MIRT553018 USP38 ubiquitin specific peptidase 38 1 1
MIRT555551 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555717 PDZD8 PDZ domain containing 8 1 1
MIRT557967 FAM222B family with sequence similarity 222, member B 1 1
MIRT559088 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559498 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561776 PEG10 paternally expressed 10 1 1
MIRT564403 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565450 SURF4 surfeit 4 1 1
MIRT566519 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567430 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT567718 E2F6 E2F transcription factor 6 1 1
MIRT568649 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569499 THYN1 thymocyte nuclear protein 1 1 1
MIRT573821 TGOLN2 trans-golgi network protein 2 1 1
MIRT574364 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574749 GOLGA4 golgin A4 1 1
MIRT576088 Poteg POTE ankyrin domain family, member G 1 1
MIRT576807 Thbs1 thrombospondin 1 1 1
MIRT616371 RWDD1 RWD domain containing 1 1 1
MIRT617852 FMO4 flavin containing monooxygenase 4 1 1
MIRT642395 ZNF556 zinc finger protein 556 1 1
MIRT680520 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680548 ZNF584 zinc finger protein 584 1 1
MIRT680801 ZNF578 zinc finger protein 578 1 1
MIRT680839 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681142 INTS7 integrator complex subunit 7 1 1
MIRT681272 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681324 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681360 BRI3BP BRI3 binding protein 1 1
MIRT681507 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT681537 ZNF738 zinc finger protein 738 1 1
MIRT681659 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681739 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681761 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT681798 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681870 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681942 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682103 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682182 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682239 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682385 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682445 MTX3 metaxin 3 1 1
MIRT682605 CPA4 carboxypeptidase A4 1 1
MIRT682641 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689328 FPR1 formyl peptide receptor 1 1 1
MIRT689731 ATXN2 ataxin 2 1 1
MIRT691037 ZNF799 zinc finger protein 799 1 1
MIRT691936 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694885 ZNF417 zinc finger protein 417 1 1
MIRT695256 ZNF443 zinc finger protein 443 1 1
MIRT695414 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700588 PRSS22 protease, serine, 22 1 1
MIRT701425 NHLRC2 NHL repeat containing 2 1 1
MIRT702485 KIAA1328 KIAA1328 1 1
MIRT702714 IPO9 importin 9 1 1
MIRT704030 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704422 CTPS1 CTP synthase 1 1 1
MIRT705751 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712372 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713521 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*