Accession ID: MIRT003901 [miRNA, hsa-let-7d-5p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7dLinkOut: [miRBase ]
Synonyms LET7D, MIRNLET7D, hsa-let-7d, let-7d, MIRLET7D
Description Homo sapiens let-7d stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7d-5p
Mature Sequence 8| AGAGGUAGUAGGUUGCAUAGUU |29
Evidence Experimental
Experiments Cloned
Putative hsa-let-7d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_0004    LinkOut: [ RefSeq ]
Other Transcripts NM_0011361 , NM_0011361 , NM_2014 , NM_2014   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_0004|3'UTR
   1 TAGACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATA
  81 ATGTGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCT
 161 GAACTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGT
 241 TTTGTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCT
 321 TAGCCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGAT
 401 GCTTCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAA
 481 CATTTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTA
 561 TATTTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGA
 641 CTTCAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTT
 721 ACGGGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGT
 801 ACAGAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGAC
 881 TTTTCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTT
 961 AACCAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCC
1041 TGGACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGA
1121 GCAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugauaCGUUGGAU--GAUGGAGa 5'
                |:||: ||  |||:||| 
Target 5' acatcaGTAATGTATTCTATCTCt 3'
179 - 202 138.00 -12.30
2
miRNA  3' uuGAUACGUUGGAUGAUGGAGa 5'
            ||:| ||: :|:||:|:|| 
Target 5' taCTGTACAGATTGCTGCTTCt 3'
535 - 556 136.00 -18.80
3
miRNA  3' uuGAUAC---GUUGG---AUGAUGGAGa 5'
            :|:||   |||::   | ||||:|: 
Target 5' gtTTGTGACCCAATTAAGTCCTACTTTa 3'
346 - 373 120.00 -6.99
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7d-5p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , miRBase Target Database
Original Description (Extracted from the article) ... We found that miR-20a, miR-17-5p, and miRNA106b affected signi´Čücantly luciferase expression (Fig. 1B). In contrast, a scrambled miRNA sequence, as well as the other candidate miRNAs (miR-15a, miR-130a, let-7d and let-7a) showed no effect in this assay. Curiously, miR-106a, which is closely related to miR-106b, had in this assay an inconsistent effect. ...

- Hebert, S. S. Horre, K. Nicolai, L. et al., 2009, Neurobiol Dis.

Article - Hebert, S. S. Horre, K. Nicolai, L. et al.
- Neurobiol Dis, 2009
Gene dosage effects of Amyloid precursor protein (APP) can cause familial AD. Recent evidence suggest that microRNA (miRNA) pathways, implicated in gene transcriptional control, could be involved in the development of sporadic Alzheimer's disease (AD). We therefore investigated whether miRNAs could participate in the regulation of APP gene expression. We show that miRNAs belonging to the miR-20a family (that is, miR-20a, miR-17-5p and miR-106b) could regulate APP expression in vitro and at the endogenous level in neuronal cell lines. A tight correlation between these miRNAs and APP was found during brain development and in differentiating neurons. We thus identify miRNAs as novel endogenous regulators of APP expression, suggesting that variations in miRNA expression could contribute to changes in APP expression in the brain during development and disease. This possibility is further corroborated by the observation that a statistically significant decrease in miR-106b expression was found in sporadic AD patients.
LinkOut: [PMID: 19110058]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
116 hsa-let-7d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000401 BDNF brain-derived neurotrophic factor 1 1
MIRT000402 CDK6 cyclin-dependent kinase 6 1 1
MIRT000403 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000405 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT000406 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT002005 HMGA2 high mobility group AT-hook 2 4 3
MIRT003901 APP amyloid beta (A4) precursor protein 2 1
MIRT004347 DICER1 dicer 1, ribonuclease type III 3 1
MIRT004505 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 4 1
MIRT005549 PDGFA platelet-derived growth factor alpha polypeptide 3 1
MIRT006398 IL13 interleukin 13 2 1
MIRT006406 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT032101 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT032102 DRD3 dopamine receptor D3 1 1
MIRT032103 SMOX spermine oxidase 1 1
MIRT032104 DAD1 defender against cell death 1 1 1
MIRT032105 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT032106 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT032107 GPR63 G protein-coupled receptor 63 1 1
MIRT032108 FAM135A family with sequence similarity 135, member A 1 1
MIRT032109 CPNE1 copine I 1 1
MIRT032110 NR4A1 nuclear receptor subfamily 4, group A, member 1 1 1
MIRT032111 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 1 1
MIRT032112 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT032113 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT032114 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT032115 FBXO3 F-box protein 3 1 1
MIRT032116 ZNF763 zinc finger protein 763 1 1
MIRT032117 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT032118 HOMER1 homer homolog 1 (Drosophila) 1 1
MIRT032119 RBM12 RNA binding motif protein 12 1 1
MIRT032120 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT032121 CBR4 carbonyl reductase 4 1 1
MIRT032122 THBS1 thrombospondin 1 1 1
MIRT032123 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT032124 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT032125 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT032126 AKAP8 A kinase (PRKA) anchor protein 8 1 1
MIRT032127 TST thiosulfate sulfurtransferase (rhodanese) 1 1
MIRT032128 GPR137B G protein-coupled receptor 137B 1 1
MIRT032129 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT032130 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT032131 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT032132 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT032133 SPATA2 spermatogenesis associated 2 1 1
MIRT032134 GOLT1B golgi transport 1 homolog B (S. cerevisiae) 1 1
MIRT032135 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT032136 SREK1IP1 SFRS12-interacting protein 1 1 1
MIRT032137 RFX5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT032138 BIN3 bridging integrator 3 1 1
MIRT032139 CEP120 centrosomal protein 120kDa 1 1
MIRT032140 ZNF526 zinc finger protein 526 1 1
MIRT032141 ISL1 ISL LIM homeobox 1 1 1
MIRT032142 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT032143 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT032144 TMEM194A transmembrane protein 194A 1 1
MIRT032145 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT032146 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT032147 TMEM2 transmembrane protein 2 1 1
MIRT032148 DLC1 deleted in liver cancer 1 1 1
MIRT032149 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT032150 SREK1 splicing factor, arginine/serine-rich 12 1 1
MIRT032151 ZNF354B zinc finger protein 354B 1 1
MIRT032152 ZNF200 zinc finger protein 200 1 1
MIRT032153 ADCY9 adenylate cyclase 9 1 1
MIRT032154 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT032155 STK40 serine/threonine kinase 40 1 1
MIRT032156 PCGF3 polycomb group ring finger 3 1 1
MIRT032157 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT032158 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT032159 RAD9A RAD9 homolog A (S. pombe) 1 1
MIRT032160 ARRDC4 arrestin domain containing 4 1 1
MIRT032161 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT032162 LBR lamin B receptor 1 1
MIRT032163 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT032164 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT032165 ABT1 activator of basal transcription 1 1 1
MIRT032166 NHLRC3 NHL repeat containing 3 1 1
MIRT032167 GLMN glomulin, FKBP associated protein 1 1
MIRT032168 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT032169 ZNF644 zinc finger protein 644 1 1
MIRT032170 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT032171 FAM104A family with sequence similarity 104, member A 1 1
MIRT032172 SPRYD4 SPRY domain containing 4 1 1
MIRT032173 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT032174 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT032175 ONECUT2 one cut homeobox 2 1 1
MIRT032176 USP24 ubiquitin specific peptidase 24 1 1
MIRT032177 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT032178 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT032179 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT032180 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 1
MIRT032181 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT032182 TMEM135 transmembrane protein 135 1 1
MIRT032183 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 1
MIRT032184 ZNF280B zinc finger protein 280B 1 1
MIRT032185 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT032186 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT051710 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT051711 PRR13 proline rich 13 1 1
MIRT051712 ZNF746 zinc finger protein 746 1 1
MIRT051713 SLC35A4 solute carrier family 35, member A4 1 1
MIRT051714 RPL31 ribosomal protein L31 1 1
MIRT051715 TPD52L2 tumor protein D52-like 2 1 1
MIRT051716 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT051717 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT051718 RPS6 ribosomal protein S6 1 1
MIRT051719 SENP5 SUMO1/sentrin specific peptidase 5 1 1
MIRT051720 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT051721 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT051722 H2AFX H2A histone family, member X 1 1
MIRT051723 DSC3 desmocollin 3 1 1
MIRT051724 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT051725 NCOA1 nuclear receptor coactivator 1 1 1
MIRT051726 LRRC42 leucine rich repeat containing 42 1 1
MIRT051727 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1