Accession ID: MIRT003917 [miRNA, hsa-miR-210-3p :: XPA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-210LinkOut: [miRBase ]
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Mature Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-210-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol XPA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms XP1, XPAC
Description xeroderma pigmentosum, complementation group A
Transcript NM_0003    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on XPA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of XPA
(miRNA target sites are highlighted)
>XPA|NM_0003|3'UTR
   1 TGATTTTTTAGTTCAGTGACCTGTTTTATAGAATTTTATATTTAAATAAAGGAAATTTAGATTGGTCCTTTTCAAAATTC
  81 AAAAAAAAAAGCAACATCTTCATAGATGAATGAAACCCTTGTATAAGTAATACTTCAGTAATAATTATGTATGTTATGGC
 161 TTAAAAGCAAGTTTCAGTGAAGGTCACCTGGCCTGGTTGTGTGCACAATGTCATGTCTGTGATTGCCTTCTTACAACAGA
 241 GATGGGAGCTGAGTGCTAGAGTAGGTGCAGAAGTGGTAGGTCAGCTACAAATTTGAGGACAAGATACCAAGGCAAACCCT
 321 AGATTGGGGTAGAGGGAAAAGGGTTCAACAAAGGCTGAACTGGATTCTTAACCAAGAAACAAATAATAGCAATGGTGGTG
 401 CACCACTGTACCCCAGGTTCTAGTCATGTGTTTTTTAGGACGATTTCTGTCTCCACGATGGTGGAAACAGTGGGGAACTA
 481 CTGCTGGAAAAAGCCCTAATAGCAGAAATAAACATTGAGTTGTACGAGTCTGAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agUCGGCGACAGUGUGCGUGUc 5'
            :||| : ||:::::||||| 
Target 5' ctGGCC-TGGTTGTGTGCACAa 3'
188 - 208 127.00 -16.00
2
miRNA  3' agUCGGCGACAGUGUGCGUGuc 5'
            |||  : ||   ::||||  
Target 5' atAGCAATGGT--GGTGCACca 3'
386 - 405 92.00 -12.20
3
miRNA  3' agUCGGC-GACAGU---GUGCGUGUc 5'
            |||:|  || :|   :| |::|| 
Target 5' ggAGCTGAGTGCTAGAGTAGGTGCAg 3'
245 - 270 88.00 -10.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-210-3p :: XPA    [ Functional MTI ]
Validation Method Western blot , Other
Conditions HeLa , MCF-7
Original Description (Extracted from the article) ... In addition, the expression of two other repair factors, XPA (involved in NER) and MRE11 (involved in HDR), was not altered by miR-210 or miR-373 (Supplementary Fig. S1B).//Forced expression of miR-210 and miR-373 specifically regulates RAD52 expression, but does not regulate MRE11 or XPA expression. ...

- Crosby, M. E. Kulshreshtha, R. Ivan, M. et al., 2009, Cancer Res.

Article - Crosby, M. E. Kulshreshtha, R. Ivan, M. et al.
- Cancer Res, 2009
Genetic instability is a hallmark of cancer; the hypoxic tumor microenvironment has been implicated as a cause of this phenomenon. MicroRNAs (miR) are small nonprotein coding RNAs that can regulate various cellular pathways. We report here that two miRs, miR-210 and miR-373, are up-regulated in a hypoxia-inducible factor-1alpha-dependent manner in hypoxic cells. Bioinformatics analyses suggested that these miRs could regulate factors implicated in DNA repair pathways. Forced expression of miR-210 was found to suppress the levels of RAD52, which is a key factor in homology-dependent repair (HDR); the forced expression of miR-373 led to a reduction in the nucleotide excision repair (NER) protein, RAD23B, as well as in RAD52. Consistent with these results, both RAD52 and RAD23B were found to be down-regulated in hypoxia, but in both cases, the hypoxia-induced down-regulation could be partially reversed by antisense inhibition of miR-210 and miR-373. Importantly, luciferase reporter assays indicated that miR-210 is capable of interacting with the 3' untranslated region (UTR) of RAD52 and that miR-373 can act on the 3' UTR of RAD23B. These results indicate that hypoxia-inducible miR-210 and miR-373 play roles in modulating the expression levels of key proteins involved in the HDR and NER pathways, providing new mechanistic insight into the effect of hypoxia on DNA repair and genetic instability in cancer.
LinkOut: [PMID: 19141645]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
55 hsa-miR-210-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 2 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 pim-1 oncogene 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor-like 1 5 2
MIRT000156 RAD52 RAD52 homolog (S. cerevisiae) 4 3
MIRT001930 NPTX1 neuronal pentraxin I 3 2
MIRT002024 EFNA3 ephrin-A3 4 5
MIRT003153 BDNF brain-derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase, beta polypeptide 4 1
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1-like (S. cerevisiae) 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 KIAA1161 3 1
MIRT003163 ISCU iron-sulfur cluster scaffold homolog (E. coli) 6 5
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1-like 4 1
MIRT003166 DENND6A family with sequence similarity 116, member A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 4 1
MIRT003168 CDK10 cyclin-dependent kinase 10 3 1
MIRT003169 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 3 1
MIRT003170 CBX1 chromobox homolog 1 (HP1 beta homolog Drosophila ) 3 1
MIRT003171 XIST X (inactive)-specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL Nipped-B homolog (Drosophila) 3 1
MIRT003176 MIB1 mindbomb homolog 1 (Drosophila) 3 1
MIRT003177 HECTD1 HECT domain containing 1 3 1
MIRT003178 ELK3 ELK3, ETS-domain protein (SRF accessory protein 2) 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase, class VI, type 11C 3 1
MIRT003183 APC adenomatous polyposis coli 3 1
MIRT003184 E2F3 E2F transcription factor 3 4 3
MIRT003185 ACVR1B activin A receptor, type IB 2 1
MIRT003916 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 2 1
MIRT003917 XPA xeroderma pigmentosum, complementation group A 2 1
MIRT004672 MNT MAX binding protein 4 1
MIRT006326 AIFM3 apoptosis-inducing factor, mitochondrion-associated, 3 1 1
MIRT006519 CASP8AP2 caspase 8 associated protein 2 2 1
MIRT006663 VMP1 transmembrane protein 49 3 1
MIRT006830 TFRC transferrin receptor (p90, CD71) 2 1
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT047006 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT047007 SCN1B sodium channel, voltage-gated, type I, beta 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1