Accession ID: MIRT003979 [miRNA, hsa-miR-34c-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34cLinkOut: [miRBase ]
Description Homo sapiens miR-34c stem-loop
Comment Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells , and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34c-5p
Mature Sequence 13| AGGCAGUGUAGUUAGCUGAUUGC |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34c-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions KATO-III
Location of target site 3'UTR
Tools used in this research Literature survey
Article - Ji, Q. Hao, X. Meng, Y. Zhang, M. Desano, et al.
- BMC Cancer, 2008
BACKGROUND: MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. METHODS: Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. RESULTS: Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. CONCLUSION: Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. The mechanism of miR-34-mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer.
LinkOut: [PMID: 18803879]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
137 hsa-miR-34c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000746 MYB v-myb myeloblastosis viral oncogene homolog (avian) 2 1
MIRT000752 CAV1 caveolin 1, caveolae protein, 22kDa 2 1
MIRT000757 MET met proto-oncogene (hepatocyte growth factor receptor) 5 5
MIRT000760 E2F3 E2F transcription factor 3 5 5
MIRT000765 CDK4 cyclin-dependent kinase 4 5 3
MIRT000766 CCNE2 cyclin E2 3 3
MIRT003979 BCL2 B-cell CLL/lymphoma 2 4 3
MIRT004402 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 5 4
MIRT004405 SRSF2 serine/arginine-rich splicing factor 2 2 1
MIRT004573 CDK6 cyclin-dependent kinase 6 1 3
MIRT005762 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 1 1
MIRT006192 NOTCH4 notch 4 2 1
MIRT006225 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 1
MIRT006227 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006228 NANOG Nanog homeobox 2 1
MIRT006263 HNF4A hepatocyte nuclear factor 4, alpha 1 2
MIRT006287 ULBP2 UL16 binding protein 2 2 1
MIRT006459 NOTCH1 notch 1 4 2
MIRT006605 Bcl2 B cell leukemia/lymphoma 2 2 1
MIRT006926 Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) 1 1
MIRT007189 MAPT microtubule-associated protein tau 1 1
MIRT007302 UNG uracil-DNA glycosylase 1 1
MIRT052952 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT052978 BMF Bcl2 modifying factor 2 1
MIRT053382 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 3 1
MIRT053384 PDGFRB platelet-derived growth factor receptor, beta polypeptide 3 1
MIRT053470 VEZT vezatin, adherens junctions transmembrane protein 3 1
MIRT054033 YY1 YY1 transcription factor 3 1
MIRT054345 RARG retinoic acid receptor, gamma 2 1
MIRT054925 RUNX2 runt-related transcription factor 2 3 1
MIRT057736 ZDHHC16 zinc finger, DHHC-type containing 16 1 1
MIRT078632 FAM104A family with sequence similarity 104, member A 1 1
MIRT100405 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT115548 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 4 2
MIRT130094 TXNIP thioredoxin interacting protein 1 2
MIRT142246 DCTN5 dynactin 5 (p25) 1 1
MIRT143718 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT169799 GIGYF1 GRB10 interacting GYF protein 1 1 2
MIRT183692 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT198920 SMAD4 SMAD family member 4 1 1
MIRT202948 TSN translin 1 2
MIRT221561 CBX3 chromobox homolog 3 1 1
MIRT253414 EVI5L ecotropic viral integration site 5-like 1 1
MIRT294757 ZNF551 zinc finger protein 551 1 2
MIRT307051 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT331270 TM9SF3 transmembrane 9 superfamily member 3 1 3
MIRT372291 UBXN2B UBX domain protein 2B 1 1
MIRT374314 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT438027 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT438028 PTENP1 phosphatase and tensin homolog pseudogene 1 1 1
MIRT438031 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT438315 PABPC1 poly(A) binding protein, cytoplasmic 1 2 1
MIRT438415 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 3 1
MIRT438614 FOSL1 FOS-like antigen 1 2 1
MIRT438702 IL6R interleukin 6 receptor 3 1
MIRT438773 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 2 1
MIRT438774 MAP2K1 mitogen-activated protein kinase kinase 1 2 1
MIRT445819 DNAAF3 dynein, axonemal, assembly factor 3 1 1
MIRT447160 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT447825 CTIF CBP80/20-dependent translation initiation factor 1 1
MIRT448795 GMFB glia maturation factor, beta 1 1
MIRT451582 HIRIP3 HIRA interacting protein 3 1 1
MIRT452681 GPR156 G protein-coupled receptor 156 1 1
MIRT453160 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT453636 SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1 1
MIRT455386 PLA2G2D phospholipase A2, group IID 1 1
MIRT456960 SPAM1 sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) 1 1
MIRT462741 EFNB1 ephrin-B1 1 1
MIRT464323 UST uronyl-2-sulfotransferase 1 1
MIRT465639 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 1 5
MIRT466750 SYNGR2 synaptogyrin 2 1 1
MIRT468347 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT469326 RGP1 RGP1 retrograde golgi transport homolog (S. cerevisiae) 1 1
MIRT474360 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT475318 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT477761 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT477826 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478267 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT481041 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT481291 ATXN1L ataxin 1-like 1 1
MIRT482732 COPZ1 coatomer protein complex, subunit zeta 1 1 1
MIRT488781 CYTH3 cytohesin 3 1 1
MIRT489580 SSBP2 single-stranded DNA binding protein 2 1 1
MIRT489661 SHMT1 serine hydroxymethyltransferase 1 (soluble) 1 2
MIRT490529 KIAA1715 KIAA1715 1 1
MIRT492948 NEUROD2 neuronal differentiation 2 1 1
MIRT493156 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT493847 FOXN3 forkhead box N3 1 2
MIRT494745 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT496493 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT503314 FICD FIC domain containing 1 2
MIRT503509 ZNF623 zinc finger protein 623 1 1
MIRT504184 FAM127B family with sequence similarity 127, member B 1 1
MIRT505012 ZNF644 zinc finger protein 644 1 1
MIRT505354 TMEM167A transmembrane protein 167A 1 1
MIRT505644 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT505712 SESN2 sestrin 2 1 1
MIRT505778 SATB2 SATB homeobox 2 1 3
MIRT506209 PHF19 PHD finger protein 19 1 1
MIRT506249 PEG10 paternally expressed 10 1 1
MIRT507788 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT508003 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 2
MIRT508859 ZRSR1 zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1 1 2
MIRT510548 XBP1P1 X-box binding protein 1 pseudogene 1 1 2
MIRT511893 GAS1 growth arrest-specific 1 1 3
MIRT512909 UBL4A ubiquitin-like 4A 1 1
MIRT513602 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT521243 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT521319 RRAGD Ras-related GTP binding D 1 2
MIRT525283 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT528652 RWDD2A RWD domain containing 2A 1 2
MIRT535100 PODXL podocalyxin-like 1 1
MIRT547754 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT547867 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT549173 BMP3 bone morphogenetic protein 3 1 1
MIRT550117 SLC35G2 solute carrier family 35, member G2 1 1
MIRT556099 MOAP1 modulator of apoptosis 1 1 1
MIRT557170 HOXA13 homeobox A13 1 1
MIRT557424 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT557933 FAM73A family with sequence similarity 73, member A 1 1
MIRT568806 VPS37D vacuolar protein sorting 37 homolog D (S. cerevisiae) 1 1
MIRT571328 TPCN2 two pore segment channel 2 1 1
MIRT572600 PAPLN papilin, proteoglycan-like sulfated glycoprotein 1 1
MIRT573439 APOPT1 apoptogenic 1, mitochondrial 1 1
MIRT574093 VASN vasorin 1 1
MIRT608690 VAV3 vav 3 guanine nucleotide exchange factor 1 2
MIRT608802 ITGA11 integrin, alpha 11 1 2
MIRT610334 SSX5 synovial sarcoma, X breakpoint 5 1 1
MIRT613160 DDA1 DET1 and DDB1 associated 1 1 1
MIRT625409 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT636605 CLIC5 chloride intracellular channel 5 1 1
MIRT638575 IER5 immediate early response 5 1 1
MIRT639688 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT677981 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT685219 POTED POTE ankyrin domain family, member D 1 1
MIRT702572 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT706261 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*