Accession ID: MIRT003979 [miRNA, hsa-miR-34c-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34cLinkOut: [miRBase ]
Description Homo sapiens miR-34c stem-loop
Comment Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells , and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34c-5p
Mature Sequence 13| AGGCAGUGUAGUUAGCUGAUUGC |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34c-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions KATO-III
Location of target site 3'UTR
Tools used in this research Literature survey
Article - Ji, Q. Hao, X. Meng, Y. Zhang, M. Desano, et al.
- BMC Cancer, 2008
BACKGROUND: MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. METHODS: Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. RESULTS: Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. CONCLUSION: Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. The mechanism of miR-34-mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer.
LinkOut: [PMID: 18803879]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
21 hsa-miR-34c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000746 MYB v-myb myeloblastosis viral oncogene homolog (avian) 2 1
MIRT000752 CAV1 caveolin 1, caveolae protein, 22kDa 2 1
MIRT000757 MET met proto-oncogene (hepatocyte growth factor receptor) 5 4
MIRT000760 E2F3 E2F transcription factor 3 3 3
MIRT000765 CDK4 cyclin-dependent kinase 4 5 3
MIRT000766 CCNE2 cyclin E2 2 2
MIRT003979 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT004402 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 2 2
MIRT004405 SRSF2 serine/arginine-rich splicing factor 2 2 1
MIRT005762 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 1 1
MIRT006192 NOTCH4 notch 4 2 1
MIRT006225 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 1
MIRT006227 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006228 NANOG Nanog homeobox 2 1
MIRT006263 HNF4A hepatocyte nuclear factor 4, alpha 1 1
MIRT006287 ULBP2 UL16 binding protein 2 2 1
MIRT006459 NOTCH1 notch 1 4 1
MIRT006605 Bcl2 B cell leukemia/lymphoma 2 2 1
MIRT006926 Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) 1 1
MIRT007189 MAPT microtubule-associated protein tau 1 1
MIRT007302 UNG uracil-DNA glycosylase 1 1