Accession ID: MIRT003991 [miRNA, hsa-miR-138-5p :: TERT, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-138-2LinkOut: [miRBase ]
Description Homo sapiens miR-138-2 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-138-5p
Mature Sequence 10| AGCUGGUGUUGUGAAUCAGGCCG |32
Evidence Experimental
Experiments Cloned
Putative hsa-miR-138-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TERT LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EST2, TCS1, TP2, TRT, hEST2
Description telomerase reverse transcriptase
Transcript NM_1982    LinkOut: [ RefSeq ]
Other Transcripts NM_1982   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TERT LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TERT
(miRNA target sites are highlighted)
>TERT|NM_1982|3'UTR
   1 TGATGGCCACCCGCCCACAGCCAGGCCGAGAGCAGACACCAGCAGCCCTGTCACGCCGGGCTCTACGTCCCAGGGAGGGA
  81 GGGGCGGCCCACACCCAGGCCCGCACCGCTGGGAGTCTGAGGCCTGAGTGAGTGTTTGGCCGAGGCCTGCATGTCCGGCT
 161 GAAGGCTGAGTGTCCGGCTGAGGCCTGAGCGAGTGTCCAGCCAAGGGCTGAGTGTCCAGCACACCTGCCGTCTTCACTTC
 241 CCCACAGGCTGGCGCTCGGCTCCACCCCAGGGCCAGCTTTTCCTCACCAGGAGCCCGGCTTCCACTCCCCACATAGGAAT
 321 AGTCCATCCCCAGATTCGCCATTGTTCACCCCTCGCCCTGCCCTCCTTTGCCTTCCACCCCCACCATCCAGGTGGAGACC
 401 CTGAGAAGGACCCTGGGAGCTCTGGGAATTTGGAGTGACCAAAGGTGTGCCCTGTACACAGGCGAGGACCCTGCACCTGG
 481 ATGGGGGTCCCTGTGGGTCAAATTGGGGGGAGGTGCTGTGGGAGTAAAATACTGAATATATGAGTTTTTCAGTTTTGAAA
 561 AAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gcCGGACUAAGUGUUGUGGUCGa 5'
            |||  :  || :|||||||| 
Target 5' agGCCGAGAGCA-GACACCAGCa 3'
23 - 44 152.00 -22.90
2
miRNA  3' gcCGGACUAAGUGUUGUGGUCga 5'
            ||| | ||: |  ||||||  
Target 5' ggGCCAGCTTTTCCTCACCAGga 3'
270 - 292 141.00 -16.10
3
miRNA  3' gcCGGACU---AAGUGUUGUGGUCGa 5'
            | ||||   | ||  ||||| || 
Target 5' agGGCTGAGTGTCCAGCACACCTGCc 3'
204 - 229 129.00 -18.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-138-5p :: TERT    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research miRBase
Original Description (Extracted from the article) ... We demonstrated that overexpression of miR-138 induced a reduction in hTERT protein expression, and confirmed target specificity between miR-138 and the hTERT 3-untranslated region by luciferase reporter assay. ...

- Mitomo, S. Maesawa, C. Ogasawara, S. Iwaya, et al., 2008, Cancer Sci.

Article - Mitomo, S. Maesawa, C. Ogasawara, S. Iwaya, et al.
- Cancer Sci, 2008
Alterations of several microRNA (miRNA) have been linked to cancer development and its biology. To search for unique miRNA that might play a role in the development of anaplastic thyroid carcinoma (ATC), we examined the expression of multiple miRNA and their functional effects on target genes in human thyroid carcinoma cell lines. We quantitatively evaluated the expression of multiple miRNA in 10 ATC and five papillary thyroid carcinoma (PTC) cell lines, as well as primary tumors from 11 thyroid carcinoma patients (three ATC and eight PTC), using the stem-loop-mediated reverse transcription real-time polymerase chain reaction method. We also examined the target gene specificity of unique miRNA that showed differences in expression between ATC and PTC cell lines. One miRNA, miR-138, was significantly downregulated in ATC cell lines in comparison with PTC (P < 0.01). Eleven miRNA (including miR-138) potentially targeting the human telomerase reverse transcriptase (hTERT) gene were totally downregulated in both ATC and PTC cell lines in comparison with normal thyroid tissues. A tendency for an inverse correlation between miR-138 and hTERT protein expression was observed in the thyroid cancer cell lines, although this failed to reach significance (r = -0.392, P = 0.148). We demonstrated that overexpression of miR-138 induced a reduction in hTERT protein expression, and confirmed target specificity between miR-138 and the hTERT 3'-untranslated region by luciferase reporter assay. These results suggest that loss of miR-138 expression may partially contribute to the gain of hTERT protein expression in ATC, and that further multiple miRNA targeting hTERT mRNA might be involved in the development of thyroid carcinoma.
LinkOut: [PMID: 18201269]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
45 hsa-miR-138-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000493 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 4 1
MIRT000494 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 4 1
MIRT000495 RHOC ras homolog gene family, member C 4 3
MIRT000797 SLC45A3 solute carrier family 45, member 3 3 1
MIRT003991 TERT telomerase reverse transcriptase 4 1
MIRT005487 EID1 EP300 interacting inhibitor of differentiation 1 4 1
MIRT005488 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT005489 PPARG peroxisome proliferator-activated receptor gamma 2 1
MIRT005490 FABP4 fatty acid binding protein 4, adipocyte 2 1
MIRT005491 LPL lipoprotein lipase 2 1
MIRT005691 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT006020 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 3 1
MIRT006142 FOSL1 FOS-like antigen 1 2 1
MIRT006271 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT006299 CCND3 cyclin D3 3 1
MIRT006388 PTK2 PTK2 protein tyrosine kinase 2 2 1
MIRT006493 H2AFX H2A histone family, member X 2 1
MIRT006744 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 1 2
MIRT006864 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT006865 BLCAP bladder cancer associated protein 2 1
MIRT006866 MXD1 MAX dimerization protein 1 2 1
MIRT007273 RELN reelin 1 1
MIRT007300 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 2
MIRT007335 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT021683 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) 1 1
MIRT021684 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT021685 PLEK2 pleckstrin 2 1 1
MIRT021686 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT021687 SNAI2 snail homolog 2 (Drosophila) 2 1
MIRT021688 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT021689 EED embryonic ectoderm development 2 1
MIRT021690 SUZ12 suppressor of zeste 12 homolog (Drosophila) 2 1
MIRT021691 ZEB2 zinc finger E-box binding homeobox 2 2 1
MIRT021692 VIM vimentin 4 1
MIRT035577 KRT19 keratin 19 1 1
MIRT045827 PHKG2 phosphorylase kinase, gamma 2 (testis) 1 1
MIRT045828 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 1 1
MIRT045829 RARA retinoic acid receptor, alpha 1 1
MIRT045830 RGS12 regulator of G-protein signaling 12 1 1
MIRT045831 TOR2A torsin family 2, member A 1 1
MIRT045832 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT045833 NVL nuclear VCP-like 1 1
MIRT045834 DMKN dermokine 1 1
MIRT045835 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT045836 HIST1H2BJ histone cluster 1, H2bj 1 1