Accession ID: MIRT003991 [miRNA, hsa-miR-138 :: TERT, target gene]
miRNA Infomation
miRNA namehsa-miR-138
miRNA-target interaction network
Gene Information
Gene Symbol TERT LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EST2, TCS1, TP2, TRT, hEST2
Description telomerase reverse transcriptase
Transcript NM_198253   LinkOut: [ RefSeq ]
Other Transcripts NM_198255   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TERT LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TERT
(miRNA target sites are highlighted)		 
>TERT|NM_198253|3'UTR
   1 TGATGGCCACCCGCCCACAGCCAGGCCGAGAGCAGACACCAGCAGCCCTGTCACGCCGGGCTCTACGTCCCAGGGAGGGA
  81 GGGGCGGCCCACACCCAGGCCCGCACCGCTGGGAGTCTGAGGCCTGAGTGAGTGTTTGGCCGAGGCCTGCATGTCCGGCT
 161 GAAGGCTGAGTGTCCGGCTGAGGCCTGAGCGAGTGTCCAGCCAAGGGCTGAGTGTCCAGCACACCTGCCGTCTTCACTTC
 241 CCCACAGGCTGGCGCTCGGCTCCACCCCAGGGCCAGCTTTTCCTCACCAGGAGCCCGGCTTCCACTCCCCACATAGGAAT
 321 AGTCCATCCCCAGATTCGCCATTGTTCACCCCTCGCCCTGCCCTCCTTTGCCTTCCACCCCCACCATCCAGGTGGAGACC
 401 CTGAGAAGGACCCTGGGAGCTCTGGGAATTTGGAGTGACCAAAGGTGTGCCCTGTACACAGGCGAGGACCCTGCACCTGG
 481 ATGGGGGTCCCTGTGGGTCAAATTGGGGGGAGGTGCTGTGGGAGTAAAATACTGAATATATGAGTTTTTCAGTTTTGAAA
 561 AAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-138 :: TERT    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot
Conditions HEK293,
Location of target site 3'UTR, unknown
Tools used in this research miRBase,
Original Description (Extracted from the article) ... We demonstrated that overexpression of miR-138 induced a reduction in hTERT protein expression, and confirmed target specificity between miR-138 and the hTERT 3-untranslated region by luciferase reporter assay. ...

- Mitomo, S. Maesawa, C. Ogasawara, S. Iwaya, et al., 2008, Cancer Sci.
Article - Mitomo, S. Maesawa, C. Ogasawara, S. Iwaya, et al.
- Cancer Sci, 2008
Alterations of several microRNA (miRNA) have been linked to cancer development and its biology. To search for unique miRNA that might play a role in the development of anaplastic thyroid carcinoma (ATC), we examined the expression of multiple miRNA and their functional effects on target genes in human thyroid carcinoma cell lines. We quantitatively evaluated the expression of multiple miRNA in 10 ATC and five papillary thyroid carcinoma (PTC) cell lines, as well as primary tumors from 11 thyroid carcinoma patients (three ATC and eight PTC), using the stem-loop-mediated reverse transcription real-time polymerase chain reaction method. We also examined the target gene specificity of unique miRNA that showed differences in expression between ATC and PTC cell lines. One miRNA, miR-138, was significantly downregulated in ATC cell lines in comparison with PTC (P < 0.01). Eleven miRNA (including miR-138) potentially targeting the human telomerase reverse transcriptase (hTERT) gene were totally downregulated in both ATC and PTC cell lines in comparison with normal thyroid tissues. A tendency for an inverse correlation between miR-138 and hTERT protein expression was observed in the thyroid cancer cell lines, although this failed to reach significance (r = -0.392, P = 0.148). We demonstrated that overexpression of miR-138 induced a reduction in hTERT protein expression, and confirmed target specificity between miR-138 and the hTERT 3'-untranslated region by luciferase reporter assay. These results suggest that loss of miR-138 expression may partially contribute to the gain of hTERT protein expression in ATC, and that further multiple miRNA targeting hTERT mRNA might be involved in the development of thyroid carcinoma.
LinkOut: [PMID: 18201269]