Accession ID: MIRT004006 [miRNA, hsa-miR-200a-3p :: GATA6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-200aLinkOut: [miRBase ]
Description Homo sapiens miR-200a stem-loop
Comment miR-200a was cloned from mouse kidney tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-200a-3p
Mature Sequence 54| UAACACUGUCUGGUAACGAUGU |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-200a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: GATA6    [ Functional MTI ]
Validation Method Microarray , Other
Conditions normal and malignant ovarian tissues
Original Description (Extracted from the article) ... Confirmed and potential targets for miRNA members of various signatures.//{This MTI shown in Supplementary Table S6} ...

- Iorio, M. V. Visone, R. Di Leva, G. Donati, et al., 2007, Cancer Res.

Article - Iorio, M. V. Visone, R. Di Leva, G. Donati, et al.
- Cancer Res, 2007
Epithelial ovarian cancer (EOC) is the sixth most common cancer in women worldwide and, despite advances in detection and therapies, it still represents the most lethal gynecologic malignancy in the industrialized countries. Unfortunately, still relatively little is known about the molecular events that lead to the development of this highly aggressive disease. The relatively recent discovery of microRNAs (miRNA), a class of small noncoding RNAs targeting multiple mRNAs and triggering translation repression and/or RNA degradation, has revealed the existence of a new level of gene expression regulation. Multiple studies involving various types of human cancers proved that miRNAs have a causal role in tumorigenesis. Here we show that, in comparison to normal ovary, miRNAs are aberrantly expressed in human ovarian cancer. The overall miRNA expression could clearly separate normal versus cancer tissues. The most significantly overexpressed miRNAs were miR-200a, miR-141, miR-200c, and miR-200b, whereas miR-199a, miR-140, miR-145, and miR-125b1 were among the most down-modulated miRNAs. We could also identify miRNAs whose expression was correlated with specific ovarian cancer biopathologic features, such as histotype, lymphovascular and organ invasion, and involvement of ovarian surface. Moreover, the levels of miR-21, miR-203, and miR-205, up-modulated in ovarian carcinomas compared with normal tissues, were significantly increased after 5-aza-2'-deoxycytidine demethylating treatment of OVCAR3 cells, suggesting that the DNA hypomethylation could be the mechanism responsible for their overexpression. Our results indicate that miRNAs might play a role in the pathogenesis of human EOC and identify altered miRNA gene methylation as a possible epigenetic mechanism involved in their aberrant expression.
LinkOut: [PMID: 17875710]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000269216.3 | 3UTR | AUAUUUUUCUUCCAUGUAUACAAUAAUUUUUUUAAAAAGUGCAAUUUGCGUUGCAGCAAUCAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000269216.3 | 3UTR | UAUACAAUAAUUUUUUUAAAAAGUGCAAUUUGCGUUGCAGCAAUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
128 hsa-miR-200a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000204 DLX5 distal-less homeobox 5 2 1
MIRT000730 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT000772 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 2 1
MIRT000773 PCDH8 protocadherin 8 2 1
MIRT000774 RAB30 RAB30, member RAS oncogene family 2 1
MIRT001035 ZEB2 zinc finger E-box binding homeobox 2 5 20
MIRT001175 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 4 3
MIRT002480 ZEB1 zinc finger E-box binding homeobox 1 5 13
MIRT002481 SIP1 gem (nuclear organelle) associated protein 2 2 2
MIRT003140 Zeb2 zinc finger E-box binding homeobox 2 3 1
MIRT003141 Zeb1 zinc finger E-box binding homeobox 1 3 1
MIRT004005 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT004006 GATA6 GATA binding protein 6 3 2
MIRT004007 VCAM1 vascular cell adhesion molecule 1 2 1
MIRT004400 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 2 1
MIRT004524 WASF3 WAS protein family, member 3 2 1
MIRT004549 TFRC transferrin receptor (p90, CD71) 1 1
MIRT004622 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT004867 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005752 GDAP1 ganglioside induced differentiation associated protein 1 3 1
MIRT006423 MAPK14 mitogen-activated protein kinase 14 4 2
MIRT006665 CCNE2 cyclin E2 1 1
MIRT006704 KEAP1 kelch-like ECH-associated protein 1 3 1
MIRT006834 SRF serum response factor (c-fos serum response element-binding transcription factor) 2 1
MIRT007290 SMAD2 SMAD family member 2 1 1
MIRT007291 SMAD3 SMAD family member 3 1 1
MIRT007299 YAP1 Yes-associated protein 1 1 1
MIRT020343 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT020345 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT020346 ELMO2 engulfment and cell motility 2 2 1
MIRT020347 ERBB2IP erbb2 interacting protein 2 1
MIRT020348 WDR37 WD repeat domain 37 2 1
MIRT020349 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT020350 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT020351 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT020352 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT020353 RIN2 Ras and Rab interactor 2 1 1
MIRT020354 HOXB5 homeobox B5 1 1
MIRT020355 SEPT7 septin 7 1 1
MIRT020356 KLF11 Kruppel-like factor 11 1 1
MIRT052922 MYB v-myb myeloblastosis viral oncogene homolog (avian) 3 1
MIRT053166 TFAM transcription factor A, mitochondrial 2 1
MIRT053353 UBASH3B ubiquitin associated and SH3 domain containing B 4 1
MIRT053604 TP53 tumor protein p53 2 1
MIRT054264 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT054265 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT054371 PTEN phosphatase and tensin homolog 3 2
MIRT054542 HFE hemochromatosis 2 1
MIRT054545 DLC1 deleted in liver cancer 1 2 1
MIRT054553 ATRX alpha thalassemia/mental retardation syndrome X-linked 2 1
MIRT061758 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT072481 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT078341 MED13 mediator complex subunit 13 1 1
MIRT099340 QKI QKI, KH domain containing, RNA binding 1 1
MIRT117486 ADNP2 ADNP homeobox 2 1 1
MIRT126445 ARL5B ADP-ribosylation factor-like 5B 1 5
MIRT127537 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT135564 SPRYD4 SPRY domain containing 4 1 1
MIRT176071 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 2
MIRT176153 PGK1 phosphoglycerate kinase 1 1 1
MIRT227601 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT313184 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT368862 IPO5 importin 5 1 1
MIRT437873 AREG amphiregulin 4 1
MIRT438100 GRB2 growth factor receptor-bound protein 2 1 1
MIRT438675 CDK6 cyclin-dependent kinase 6 3 1
MIRT441429 STXBP2 syntaxin binding protein 2 1 1
MIRT441732 SEPT8 septin 8 1 1
MIRT442158 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT443389 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT447629 NDST4 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4 1 1
MIRT452254 TRAM1 translocation associated membrane protein 1 1 1
MIRT455748 YRDC yrdC domain containing (E. coli) 1 6
MIRT470195 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT473463 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT478508 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT488715 BICD2 bicaudal D homolog 2 (Drosophila) 1 2
MIRT498345 PRELID2 PRELI domain containing 2 1 1
MIRT500583 USP53 ubiquitin specific peptidase 53 1 1
MIRT502259 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 2
MIRT502310 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT502449 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 2
MIRT502530 EPHA2 EPH receptor A2 1 2
MIRT503111 BRD3 bromodomain containing 3 1 1
MIRT505323 TMOD3 tropomodulin 3 (ubiquitous) 1 2
MIRT506628 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 4
MIRT506861 KIAA1147 KIAA1147 1 1
MIRT519589 ZNF805 zinc finger protein 805 1 2
MIRT519813 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT529418 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT536478 KIAA1549 KIAA1549 1 1
MIRT537735 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT539039 ATXN7L1 ataxin 7-like 1 1 1
MIRT547112 PIGW phosphatidylinositol glycan anchor biosynthesis, class W 1 1
MIRT548308 EPHA7 EPH receptor A7 1 1
MIRT549102 C18orf25 chromosome 18 open reading frame 25 1 1
MIRT554194 SLC35D1 solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 1 1
MIRT555677 PGAM4 phosphoglycerate mutase family member 4 1 1
MIRT557413 H2AFZ H2A histone family, member Z 1 2
MIRT559958 TRMT112 tRNA methyltransferase 11-2 homolog (S. cerevisiae) 1 1
MIRT564938 XPOT exportin, tRNA 1 1
MIRT568097 CDV3 CDV3 homolog (mouse) 1 1
MIRT573383 KIAA1549L KIAA1549-like 1 1
MIRT614582 LHX1 LIM homeobox 1 1 1
MIRT632224 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT634842 APOOL apolipoprotein O-like 1 1
MIRT639525 ZNF621 zinc finger protein 621 1 1
MIRT645300 ANGPTL7 angiopoietin-like 7 1 1
MIRT654775 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT656541 MACC1 metastasis associated in colon cancer 1 1 1
MIRT663684 CCDC18 coiled-coil domain containing 18 1 1
MIRT682853 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT682940 ZNF292 zinc finger protein 292 1 1
MIRT682959 RPL12 ribosomal protein L12 1 1
MIRT683087 A1BG alpha-1-B glycoprotein 1 1
MIRT692251 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT696502 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT696748 RBM28 RNA binding motif protein 28 1 1
MIRT702209 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT708614 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT709036 TROVE2 TROVE domain family, member 2 1 1
MIRT710918 GLTSCR1L KIAA0240 1 1
MIRT713191 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT714497 HSPA4 heat shock 70kDa protein 4 1 1
MIRT718596 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT723110 CLDND1 claudin domain containing 1 1 1
MIRT723914 PEX11A peroxisomal biogenesis factor 11 alpha 1 1
MIRT725579 CELF1 CUGBP, Elav-like family member 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*