Accession ID: MIRT004006 [miRNA, hsa-miR-200a-3p :: GATA6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-200aLinkOut: [miRBase ]
Description Homo sapiens miR-200a stem-loop
Comment miR-200a was cloned from mouse kidney tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-200a-3p
Mature Sequence 54| UAACACUGUCUGGUAACGAUGU |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-200a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GATA6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description GATA binding protein 6
Transcript NM_0052    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GATA6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GATA6
(miRNA target sites are highlighted)
>GATA6|NM_0052|3'UTR
   1 GCCCTGGCCCTGGCCTGAGCCCACGCCGCCAGGAGGCAGGGAGGGCTCCGCCGCGGGCCTCACTCCACTCGTGTCTGCTT
  81 TTGTGCAGCGGTCCAGACAGTGGCGACTGCGCTGACAGAACGTGATTCTCGTGCCTTTATTTTGAAAGAGATGTTTTTCC
 161 CAAGAGGCTTGCTGAAAGAGTGAGAGAAGATGGAAGGGAAGGGCCAGTGCAACTGGGCGCTTGGGCCACTCCAGCCAGCC
 241 CGCCTCCGGGGCGGACCCTGCTCCACTTCCAGAAGCCAGGACTAGGACCTGGGCCTTGCCTGCTATGGAATATTGAGAGA
 321 GATTTTTTAAAAAAGATTTTGCATTTTGTCCAAAATCATGTGCTTCTTCTGATCAATTTTGGTTGTTCCAGAATTTCTTC
 401 ATACCTTTTCCACATCCAGATTTCATGTGCGTTCATGGAGAAGATCACTTGAGGCCATTTGGTACACATCTCTGGAGGCT
 481 GAGTCGGTTCATGAGGTCTCTTATCAAAAATATTACTCAGTTTGCAAGACTGCATTGTAACTTTAACATACACTGTGACT
 561 GACGTTTCTCAAAGTTCATATTGTGTGGCTGATCTGAAGTCAGTCGGAATTTGTAAACAGGGTAGCAAACAAGATATTTT
 641 TCTTCCATGTATACAATAATTTTTTTAAAAAGTGCAATTTGCGTTGCAGCAATCAGTGTTAAATCATTTGCATAAGATTT
 721 AACAGCATTTTTTATAATGAATGTAAACATTTTAACTTAATGGTACTTAAAATAATTTAAAAGAAAAATGTTAACTTAGA
 801 CATTCTTATGCTTCTTTTACAACTACATCCCATTTTATATTTCCAATTGTTAAAGAAAAATATTTCAAGAACAAATCTTC
 881 TCTCAGGAAAATTGCCTTTCTCTATTTGTTAAGAATTTTTATACAAGAACACCAATATACCCCCTTTATTTTACTGTGGA
 961 ATATGTGCTGGAAAAATTGCAACAACACTTTACTACCTAACGGATAGCATTTGTAAATACTCTAGGTATCTGTAAACACT
1041 CTGATGAAGTCTGTATAGTGTGACTAACCCACAGGCAGGTTGGTTTACATTAATTTTTTTTTTTGAATGGGATGTCCTAT
1121 GGAAACCTATTTCACCAGAGTTTTAAAAATAAAAAGGGTATTGTTTTGTCTTCTGTACAGTGAGTTCCTTCCCTTTTCAA
1201 AGCTTTCTTTTTATGCTGTATGTGACTATAGATATTCATATAAAACAAGTGCACGTGAAGTTTGCAAAATGCTTTAAGGC
1281 CTTCCTTTCAAAGCATAGTCCTTTTGGAGCCGTTTTGTACCTTTTATACCTTGGCTTATTTGAAGTTGACACATGGGGTT
1361 AGTTACTACTCTCCATGTGCATTGGGGACAGTTTTTATAAGTGGGAAGGACTCAGTATTATTATATTTGAGATGATAAGC
1441 ATTTTGTTTGGGAACAATG
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: GATA6    [ Functional MTI ]
Validation Method Microarray , Other
Conditions normal and malignant ovarian tissues
Original Description (Extracted from the article) ... Confirmed and potential targets for miRNA members of various signatures.//{This MTI shown in Supplementary Table S6} ...

- Iorio, M. V. Visone, R. Di Leva, G. Donati, et al., 2007, Cancer Res.

Article - Iorio, M. V. Visone, R. Di Leva, G. Donati, et al.
- Cancer Res, 2007
Epithelial ovarian cancer (EOC) is the sixth most common cancer in women worldwide and, despite advances in detection and therapies, it still represents the most lethal gynecologic malignancy in the industrialized countries. Unfortunately, still relatively little is known about the molecular events that lead to the development of this highly aggressive disease. The relatively recent discovery of microRNAs (miRNA), a class of small noncoding RNAs targeting multiple mRNAs and triggering translation repression and/or RNA degradation, has revealed the existence of a new level of gene expression regulation. Multiple studies involving various types of human cancers proved that miRNAs have a causal role in tumorigenesis. Here we show that, in comparison to normal ovary, miRNAs are aberrantly expressed in human ovarian cancer. The overall miRNA expression could clearly separate normal versus cancer tissues. The most significantly overexpressed miRNAs were miR-200a, miR-141, miR-200c, and miR-200b, whereas miR-199a, miR-140, miR-145, and miR-125b1 were among the most down-modulated miRNAs. We could also identify miRNAs whose expression was correlated with specific ovarian cancer biopathologic features, such as histotype, lymphovascular and organ invasion, and involvement of ovarian surface. Moreover, the levels of miR-21, miR-203, and miR-205, up-modulated in ovarian carcinomas compared with normal tissues, were significantly increased after 5-aza-2'-deoxycytidine demethylating treatment of OVCAR3 cells, suggesting that the DNA hypomethylation could be the mechanism responsible for their overexpression. Our results indicate that miRNAs might play a role in the pathogenesis of human EOC and identify altered miRNA gene methylation as a possible epigenetic mechanism involved in their aberrant expression.
LinkOut: [PMID: 17875710]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
40 hsa-miR-200a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000204 DLX5 distal-less homeobox 5 2 1
MIRT000730 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT000772 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 2 1
MIRT000773 PCDH8 protocadherin 8 2 1
MIRT000774 RAB30 RAB30, member RAS oncogene family 2 1
MIRT001035 ZEB2 zinc finger E-box binding homeobox 2 5 14
MIRT001175 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 4 2
MIRT002480 ZEB1 zinc finger E-box binding homeobox 1 5 11
MIRT002481 SIP1 survival of motor neuron protein interacting protein 1 2 2
MIRT003140 Zeb2 zinc finger E-box binding homeobox 2 3 1
MIRT003141 Zeb1 zinc finger E-box binding homeobox 1 3 1
MIRT004005 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT004006 GATA6 GATA binding protein 6 2 1
MIRT004007 VCAM1 vascular cell adhesion molecule 1 2 1
MIRT004400 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 2 1
MIRT004524 WASF3 WAS protein family, member 3 2 1
MIRT004549 TFRC transferrin receptor (p90, CD71) 1 1
MIRT004622 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT004867 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005752 GDAP1 ganglioside-induced differentiation-associated protein 1 3 1
MIRT006423 MAPK14 mitogen-activated protein kinase 14 3 1
MIRT006665 CCNE2 cyclin E2 1 1
MIRT006704 KEAP1 kelch-like ECH-associated protein 1 3 1
MIRT006834 SRF serum response factor (c-fos serum response element-binding transcription factor) 2 1
MIRT007290 SMAD2 SMAD family member 2 1 1
MIRT007291 SMAD3 SMAD family member 3 1 1
MIRT007299 YAP1 Yes-associated protein 1 1 1
MIRT020343 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT020345 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT020346 ELMO2 engulfment and cell motility 2 2 1
MIRT020347 ERBB2IP erbb2 interacting protein 2 1
MIRT020348 WDR37 WD repeat domain 37 2 1
MIRT020349 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT020350 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT020351 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT020352 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT020353 RIN2 Ras and Rab interactor 2 1 1
MIRT020354 HOXB5 homeobox B5 1 1
MIRT020355 SEPT7 septin 7 1 1
MIRT020356 KLF11 Kruppel-like factor 11 1 1