Accession ID: MIRT004074 [miRNA, hsa-miR-373-3p :: CNOT6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-373LinkOut: [miRBase ]
Synonyms MIRN373, hsa-mir-373, miRNA373, MIR373
Description Homo sapiens miR-373 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-373-3p
Mature Sequence 44| GAAGUGCUUCGAUUUUGGGGUGU |66
Evidence Experimental
Experiments Cloned
Putative hsa-miR-373-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CNOT6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CCR4
Description CCR4-NOT transcription complex, subunit 6
Transcript NM_015455    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CNOT6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CNOT6
(miRNA target sites are highlighted)
>CNOT6|NM_015455|3'UTR
   1 TCAAGCACCTTCAGAGGACAGCCTTGATTCACTTGTAAACTTGTGAAAATCTGAACATAGGGGAGTGAGGTATGGCCACT
  81 GAGGATTTTTGCTTGCTTAAGAATGATTTGGACTTTCAATCTGATTATTTGATAAGGATATAGTATGAAAGCCAGGTGCT
 161 AGCAACAGACAAATTCTGAGCCCAATATGCTTTATACTGCTAGACAGGGATTGGTGTGTTTGCACCTGTCTTTCATTTGT
 241 CATAAGAGATTTTCCTATTTCTTCTACCCAATAGAATATTTTCATGCCTGGAAATAGGAAAATGTGTGAACAGCGTATTC
 321 TCTTCACACAGAAATCTGTAGCACTGCTTTTTTGAGGCCAGTAGCAACATCCAGAGATCATTCTTCCATACTTTACTCCC
 401 TCCTTTTTCAGACTTGTTTGTAAAGTACAGAATCTGAATTTAGCCTTTATGATTGTATATGATCCACAGAAGACCTGATT
 481 TATGAAATTTTGTACTAAAATCATTTGGAAATGATTGTATTGTAAACTGAGGCTAAATTTTTTTTTAAACCTGTTTCATG
 561 TGTTATAAAGGCCAGCTTGTAAAAGAAGCTGCAACAGACTTTCTCTGCTCATGATTTGCACTCTTAGGGTTTTGTTAGCC
 641 CTTTTGTACTACTTTCTTTTTAAATTGAGAACATGGTTCTTTACATATAAATCTGCTTCAACCTTAGGATGTTTTCAGAC
 721 CAGAGGCAACTTATTCATGAATTTTTATGAAAACTATCTACTAGGACAGATAAGCTGAACAGTGATGATCTGTAGACATT
 801 TATGGACTGAATGTAATGGTTGATATATGTACATTCTGATATTTTTAAATCTTTAACTTTTTAAAGTTAAAAACCTACAG
 881 CTGCTTAGGTCCAGCTTCTTAACTCTTTTTGAGACACTTCCTGTCCTATCTCCACTGTGCCTGCCTAAATTTGTTCTCAC
 961 CAAGCACTGCCTGTGCATGCAGAGAAAATCTGTGCATCCTCTTTTATATTTTTAAAATACTGTTTAACATTTGTGAGAAT
1041 TTTATGAAAATGCTTTTGTATGAGCTGTGGCTTTTTCCCATTGTGAAGCATTGAATATCACATTTTGGAACATGTTATAG
1121 GGTGAGTCCCTGGATCTTTGCTCACCAGATCCAAGCACTGCTTCTCGGTGTCATTGCAGTGTGCTGCTTGTCACCCAGAA
1201 TACTACTATCATGTGAATTCTTTTTGTCGTCAGTGTCTTTTCCTTAGTCTTTTTGTTGTTGTTGTTGTTGTTGTTTTAAT
1281 CATTCCTTTTTTAAGAAGAAGTAATTTTCCATTTATGAAGCAGTATGAATTAGATGTATTTTCAAAACAGGTCCCTAAGA
1361 CAATTCTTCAGATCATTTTTAAAATGACTAAGTCATTTTAGTATGTCAAGCAAGATAAAAATTACATCATACCGTCTATT
1441 TTGCCCATAGTGCCATTTAGAGATGAAAACCAGCTTTAACTTTGCAAAGTGAACATGTACATGGTCTGCTCTCATTTATT
1521 CATTCTTCTCTCAAAAGTCAAATGAATGCAGAGGGAGCTTGGTCAAACTGCTTTTGTTTCAACTGCAGGCAGGGGAGCAA
1601 AAGGACGCCATGTGAGCATTAGGAAAAAAAATACTCACTCTTACTAACAATTTTTATACAGAAAATGAGTCATTTTGGAA
1681 ATGATTCTTATGTTTTTTTTTTTTCTCCTTTTAGAAAATTCTCCAAAAGGTTTTGATGTTGAATCTTGGTCTTGGACCTG
1761 TTTTTTCCTTTGAGGGTTTTTTGTTTTTTGTTTTTTCTAGGATTTCATTGTGATGTTTTGGTTTTGTTTTTTGCTTTTTG
1841 TTTAAGTTGTGCTGACACCAAACACATCCAGTTTATAATCAGTACATTGGAAAGCTGGTATTGATGTAGAACCAGTGCAT
1921 AACTTTTTATGGGGTTTTGTTATTGGTTTTTTTTTGTAAAGTGTGAATAAAAGGTATGTTTACTCATTTTTCCTGAACAC
2001 TGTGTTGGTAATGTGCATCATGACAATTTCCAGTGAAGGTGAGCTGGAGCTGGTTGGACTAATGAGACTGAGGAAGCAGC
2081 TTTTCCTACGATCTGCATTATGTAATCACAGGTCCAGAGAGCTTTATGGAAGCGGGAGAGGAGGAGCACTTACTCATGTT
2161 GTATTTGTTAATGGAGGATGTCATCTTTTCATAGATGCTGGAACTAGAGTGCACTTGTTAGATGCTAAAGGTTTGAGCTT
2241 TACACAAAATGTCTTCATCTGTATTTGTTATTGTCTACAATATATTTGAATTTGGGGCAGCATATTAAGATGTAATGGCC
2321 TGTTATGTCTTGAAAATACTTGTTTTGCCTCTTCCAGGCATACTGCATTCTGTGGATCAGTTTGAACAGCTTCTCCACCT
2401 TATTTGGACAGTGATAAATTGAACCAAGAGTGTAGATTTACAAGTGTAACCTTCAAAAGAGGAAGAACTATTTGGGGTCT
2481 GTAGGTAATGAACAGTCACACCAAAATAGACTATGATGCTTTTGTTAAGAAAGGTTTCATGTTTTAGATATTTTCCGTGT
2561 CCTAAATAATTTTCAATAATCTATAATCCCTAAAATGCAATAAAAACTAGTATGTTTTCACGGTGTATATTTTTTTTCAA
2641 AAATTCTGTAACAAATATATTTAATGTGTTGCCATAATGTCATTTCAGTATTTTTGCTGGATAAATCCATTTTAGAAATG
2721 TCTTACAAAAAGTTTAGGGCATGTTTTCTGTTTTAAAGACCAGAAGTTTGAAGGCACCCAAATCCTTGTCGCCAATCTCC
2801 TGAAGTACAGCTTTACCATATTAGTGGTCATTATTTATGCTTTGAGAGTTTCAATATTGTTCGTCAAGTTAACTTATGGC
2881 ATAATTTAAGCTAAAGTTGTAGAAATGAATTGTTGAGTGCAACTTTCATAGTCCCAAAGATAGGCAGAGAACATCTCCAG
2961 AAATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTAATATGATTTAGTGACAACCAGGAAAACTTACTTGGGATTAT
3041 TAGCACTTTCAAACTTAGGGACATTATTAAATTGGATGGAATGCACTTCTAAATGTTTAAATTAAAATTTCAAAGCTCTT
3121 TCGAGATTCAGGTTCTCAATAATAATATTCAAGTTTTAGAGTTTCACTTTGTACTATTTAAATTTATGGAACTAGTTTCC
3201 ATACTGACTTGTAAGGTTTTGGGGTCATATATAAGGACTAAAGCCAAGCTAGGCAAAACAATGACAGCACCGTTTTTTCA
3281 GTGAAGCTCTCAGAATGTCCAGTACAGATGTTGCAGATAATTCCAAGAACTCCTTCAGCAGGTGTTCTTCACCATTCGTA
3361 AACAGTATTTTAAGATGTTCACTTTGCTCTTCTTTTTGGTTACATACATTTTAATAACTGGTATGTTGAAGTAGTGTCTA
3441 AAAGTATCTAGTCTTTATTCACAGTACATTATATTGTGTGATGCACTGGACTAACTCTTGTTTACCATTCATGTAACAAA
3521 ACCCAGCACATTATCTGCACTATAAGCTCAAAGAATGTCACATCCGCCCAGACAGCTCTTTGATGAGGGTGATGGGAACT
3601 GAATAAACCATACGGACTGGCAGTAACAAGGGCTTTTACTGTTCTGTTCAGTGGAACCTTCTTGGTCAAATTGTAATTAG
3681 CTAGCATTATATTTATATACAGGGTCTTTTTTCTTTACCGATGTATTTTCCTACTCATAGCCAACCAATAAATTCAGTAT
3761 CTGTTTCAAATATTTTAGAAGTGTAGTTTGTATAGCTGTAGTACTGAGGTTTGAGGAAAAATAAATGTTGATCAGCAGAC
3841 CACGTATTTAAAATTCTGAATCTTCTGGGACAGGGTTGTAACTCAGCCTTCCAAAGGGAAGAGTGCAGGGGGACGGGGCC
3921 ATGATATGGGGAAATGGTGTAAACTAATGTATTTCTTTATTGGCTGTTATTCTGTATAACACTCATATCTTTGCCAAAGT
4001 TCAATTTTATATTTAGGCAACTGATGGTCCTTTTGCATTTAGGATTTTCGTTGTTGTTACCTTATACCTCATGATATAAG
4081 GAATGGGCTCATGTGTCTTCCGTCTTTTGGAAGGAGGTTGACATATTTTAAATAAATGCTTTTAAATACAGTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uguggggUUUUAGCUUCGUGAAg 5'
                 |:|:  |:||||||| 
Target 5' aagcgggAGAGGAGGAGCACTTa 3'
2130 - 2152 152.00 -13.80
2
miRNA  3' ugUGGGGUUUUAG-CUUCGUGAag 5'
            || | :||||| | ||||||  
Target 5' tcACACAGAAATCTGTAGCACTgc 3'
324 - 347 149.00 -15.40
3
miRNA  3' ugUGGG-GUUUUAGCUUCGUGAag 5'
            :|:| | |:||| |||||||  
Target 5' ttGCTCACCAGATCCAAGCACTgc 3'
1138 - 1161 149.00 -16.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-373-3p :: CNOT6    [ Functional MTI ]
Validation Method Microarray , Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... Filtering the expression profiles for genes characterized by the LocusLink database12 that were significantly downregulated (P < 0.001) at both 12 and 24 h, gave sets of 96 and 174 annotated genes downregulated by miR-1 and miR-124, respectively (Supplementary Tables 1 and 2).//{These MTI shown in Supplementary Table 1,2,4} ...

- Lim, L. P. Lau, N. C. Garrett-Engele, P. et al., 2005, Nature.

Article - Lim, L. P. Lau, N. C. Garrett-Engele, P. et al.
- Nature, 2005
MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression in plants and animals. To investigate the influence of miRNAs on transcript levels, we transfected miRNAs into human cells and used microarrays to examine changes in the messenger RNA profile. Here we show that delivering miR-124 causes the expression profile to shift towards that of brain, the organ in which miR-124 is preferentially expressed, whereas delivering miR-1 shifts the profile towards that of muscle, where miR-1 is preferentially expressed. In each case, about 100 messages were downregulated after 12 h. The 3' untranslated regions of these messages had a significant propensity to pair to the 5' region of the miRNA, as expected if many of these messages are the direct targets of the miRNAs. Our results suggest that metazoan miRNAs can reduce the levels of many of their target transcripts, not just the amount of protein deriving from these transcripts. Moreover, miR-1 and miR-124, and presumably other tissue-specific miRNAs, seem to downregulate a far greater number of targets than previously appreciated, thereby helping to define tissue-specific gene expression in humans.
LinkOut: [PMID: 15685193]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
499 hsa-miR-373-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000056 RAD23B RAD23 homolog B (S. cerevisiae) 4 2
MIRT000606 RECK reversion-inducing-cysteine-rich protein with kazal motifs 4 1
MIRT000721 VEGFA vascular endothelial growth factor A 2 2
MIRT001754 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 5 5
MIRT001931 CSDC2 cold shock domain containing C2, RNA binding 2 1
MIRT002428 CD44 CD44 molecule (Indian blood group) 4 4
MIRT002495 KIF23 kinesin family member 23 2 1
MIRT002496 GBAS glioblastoma amplified sequence 2 1
MIRT002498 C2orf18 chromosome 2 open reading frame 18 3 2
MIRT002500 PHC2 polyhomeotic homolog 2 (Drosophila) 2 1
MIRT002501 CD24 CD24 molecule 2 1
MIRT002504 NUPL1 nucleoporin like 1 2 1
MIRT002505 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT002506 KLHL12 kelch-like 12 (Drosophila) 2 1
MIRT002508 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 2 1
MIRT002509 LUC7L2 LUC7-like 2 (S. cerevisiae) 2 1
MIRT002510 LMNB1 lamin B1 2 1
MIRT002511 MKRN1 makorin ring finger protein 1 2 1
MIRT002512 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 2 1
MIRT002515 FYCO1 FYVE and coiled-coil domain containing 1 2 1
MIRT002516 CD83 CD83 molecule 2 1
MIRT002517 GBP3 guanylate binding protein 3 2 1
MIRT002520 RNF149 ring finger protein 149 2 1
MIRT002521 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 5 2
MIRT002522 STX11 syntaxin 11 2 1
MIRT002523 FITM2 fat storage-inducing transmembrane protein 2 2 1
MIRT002524 GPSM2 G-protein signaling modulator 2 2 1
MIRT002525 CENPF centromere protein F, 350/400kDa (mitosin) 2 1
MIRT002526 CFL2 cofilin 2 (muscle) 2 1
MIRT002528 TUSC2 tumor suppressor candidate 2 2 1
MIRT002529 INSIG2 insulin induced gene 2 2 1
MIRT002530 GLTP glycolipid transfer protein 2 1
MIRT002531 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 2 1
MIRT002532 PRC1 protein regulator of cytokinesis 1 2 1
MIRT002533 BAZ1A bromodomain adjacent to zinc finger domain, 1A 2 1
MIRT002534 USP12 ubiquitin specific peptidase 12 2 1
MIRT002535 NIN ninein (GSK3B interacting protein) 2 1
MIRT002537 TBC1D2 TBC1 domain family, member 2 2 1
MIRT002538 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 3 3
MIRT002540 TMEM14A transmembrane protein 14A 2 1
MIRT002541 STK4 serine/threonine kinase 4 2 1
MIRT002542 ZNF226 zinc finger protein 226 2 1
MIRT002543 HSPA14 heat shock 70kDa protein 14 2 1
MIRT002544 KIAA1919 KIAA1919 2 1
MIRT002545 SLC25A23 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 2 1
MIRT002548 C9orf78 chromosome 9 open reading frame 78 2 1
MIRT002551 MICA MHC class I polypeptide-related sequence A 3 2
MIRT002552 KDM1B lysine (K)-specific demethylase 1B 2 1
MIRT002554 MED28 mediator complex subunit 28 2 1
MIRT002555 ADAM9 ADAM metallopeptidase domain 9 2 1
MIRT002556 TTC8 tetratricopeptide repeat domain 8 2 1
MIRT002558 ZHX1 zinc fingers and homeoboxes 1 2 1
MIRT002559 RPIA ribose 5-phosphate isomerase A 2 1
MIRT003815 PCGF5 polycomb group ring finger 5 2 1
MIRT003816 PDIK1L PDLIM1 interacting kinase 1 like 2 1
MIRT003817 UBXN1 UBX domain protein 1 2 1
MIRT003832 CDK19 cyclin-dependent kinase 19 2 1
MIRT003843 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 2 1
MIRT003846 TMEM9B TMEM9 domain family, member B 2 1
MIRT003914 RAD52 RAD52 homolog (S. cerevisiae) 4 1
MIRT003918 XPA xeroderma pigmentosum, complementation group A 2 1
MIRT003919 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 2 1
MIRT003942 PACRGL PARK2 co-regulated-like 2 1
MIRT003943 TEX30 testis expressed 30 2 1
MIRT003944 C12orf23 chromosome 12 open reading frame 23 2 1
MIRT003948 ANKRD13B ankyrin repeat domain 13B 2 1
MIRT004073 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 2 1
MIRT004074 CNOT6 CCR4-NOT transcription complex, subunit 6 2 1
MIRT004438 CYB5R4 cytochrome b5 reductase 4 2 1
MIRT004448 VPS26A vacuolar protein sorting 26 homolog A (S. pombe) 2 1
MIRT004449 PBK PDZ binding kinase 2 1
MIRT004468 FAM13B family with sequence similarity 13, member B 2 1
MIRT004515 SEPT2 septin 2 2 1
MIRT005561 TXNIP thioredoxin interacting protein 5 5
MIRT005562 RABEP1 rabaptin, RAB GTPase binding effector protein 1 4 1
MIRT006016 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 1
MIRT006021 MBD2 methyl-CpG binding domain protein 2 3 1
MIRT006022 RASSF1 Ras association (RalGDS/AF-6) domain family member 1 3 1
MIRT006157 MTOR mechanistic target of rapamycin (serine/threonine kinase) 3 1
MIRT006158 SIRT1 sirtuin 1 3 1
MIRT006735 NFIB nuclear factor I/B 5 2
MIRT020072 CD24P4 CD24 molecule pseudogene 4 1 1
MIRT035565 ANKRD52 ankyrin repeat domain 52 1 1
MIRT053300 DKK1 dickkopf 1 homolog (Xenopus laevis) 3 1
MIRT053301 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 3 1
MIRT053303 BTG1 B-cell translocation gene 1, anti-proliferative 4 2
MIRT053305 LEFTY1 left-right determination factor 1 4 3
MIRT056486 PFKP phosphofructokinase, platelet 1 4
MIRT057393 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT061191 MED17 mediator complex subunit 17 1 1
MIRT061364 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT063064 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT064714 CCND2 cyclin D2 1 1
MIRT065869 GDF11 growth differentiation factor 11 1 1
MIRT066865 TMEM19 transmembrane protein 19 1 1
MIRT067239 FOXJ2 forkhead box J2 1 1
MIRT070849 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 2
MIRT071386 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 3
MIRT075784 KIAA0513 KIAA0513 1 3
MIRT077841 MINK1 misshapen-like kinase 1 1 1
MIRT078821 UNK unkempt homolog (Drosophila) 1 1
MIRT079421 FOXK2 forkhead box K2 1 2
MIRT080187 PRKACB protein kinase, cAMP-dependent, catalytic, beta 1 1
MIRT083970 RAB22A RAB22A, member RAS oncogene family 1 2
MIRT084953 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT093811 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT093950 SLAIN2 SLAIN motif family, member 2 1 1
MIRT108660 ZBTB33 zinc finger and BTB domain containing 33 1 2
MIRT112098 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 3
MIRT122373 RGMB RGM domain family, member B 1 2
MIRT124137 GINS4 GINS complex subunit 4 (Sld5 homolog) 1 2
MIRT138703 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT147291 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 5
MIRT155905 SIK1 salt-inducible kinase 1 1 1
MIRT165903 CREBRF CREB3 regulatory factor 1 1
MIRT173698 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT178671 FAM102B family with sequence similarity 102, member B 1 1
MIRT187259 DAZAP2 DAZ associated protein 2 1 5
MIRT199115 ZNF532 zinc finger protein 532 1 1
MIRT199291 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT200932 ZNF264 zinc finger protein 264 1 3
MIRT201029 ZNF805 zinc finger protein 805 1 1
MIRT213212 REST RE1-silencing transcription factor 1 3
MIRT216433 SERF1A small EDRK-rich factor 1A (telomeric) 1 1
MIRT216458 SERF1B small EDRK-rich factor 1B (centromeric) 1 1
MIRT242207 TTC9 tetratricopeptide repeat domain 9 1 2
MIRT242365 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT242510 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT243434 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT244598 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT280999 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT302447 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT321782 FZD6 frizzled family receptor 6 1 4
MIRT322532 HMBOX1 homeobox containing 1 1 1
MIRT325520 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT356939 FEM1C fem-1 homolog c (C. elegans) 1 4
MIRT383606 POU2F1 POU class 2 homeobox 1 1 1
MIRT437959 LEFTY2 left-right determination factor 2 1 1
MIRT441412 FAM9C family with sequence similarity 9, member C 1 1
MIRT442452 FGF7 fibroblast growth factor 7 1 3
MIRT443079 ABLIM1 actin binding LIM protein 1 1 1
MIRT444426 EMC1 ER membrane protein complex subunit 1 1 1
MIRT446621 HIP1 huntingtin interacting protein 1 1 2
MIRT446812 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT448356 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 3
MIRT448739 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT449163 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT450835 IFFO1 intermediate filament family orphan 1 1 1
MIRT450923 CADM2 cell adhesion molecule 2 1 1
MIRT450967 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT461256 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 3
MIRT463606 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT467903 SLC22A23 solute carrier family 22, member 23 1 1
MIRT472001 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT473616 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT474729 KIF13A kinesin family member 13A 1 3
MIRT476994 FAM73B family with sequence similarity 73, member B 1 1
MIRT477103 FAM160B1 family with sequence similarity 160, member B1 1 3
MIRT477274 ERGIC2 ERGIC and golgi 2 1 1
MIRT478735 CSNK1A1 casein kinase 1, alpha 1 1 3
MIRT480001 CAPRIN2 caprin family member 2 1 2
MIRT480665 BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 1 1
MIRT480830 BLCAP bladder cancer associated protein 1 5
MIRT481760 APH1A anterior pharynx defective 1 homolog A (C. elegans) 1 1
MIRT484828 ZNFX1 zinc finger, NFX1-type containing 1 1 1
MIRT484935 ZFYVE26 zinc finger, FYVE domain containing 26 1 2
MIRT485345 MYO1D myosin ID 1 1
MIRT485824 ARID4B AT rich interactive domain 4B (RBP1-like) 1 2
MIRT486018 LPAR2 lysophosphatidic acid receptor 2 1 1
MIRT493137 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 3
MIRT494092 DUSP2 dual specificity phosphatase 2 1 2
MIRT496053 MORC1 MORC family CW-type zinc finger 1 1 1
MIRT497461 DDR2 discoidin domain receptor tyrosine kinase 2 1 1
MIRT498052 SNX5 sorting nexin 5 1 3
MIRT500882 SUCO SUN domain containing ossification factor 1 2
MIRT501407 RBBP6 retinoblastoma binding protein 6 1 4
MIRT503795 ZNF12 zinc finger protein 12 1 3
MIRT504088 C9orf40 chromosome 9 open reading frame 40 1 3
MIRT504283 PARP1 poly (ADP-ribose) polymerase 1 1 3
MIRT505168 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 2
MIRT505217 UBN2 ubinuclein 2 1 4
MIRT505996 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 2
MIRT506271 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT506980 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT507215 FZD9 frizzled family receptor 9 1 3
MIRT507427 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT508565 CEP72 centrosomal protein 72kDa 1 2
MIRT508734 ZNF682 zinc finger protein 682 1 2
MIRT508825 GPR155 G protein-coupled receptor 155 1 1
MIRT509119 BMP8B bone morphogenetic protein 8b 1 3
MIRT509426 MCM7 minichromosome maintenance complex component 7 1 3
MIRT509734 EFCAB11 EF-hand calcium binding domain 11 1 2
MIRT510018 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 2
MIRT510215 ZNF317 zinc finger protein 317 1 2
MIRT511309 KIAA1551 KIAA1551 1 1
MIRT511408 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 3
MIRT511545 HMGB1 high mobility group box 1 1 3
MIRT512028 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT514126 SERF2 small EDRK-rich factor 2 1 1
MIRT514309 FXYD5 FXYD domain containing ion transport regulator 5 1 3
MIRT514471 FANCA Fanconi anemia, complementation group A 1 1
MIRT515194 CRCP CGRP receptor component 1 1
MIRT515564 TMEM134 transmembrane protein 134 1 1
MIRT515921 MFAP2 microfibrillar-associated protein 2 1 2
MIRT516049 MED18 mediator complex subunit 18 1 1
MIRT516360 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT516548 MIXL1 Mix paired-like homeobox 1 1
MIRT516788 PTRF polymerase I and transcript release factor 1 2
MIRT517009 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 1
MIRT517176 SLC28A1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1 1
MIRT517249 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 2
MIRT518306 ZNF514 zinc finger protein 514 1 2
MIRT518457 KIF6 kinesin family member 6 1 1
MIRT518688 KCNMB1 potassium large conductance calcium-activated channel, subfamily M, beta member 1 1 1
MIRT518793 MED16 mediator complex subunit 16 1 2
MIRT518852 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT518961 GRK7 G protein-coupled receptor kinase 7 1 1
MIRT519261 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT519421 KCNA7 potassium voltage-gated channel, shaker-related subfamily, member 7 1 2
MIRT519537 TMEM38A transmembrane protein 38A 1 1
MIRT520071 YIPF4 Yip1 domain family, member 4 1 1
MIRT520145 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT520299 UBXN2A UBX domain protein 2A 1 1
MIRT520562 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT520813 TAOK1 TAO kinase 1 1 1
MIRT520999 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT521226 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1
MIRT521538 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 2
MIRT522161 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 2
MIRT522207 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 3
MIRT522516 MFN1 mitofusin 1 1 1
MIRT522959 IPO9 importin 9 1 1
MIRT523072 HYPK huntingtin interacting protein K 1 1
MIRT523429 GPR157 G protein-coupled receptor 157 1 2
MIRT523554 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT523643 FOXK1 forkhead box K1 1 2
MIRT524241 DCTN6 dynactin 6 1 1
MIRT524284 CYCS cytochrome c, somatic 1 1
MIRT524383 CREB1 cAMP responsive element binding protein 1 1 1
MIRT524446 CNKSR3 CNKSR family member 3 1 1
MIRT524763 BCL2L2 BCL2-like 2 1 1
MIRT524972 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT525656 NHSL2 NHS-like 2 1 1
MIRT525692 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT526628 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT527541 DLGAP5 discs, large (Drosophila) homolog-associated protein 5 1 2
MIRT529528 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT529992 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 2
MIRT530139 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT530580 ABHD15 abhydrolase domain containing 15 1 1
MIRT530978 EXO5 exonuclease 5 1 2
MIRT531469 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 2
MIRT531768 TXK TXK tyrosine kinase 1 2
MIRT532042 FHDC1 FH2 domain containing 1 1 1
MIRT532933 ZNF385A zinc finger protein 385A 1 1
MIRT534515 SAR1B SAR1 homolog B (S. cerevisiae) 1 1
MIRT534620 RNASEH1 ribonuclease H1 1 2
MIRT534770 RASGEF1A RasGEF domain family, member 1A 1 1
MIRT535259 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT535394 PER1 period homolog 1 (Drosophila) 1 1
MIRT536029 MCUR1 coiled-coil domain containing 90A 1 1
MIRT536114 MBNL1 muscleblind-like splicing regulator 1 1 2
MIRT536178 MAP1B microtubule-associated protein 1B 1 1
MIRT536300 LIMA1 LIM domain and actin binding 1 1 1
MIRT536417 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT536554 KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 1 1
MIRT536614 IRF2 interferon regulatory factor 2 1 1
MIRT536635 INO80D INO80 complex subunit D 1 1
MIRT536870 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 1 1
MIRT536959 HAS3 hyaluronan synthase 3 1 1
MIRT536986 HABP4 hyaluronan binding protein 4 1 2
MIRT537249 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT537439 FBXL7 F-box and leucine-rich repeat protein 7 1 1
MIRT537555 ETNK1 ethanolamine kinase 1 1 1
MIRT537753 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT537965 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT537995 DPP8 dipeptidyl-peptidase 8 1 1
MIRT538265 CUL3 cullin 3 1 2
MIRT538518 CLCN3 chloride channel, voltage-sensitive 3 1 1
MIRT538581 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT538652 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT538916 BRI3BP BRI3 binding protein 1 1
MIRT539016 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT539063 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 2
MIRT539107 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT539444 ADAT2 adenosine deaminase, tRNA-specific 2 1 1
MIRT540267 FAM89A family with sequence similarity 89, member A 1 1
MIRT540381 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT541299 GLO1 glyoxalase I 1 1
MIRT542134 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT542260 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT546551 SATB2 SATB homeobox 2 1 1
MIRT547478 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT547636 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT547885 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT548572 DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 1 1
MIRT550870 SNAP47 synaptosomal-associated protein, 47kDa 1 2
MIRT552166 DAD1 defender against cell death 1 1 1
MIRT552196 F2RL3 coagulation factor II (thrombin) receptor-like 3 1 1
MIRT553586 TMEM100 transmembrane protein 100 1 1
MIRT554443 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT554497 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT554765 RHOC ras homolog family member C 1 1
MIRT555457 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT556533 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT557062 HOXB3 homeobox B3 1 1
MIRT557654 GATA6 GATA binding protein 6 1 1
MIRT560241 KLHL21 kelch-like 21 (Drosophila) 1 2
MIRT561334 ZBTB18 zinc finger protein 238 1 1
MIRT566279 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT567086 KBTBD2 kelch repeat and BTB (POZ) domain containing 2 1 1
MIRT567932 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT567985 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT568172 CCDC6 coiled-coil domain containing 6 1 1
MIRT571716 RPL17-C18orf32 RPL17-C18orf32 readthrough 1 1
MIRT571769 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT572202 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT572669 AGMAT agmatine ureohydrolase (agmatinase) 1 2
MIRT573701 RBM12B RNA binding motif protein 12B 1 1
MIRT574571 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT574737 HAUS8 HAUS augmin-like complex, subunit 8 1 1
MIRT575718 Map1b microtubule-associated protein 1B 1 1
MIRT608741 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT612604 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT614256 WDR53 WD repeat domain 53 1 2
MIRT615169 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT616165 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT616804 FEM1A fem-1 homolog a (C. elegans) 1 1
MIRT617317 DPF3 D4, zinc and double PHD fingers, family 3 1 1
MIRT617871 ESR1 estrogen receptor 1 1 1
MIRT619834 POLM polymerase (DNA directed), mu 1 2
MIRT620971 TM4SF5 transmembrane 4 L six family member 5 1 1
MIRT625858 SLC35C2 solute carrier family 35, member C2 1 1
MIRT626214 PNRC1 proline-rich nuclear receptor coactivator 1 1 2
MIRT626923 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT633115 CBX5 chromobox homolog 5 1 1
MIRT634091 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT634948 GTF2H2C general transcription factor IIH, polypeptide 2C 1 2
MIRT640024 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT641699 SPCS1 signal peptidase complex subunit 1 homolog (S. cerevisiae) 1 1
MIRT645208 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT656324 MELK maternal embryonic leucine zipper kinase 1 1
MIRT659550 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 1 1
MIRT662400 ICA1L islet cell autoantigen 1,69kDa-like 1 2
MIRT663618 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT663945 ZNF554 zinc finger protein 554 1 1
MIRT664221 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT664387 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT673127 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT677148 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT677254 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT678741 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT679726 FBXL2 F-box and leucine-rich repeat protein 2 1 1
MIRT680367 GATAD1 GATA zinc finger domain containing 1 1 2
MIRT680694 ZNF785 zinc finger protein 785 1 1
MIRT680772 WDR73 WD repeat domain 73 1 1
MIRT681404 RMND1 required for meiotic nuclear division 1 homolog (S. cerevisiae) 1 1
MIRT681698 ABI2 abl-interactor 2 1 1
MIRT681834 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT682325 RAB42 RAB42, member RAS oncogene family 1 1
MIRT683323 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT683393 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT683497 ZNF7 zinc finger protein 7 1 1
MIRT683529 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT683880 OCIAD1 OCIA domain containing 1 1 1
MIRT683953 MYLK3 myosin light chain kinase 3 1 1
MIRT683982 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT684085 TLR7 toll-like receptor 7 1 1
MIRT684138 CEP104 centrosomal protein 104kDa 1 1
MIRT684202 MSRB2 methionine sulfoxide reductase B2 1 1
MIRT684363 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT684497 GPR137B G protein-coupled receptor 137B 1 1
MIRT684579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT684622 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT684653 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT684718 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT684747 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT684792 MYO1F myosin IF 1 1
MIRT684924 CD28 CD28 molecule 1 1
MIRT685200 DCTN5 dynactin 5 (p25) 1 1
MIRT685253 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT685321 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT685356 CCL5 chemokine (C-C motif) ligand 5 1 1
MIRT685524 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685583 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT685640 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT685665 C11orf1 chromosome 11 open reading frame 1 1 1
MIRT685714 BHMT2 betaine--homocysteine S-methyltransferase 2 1 1
MIRT685747 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT685788 ZNF426 zinc finger protein 426 1 1
MIRT685888 RTN2 reticulon 2 1 1
MIRT685960 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT686111 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT686161 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT686288 WWC1 WW and C2 domain containing 1 1 1
MIRT686326 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT686367 USP15 ubiquitin specific peptidase 15 1 1
MIRT686395 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT686449 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT686496 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686532 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT686587 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT686698 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT686832 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT686885 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT686919 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT686985 SERINC1 serine incorporator 1 1 1
MIRT687049 RNF115 ring finger protein 115 1 1
MIRT687084 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT687259 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT687601 MANEAL mannosidase, endo-alpha-like 1 1
MIRT687655 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT687863 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT687988 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT688128 GEMIN8 gem (nuclear organelle) associated protein 8 1 1
MIRT688222 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT688280 FAM213A family with sequence similarity 213, member A 1 1
MIRT688481 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT688511 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT688835 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT689179 ZNF665 zinc finger protein 665 1 1
MIRT689804 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT689849 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT690744 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT690989 ZNF578 zinc finger protein 578 1 1
MIRT691081 NUGGC nuclear GTPase, germinal center associated 1 1
MIRT691338 KIAA1841 KIAA1841 1 1
MIRT691502 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT691583 CCDC125 coiled-coil domain containing 125 1 1
MIRT691619 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT692079 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT692116 CXorf38 chromosome X open reading frame 38 1 2
MIRT692217 NOL9 nucleolar protein 9 1 1
MIRT692325 RFK riboflavin kinase 1 1
MIRT692387 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT692448 METTL8 methyltransferase like 8 1 1
MIRT692483 APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 1 1
MIRT692551 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692612 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT692793 SYNPO2L synaptopodin 2-like 1 1
MIRT692824 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT692886 RBM41 RNA binding motif protein 41 1 1
MIRT692996 LGSN lengsin, lens protein with glutamine synthetase domain 1 1
MIRT693145 THEM4 thioesterase superfamily member 4 1 1
MIRT693358 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT694118 ZNF446 zinc finger protein 446 1 1
MIRT694202 ZNF347 zinc finger protein 347 1 1
MIRT694668 C14orf119 chromosome 14 open reading frame 119 1 1
MIRT694822 STX4 syntaxin 4 1 1
MIRT694944 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT695188 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT695314 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT695668 MAN2B2 mannosidase, alpha, class 2B, member 2 1 1
MIRT695841 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT695933 ZNF174 zinc finger protein 174 1 1
MIRT695980 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT696191 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT696452 SUGP1 SURP and G patch domain containing 1 1 1
MIRT696868 UBOX5 U-box domain containing 5 1 1
MIRT696915 C14orf105 chromosome 14 open reading frame 105 1 1
MIRT697255 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697399 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT697993 TSPAN6 tetraspanin 6 1 1
MIRT698339 TMEM127 transmembrane protein 127 1 1
MIRT699279 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT699326 SLC35F5 solute carrier family 35, member F5 1 2
MIRT699642 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT699704 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT700053 RPL14 ribosomal protein L14 1 1
MIRT700111 RNF19B ring finger protein 19B 1 1
MIRT701119 PAPD5 PAP associated domain containing 5 1 1
MIRT701303 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT701584 MYPN myopalladin 1 1
MIRT702534 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT703100 GPRIN3 GPRIN family member 3 1 1
MIRT704119 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT704154 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT704206 LDHD lactate dehydrogenase D 1 1
MIRT704472 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT704772 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT705093 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT705358 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT706114 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT706320 CCDC30 coiled-coil domain containing 30 1 1
MIRT706360 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT706412 HAS2 hyaluronan synthase 2 1 1
MIRT706443 LIAS lipoic acid synthetase 1 1
MIRT706523 MTMR9 myotubularin related protein 9 1 1
MIRT707597 PCNXL2 pecanex-like 2 (Drosophila) 1 1
MIRT708379 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT708457 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT709081 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT709546 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT709628 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT714315 ZNF454 zinc finger protein 454 1 1
MIRT715606 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT716549 GOLGA2 golgin A2 1 1
MIRT717812 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT719081 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*