Accession ID: MIRT004074 [miRNA, hsa-miR-373-3p :: CNOT6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-373LinkOut: [miRBase ]
Synonyms MIRN373, hsa-mir-373, miRNA373, MIR373
Description Homo sapiens miR-373 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-373-3p
Mature Sequence 44| GAAGUGCUUCGAUUUUGGGGUGU |66
Evidence Experimental
Experiments Cloned
Putative hsa-miR-373-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CNOT6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CCR4, KIAA1194
Description CCR4-NOT transcription complex, subunit 6
Transcript NM_0154    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CNOT6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CNOT6
(miRNA target sites are highlighted)
>CNOT6|NM_0154|3'UTR
   1 TAGTCAAGCACCTTCAGAGGACAGCCTTGATTCACTTGTAAACTTGTGAAAATCTGAACATAGGGGAGTGAGGTATGGCC
  81 ACTGAGGATTTTTGCTTGCTTAAGAATGATTTGGACTTTCAATCTGATTATTTGATAAGGATATAGTATGAAAGCCAGGT
 161 GCTAGCAACAGACAAATTCTGAGCCCAATATGCTTTATACTGCTAGACAGGGATTGGTGTGTTTGCACCTGTCTTTCATT
 241 TGTCATAAGAGATTTTCCTATTTCTTCTACCCAATAGAATATTTTCATGCCTGGAAATAGGAAAATGTGTGAACAGCGTA
 321 TTCTCTTCACACAGAAATCTGTAGCACTGCTTTTTTGAGGCCAGTAGCAACATCCAGAGATCATTCTTCCATACTTTACT
 401 CCCTCCTTTTTCAGACTTGTTTGTAAAGTACAGAATCTGAATTTAGCCTTTATGATTGTATATGATCCACAGAAGACCTG
 481 ATTTATGAAATTTTGTACTAAAATCATTTGGAAATGATTGTATTGTAAACTGAGGCTAAATTTTTTTTTAAACCTGTTTC
 561 ATGTGTTATAAAGGCCAGCTTGTAAAAGAAGCTGCAACAGACTTTCTCTGCTCATGATTTGCACTCTTAGGGTTTTGTTA
 641 GCCCTTTTGTACTACTTTCTTTTTAAATTGAGAACATGGTTCTTTACATATAAATCTGCTTCAACCTTAGGATGTTTTCA
 721 GACCAGAGGCAACTTATTCATGAATTTTTATGAAAACTATCTACTAGGACAGATAAGCTGAACAGTGATGATCTGTAGAC
 801 ATTTATGGACTGAATGTAATGGTTGATATATGTACATTCTGATATTTTTAAATCTTTAACTTTTTAAAGTTAAAAACCTA
 881 CAGCTGCTTAGGTCCAGCTTCTTAACTCTTTTTGAGACACTTCCTGTCCTATCTCCACTGTGCCTGCCTAAATTTGTTCT
 961 CACCAAGCACTGCCTGTGCATGCAGAGAAAATCTGTGCATCCTCTTTTATATTTTTAAAATACTGTTTAACATTTGTGAG
1041 AATTTTATGAAAATGCTTTTGTATGAGCTGTGGCTTTTTCCCATTGTGAAGCATTGAATATCACATTTTGGAACATGTTA
1121 TAGGGTGAGTCCCTGGATCTTTGCTCACCAGATCCAAGCACTGCTTCTCGGTGTCATTGCAGTGTGCTGCTTGTCACCCA
1201 GAATACTACTATCATGTGAATTCTTTTTGTCGTCAGTGTCTTTTCCTTAGTCTTTTTGTTGTTGTTGTTGTTGTTGTTTT
1281 AATCATTCCTTTTTTAAGAAGAAGTAATTTTCCATTTATGAAGCAGTATGAATTAGATGTATTTTCAAAACAGGTCCCTA
1361 AGACAATTCTTCAGATCATTTTTAAAATGACTAAGTCATTTTAGTATGTCAAGCAAGATAAAAATTACATCATACCGTCT
1441 ATTTTGCCCATAGTGCCATTTAGAGATGAAAACCAGCTTTAACTTTGCAAAGTGAACATGTACATGGTCTGCTCTCATTT
1521 ATTCATTCTTCTCTCAAAAGTCAAATGAATGCAGAGGGAGCTTGGTCAAACTGCTTTTGTTTCAACTGCAGGCAGGGGAG
1601 CAAAAGGACGCCATGTGAGCATTAGGAAAAAAAATACTCACTCTTACTAACAATTTTTATACAGAAAATGAGTCATTTTG
1681 GAAATGATTCTTATGTTTTTTTTTTTTCTCCTTTTAGAAAATTCTCCAAAAGGTTTTGATGTTGAATCTTGGTCTTGGAC
1761 CTGTTTTTTCCTTTGAGGGTTTTTTGTTTTTTGTTTTTTCTAGGATTTCATTGTGATGTTTTGGTTTTGTTTTTTGCTTT
1841 TTGTTTAAGTTGTGCTGACACCAAACACATCCAGTTTATAATCAGTACATTGGAAAGCTGGTATTGATGTAGAACCAGTG
1921 CATAACTTTTTATGGGGTTTTGTTATTGGTTTTTTTTTGTAAAGTGTGAATAAAAGGTATGTTTACTCATTTTTCCTGAA
2001 CACTGTGTTGGTAATGTGCATCATGACAATTTCCAGTGAAGGTGAGCTGGAGCTGGTTGGACTAATGAGACTGAGGAAGC
2081 AGCTTTTCCTACGATCTGCATTATGTAATCACAGGTCCAGAGAGCTTTATGGAAGCGGGAGAGGAGGAGCACTTACTCAT
2161 GTTGTATTTGTTAATGGAGGATGTCATCTTTTCATAGATGCTGGAACTAGAGTGCACTTGTTAGATGCTAAAGGTTTGAG
2241 CTTTACACAAAATGTCTTCATCTGTATTTGTTATTGTCTACAATATATTTGAATTTGGGGCAGCATATTAAGATGTAATG
2321 GCCTGTTATGTCTTGAAAATACTTGTTTTGCCTCTTCCAGGCATACTGCATTCTGTGGATCAGTTTGAACAGCTTCTCCA
2401 CCTTATTTGGACAGTGATAAATTGAACCAAGAGTGTAGATTTACAAGTGTAACCTTCAAAAGAGGAAGAACTATTTGGGG
2481 TCTGTAGGTAATGAACAGTCACACCAAAATAGACTATGATGCTTTTGTTAAGAAAGGTTTCATGTTTTAGATATTTTCCG
2561 TGTCCTAAATAATTTTCAATAATCTATAATCCCTAAAATGCAATAAAAACTAGTATGTTTTCACGGTGTATATTTTTTTT
2641 CAAAAATTCTGTAACAAATATATTTAATGTGTTGCCATAATGTCATTTCAGTATTTTTGCTGGATAAATCCATTTTAGAA
2721 ATGTCTTACAAAAAGTTTAGGGCATGTTTTCTGTTTTAAAGACCAGAAGTTTGAAGGCACCCAAATCCTTGTCGCCAATC
2801 TCCTGAAGTACAGCTTTACCATATTAGTGGTCATTATTTATGCTTTGAGAGTTTCAATATTGTTCGTCAAGTTAACTTAT
2881 GGCATAATTTAAGCTAAAGTTGTAGAAATGAATTGTTGAGTGCAACTTTCATAGTCCCAAAGATAGGCAGAGAACATCTC
2961 CAGAAATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTAATATGATTTAGTGACAACCAGGAAAACTTACTTGGGAT
3041 TATTAGCACTTTCAAACTTAGGGACATTATTAAATTGGATGGAATGCACTTCTAAATGTTTAAATTAAAATTTCAAAGCT
3121 CTTTCGAGATTCAGGTTCTCAATAATAATATTCAAGTTTTAGAGTTTCACTTTGTACTATTTAAATTTATGGAACTAGTT
3201 TCCATACTGACTTGTAAGGTTTTGGGGTCATATATAAGGACTAAAGCCAAGCTAGGCAAAACAATGACAGCACCGTTTTT
3281 TCAGTGAAGCTCTCAGAATGTCCAGTACAGATGTTGCAGATAATTCCAAGAACTCCTTCAGCAGGTGTTCTTCACCATTC
3361 GTAAACAGTATTTTAAGATGTTCACTTTGCTCTTCTTTTTGGTTACATACATTTTAATAACTGGTATGTTGAAGTAGTGT
3441 CTAAAAGTATCTAGTCTTTATTCACAGTACATTATATTGTGTGATGCACTGGACTAACTCTTGTTTACCATTCATGTAAC
3521 AAAACCCAGCACATTATCTGCACTATAAGCTCAAAGAATGTCACATCCGCCCAGACAGCTCTTTGATGAGGGTGATGGGA
3601 ACTGAATAAACCATACGGACTGGCAGTAACAAGGGCTTTTACTGTTCTGTTCAGTGGAACCTTCTTGGTCAAATTGTAAT
3681 TAGCTAGCATTATATTTATATACAGGGTCTTTTTTCTTTACCGATGTATTTTCCTACTCATAGCCAACCAATAAATTCAG
3761 TATCTGTTTCAAATATTTTAGAAGTGTAGTTTGTATAGCTGTAGTACTGAGGTTTGAGGAAAAATAAATGTTGATCAGCA
3841 GACCACGTATTTAAAATTCTGAATCTTCTGGGACAGGGTTGTAACTCAGCCTTCCAAAGGGAAGAGTGCAGGGGGACGGG
3921 GCCATGATATGGGGAAATGGTGTAAACTAATGTATTTCTTTATTGGCTGTTATTCTGTATAACACTCATATCTTTGCCAA
4001 AGTTCAATTTTATATTTAGGCAACTGATGGTCCTTTTGCATTTAGGATTTTCGTTGTTGTTACCTTATACCTCATGATAT
4081 AAGGAATGGGCTCATGTGTCTTCCGTCTTTTGGAAGGAGGTTGACATATTTTAAATAAATGCTTTTAAATACAGTAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uguggggUUUUAGCUUCGUGAAg 5'
                 |:|:  |:||||||| 
Target 5' aagcgggAGAGGAGGAGCACTTa 3'
2133 - 2155 152.00 -13.80
2
miRNA  3' ugUGGGGUUUUAG-CUUCGUGAag 5'
            || | :||||| | ||||||  
Target 5' tcACACAGAAATCTGTAGCACTgc 3'
327 - 350 149.00 -15.40
3
miRNA  3' ugUGGG-GUUUUAGCUUCGUGAag 5'
            :|:| | |:||| |||||||  
Target 5' ttGCTCACCAGATCCAAGCACTgc 3'
1141 - 1164 149.00 -16.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-373-3p :: CNOT6    [ Functional MTI ]
Validation Method Microarray , Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... Filtering the expression profiles for genes characterized by the LocusLink database12 that were significantly downregulated (P < 0.001) at both 12 and 24 h, gave sets of 96 and 174 annotated genes downregulated by miR-1 and miR-124, respectively (Supplementary Tables 1 and 2).//{These MTI shown in Supplementary Table 1,2,4} ...

- Lim, L. P. Lau, N. C. Garrett-Engele, P. et al., 2005, Nature.

Article - Lim, L. P. Lau, N. C. Garrett-Engele, P. et al.
- Nature, 2005
MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression in plants and animals. To investigate the influence of miRNAs on transcript levels, we transfected miRNAs into human cells and used microarrays to examine changes in the messenger RNA profile. Here we show that delivering miR-124 causes the expression profile to shift towards that of brain, the organ in which miR-124 is preferentially expressed, whereas delivering miR-1 shifts the profile towards that of muscle, where miR-1 is preferentially expressed. In each case, about 100 messages were downregulated after 12 h. The 3' untranslated regions of these messages had a significant propensity to pair to the 5' region of the miRNA, as expected if many of these messages are the direct targets of the miRNAs. Our results suggest that metazoan miRNAs can reduce the levels of many of their target transcripts, not just the amount of protein deriving from these transcripts. Moreover, miR-1 and miR-124, and presumably other tissue-specific miRNAs, seem to downregulate a far greater number of targets than previously appreciated, thereby helping to define tissue-specific gene expression in humans.
LinkOut: [PMID: 15685193]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
82 hsa-miR-373-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000056 RAD23B RAD23 homolog B (S. cerevisiae) 4 2
MIRT000606 RECK reversion-inducing-cysteine-rich protein with kazal motifs 4 1
MIRT000721 VEGFA vascular endothelial growth factor A 2 2
MIRT001754 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 5 5
MIRT001931 CSDC2 cold shock domain containing C2, RNA binding 2 1
MIRT002428 CD44 CD44 molecule (Indian blood group) 4 4
MIRT002495 KIF23 kinesin family member 23 2 1
MIRT002496 GBAS glioblastoma amplified sequence 2 1
MIRT002498 C2orf18 chromosome 2 open reading frame 18 2 1
MIRT002500 PHC2 polyhomeotic homolog 2 (Drosophila) 2 1
MIRT002501 CD24 CD24 molecule 2 1
MIRT002504 NUPL1 nucleoporin like 1 2 1
MIRT002505 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT002506 KLHL12 kelch-like 12 (Drosophila) 2 1
MIRT002508 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 2 1
MIRT002509 LUC7L2 LUC7-like 2 (S. cerevisiae) 2 1
MIRT002510 LMNB1 lamin B1 2 1
MIRT002511 MKRN1 makorin ring finger protein 1 2 1
MIRT002512 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 2 1
MIRT002515 FYCO1 FYVE and coiled-coil domain containing 1 2 1
MIRT002516 CD83 CD83 molecule 2 1
MIRT002517 GBP3 guanylate binding protein 3 2 1
MIRT002520 RNF149 ring finger protein 149 2 1
MIRT002521 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 2 1
MIRT002522 STX11 syntaxin 11 2 1
MIRT002523 FITM2 fat storage-inducing transmembrane protein 2 2 1
MIRT002524 GPSM2 G-protein signaling modulator 2 (AGS3-like, C. elegans) 2 1
MIRT002525 CENPF centromere protein F, 350/400ka (mitosin) 2 1
MIRT002526 CFL2 cofilin 2 (muscle) 2 1
MIRT002528 TUSC2 tumor suppressor candidate 2 2 1
MIRT002529 INSIG2 insulin induced gene 2 2 1
MIRT002530 GLTP glycolipid transfer protein 2 1
MIRT002531 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 2 1
MIRT002532 PRC1 protein regulator of cytokinesis 1 2 1
MIRT002533 BAZ1A bromodomain adjacent to zinc finger domain, 1A 2 1
MIRT002534 USP12 ubiquitin specific peptidase 12 2 1
MIRT002535 NIN ninein (GSK3B interacting protein) 2 1
MIRT002537 TBC1D2 TBC1 domain family, member 2 2 1
MIRT002538 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 2 1
MIRT002540 TMEM14A transmembrane protein 14A 2 1
MIRT002541 STK4 serine/threonine kinase 4 2 1
MIRT002542 ZNF226 zinc finger protein 226 2 1
MIRT002543 HSPA14 heat shock 70kDa protein 14 2 1
MIRT002544 KIAA1919 KIAA1919 2 1
MIRT002545 SLC25A23 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 2 1
MIRT002548 C9orf78 chromosome 9 open reading frame 78 2 1
MIRT002552 KDM1B lysine (K)-specific demethylase 1B 2 1
MIRT002554 MED28 mediator complex subunit 28 2 1
MIRT002555 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 2 1
MIRT002556 TTC8 tetratricopeptide repeat domain 8 2 1
MIRT002558 ZHX1 zinc fingers and homeoboxes 1 2 1
MIRT002559 RPIA ribose 5-phosphate isomerase A 2 1
MIRT003815 PCGF5 polycomb group ring finger 5 2 1
MIRT003816 PDIK1L PDLIM1 interacting kinase 1 like 2 1
MIRT003817 UBXN1 UBX domain protein 1 2 1
MIRT003832 CDK19 cyclin-dependent kinase 19 2 1
MIRT003843 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 2 1
MIRT003846 TMEM9B TMEM9 domain family, member B 2 1
MIRT003914 RAD52 RAD52 homolog (S. cerevisiae) 4 1
MIRT003918 XPA xeroderma pigmentosum, complementation group A 2 1
MIRT003919 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 2 1
MIRT003942 PACRGL PARK2 co-regulated-like 2 1
MIRT003943 TEX30 chromosome 13 open reading frame 27 2 1
MIRT003944 C12orf23 chromosome 12 open reading frame 23 2 1
MIRT003948 ANKRD13B ankyrin repeat domain 13B 2 1
MIRT004073 MARCH4 membrane-associated ring finger (C3HC4) 4 2 1
MIRT004074 CNOT6 CCR4-NOT transcription complex, subunit 6 2 1
MIRT004438 CYB5R4 cytochrome b5 reductase 4 2 1
MIRT004448 VPS26A vacuolar protein sorting 26 homolog A (S. pombe) 2 1
MIRT004449 PBK PDZ binding kinase 2 1
MIRT004468 FAM13B family with sequence similarity 13, member B 2 1
MIRT004515 SEPT2 septin 2 2 1
MIRT005561 TXNIP thioredoxin interacting protein 4 1
MIRT005562 RABEP1 rabaptin, RAB GTPase binding effector protein 1 4 1
MIRT006016 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 1
MIRT006021 MBD2 methyl-CpG binding domain protein 2 3 1
MIRT006022 RASSF1 Ras association (RalGDS/AF-6) domain family member 1 3 1
MIRT006157 MTOR mechanistic target of rapamycin (serine/threonine kinase) 3 1
MIRT006158 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 3 1
MIRT006735 NFIB nuclear factor I/B 4 1
MIRT020072 CD24P4 CD24 molecule-like 4 pseudogene 1 1
MIRT035565 ANKRD52 ankyrin repeat domain 52 1 1