Accession ID: MIRT004114 [miRNA, hsa-miR-661 :: VCL, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-661LinkOut: [miRBase ]
Synonyms MIRN661, hsa-mir-661, MIR661
Description Homo sapiens miR-661 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-661
Mature Sequence 51| UGCCUGGGUCUCUGGCCUGCGCGU |74
Evidence Experimental
Experiments SAGE
Putative hsa-miR-661 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol VCL LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CMD1W, CMH15, MVCL
Description vinculin
Transcript NM_003373    LinkOut: [ RefSeq ]
Other Transcripts NM_014000   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on VCL LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of VCL
(miRNA target sites are highlighted)
>VCL|NM_003373|3'UTR
   1 GCACCTGGCTGAGCCTGGCTGGCACAGAAACCTCTACTAAAAAGAAGGAAAATGATCTGAGTCCCAGGAGCTGCCCAGAG
  81 TTGCTGGGAGCTGAAAAATCACATCCTGGCCTGGCACATCAGAAAGGAATGGGGGCCTCTTCAAATTAGAAGACATTTAT
 161 ACTCTTTTTTCATGGACACTTTGAAATGTGTTTCTGTATAAAGCCTGTATTCTCAAACACAGTTACACTTGTGCACCCTC
 241 TATCCCAATAGGCAGACTGGGTTTCTAGCCCATGGACTTCACATAAGCTCAGAATCCAAGTGAACACTAGCCAGACACTC
 321 TGCTCTGCCCTTGTTCCCTAGGGGACACTTCCCTCTGTTTCTCTTTCCTTGGCTCCCATTCACTCTTCCAGAATCCCAAG
 401 ACCCAGGGCCCAGGCAAATCAGTTACTAAGAAGAAAATTGCTGTGCCTCCCAAAATTGTTTTGAGCTTTCCATGTTGCTG
 481 CCAACCATACCTTCCTTCCCTGGGCTGTGCTACCTGGGTCCTTTTCAGAAGTGAGCTTTGCTGCTACAGGGGAAGGTGGC
 561 CTCTGTGGAGCCCCAGCATATGGGGGCCTGGATTCATTTCCTGCCCTTCCTCAGTTTAATCCTTCTAGTTTCCCACAATA
 641 TAAAACTGTACTTCACTGTCAGGAAGAAATCACAGAATCATATGATTCTGCTTTTACCATGCCCCTGAGCAATGTCTGTG
 721 CTAGGGAAACTTCCCGTCCCATATCCTGCCTCAGCCCGCCAAGGTAGCCATCCCATGAACACACTGTGTCCTGGTGCTCT
 801 CTGCCACTGGAAGGGCAGAGTAGCCAGGGTGTGGCCCTGCCATCTTCCCAGCAGGGCCACTCCCGGCACTCCATGCTTAG
 881 TCACTGCCTGCAGAGGTCTGTGCTGAGGCCTTATCATTCATTCTTAGCTCTTAATTGTTCATTTTGAGCTGAAATGCTGC
 961 ATTTTAATTTTAACCAAAACATGTCTCCTATCCTGGTTTTTGTAGCCTTCCTCCACATCCTTTCTAAACAAGATTTTAAA
1041 GACATGTAGGTGTTTGTTCATCTGTAACTCTAAAAGATCCTTTTTAAATTCAGTCCTAAGAAAGAGGAGTGCTTGTCCCC
1121 TAAGAGTGTTTAATGGCAAGGCAGCCCTGTCTGAAGGACACTTCCTGCCTAAGGGAGAGTGGTATTTGCAGACTAGAATT
1201 CTAGTGCTGCTGAAGATGAATCAATGGGAAATACTACTCCTGTAATTCCTACCTCCCTGCAACCAACTACAACCAAGCTC
1281 TCTGCATCTACTCCCAAGTATGGGGTTCAAGAGAGTAATGGGTTTCATATTTCTTATCACCACAGTAAGTTCCTACTAGG
1361 CAAAATGAGAGGGCAGTGTTTCCTTTTTGGTACTTATTACTGCTAAGTATTTCCCAGCACATGAAACCTTATTTTTTCCC
1441 AAAGCCAGAACCAGATGAGTAAAGGAGTAAGAACCTTGCCTGAACATCCTTCCTTCCCACCCATCGCTGTGTGTTAGTTC
1521 CCAACATCGAATGTGTACAACTTAAGTTGGTCCTTTACACTCAGGCTTTCACTATTTCCTTTATAATGAGGATGATTATT
1601 TTCAAGGCCCTCAGCATATTTGTATAGTTGCTTGCCTGATATAAATGCAATATTAATGCCTTTAAAGTATGAATCTATGC
1681 CAAAGATCACTTGTTGTTTTACTAAAGAAAGATTACTTAGAGGAAATAAGAAAAATCATGTTTGCTCTCCCGGTTCTTCC
1761 AGTGGTTTGAGACACTGGTTTACACTTTATGCCGGATGTGCTTTTCTCCAATATCAGTGCTCGAGACACAGTGAAGCAAA
1841 TTAAAAAAAAAAAAAAAAAAAATCCCTGAATGATGATTAGAGACATCACCGCTAAAAAACTACATTTATAAGCTAGGATT
1921 TGTTATATGCAAATATTTTCTGCCTCTTCTTTTGTTCTGTTTAAAACAATAAAATGCATTTGTATAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugcGCGUCC--GGUCUCUGGGUCCGu 5'
             | || |  |||| |:||||||| 
Target 5' aatCCCAAGACCCAG-GGCCCAGGCa 3'
392 - 416 162.00 -25.90
2
miRNA  3' ugcgcguCCGGUCUCUGGGUCCgu 5'
                 | :| ||| ||||||  
Target 5' ggaaaatGATCTGAGTCCCAGGag 3'
47 - 70 137.00 -17.50
3
miRNA  3' ugcgCGUCC--GGUCUCUGGGUCCGu 5'
              |: ||  |:  | ||:||||| 
Target 5' ttaaGTTGGTCCTTTACACTCAGGCt 3'
1542 - 1567 134.00 -15.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-661 :: VCL    [ Functional MTI ]
Validation Method Western blot , Other
Conditions ZR75 , MCF-7 , HeLa , MDA-MB-231
Location of target site 3'UTR
Original Description (Extracted from the article) ... To assess the effects of these miRs on MTA1 expression, we transfected human cancer cell lines with miR-559 or miR-661 or a negative control (designated con-miR) and MTA1 protein levels were determined by Western blot analysis. Both miRs inhibited the expression level of MTA1 but not MTA2 or vinculin. (Fig. 1B). ...

- Reddy, S. D. Pakala, S. B. Ohshiro, K. et al., 2009, Cancer Res.

Article - Reddy, S. D. Pakala, S. B. Ohshiro, K. et al.
- Cancer Res, 2009
MicroRNAs (miR) have been identified as posttranscriptional modifiers of target gene regulation and control the expression of gene products important in cancer progression. Here, we show that miR-661 inhibits the expression of metastatic tumor antigen 1 (MTA1), a widely up-regulated gene product in human cancer, by targeting the 3' untranslated region (UTR) of MTA1 mRNA. We found that endogenous miR-661 expression was positively regulated by the c/EBPalpha transcription factor, which is down-regulated during cancer progression. c/EBPalpha directly interacted with the miR-661 chromatin and bound to miR-661 putative promoter that contains a c/EBPalpha-consensus motif. In addition, we found that the level of MTA1 protein was progressively up-regulated, whereas that of miR-661 and its activator, c/EBPalpha, were down-regulated in a breast cancer progression model consisting of MCF-10A cell lines whose phenotypes ranged from noninvasive to highly invasive. c/EBPalpha expression in breast cancer cells resulted in increased miR-661 expression and reduced MTA1 3'UTR-luciferase activity and MTA1 protein level. We also provide evidence that the introduction of miR-661 inhibited the motility, invasiveness, anchorage-independent growth, and tumorigenicity of invasive breast cancer cells. We believe our findings show for the first time that c/EBPalpha regulates the level of miR-661 and in turn modifies the functions of the miR661-MTA1 pathway in human cancer cells. Based on these findings, we suggest that miR-661 be further investigated for therapeutic use in down-regulating the expression of MTA1 in cancer cells.
LinkOut: [PMID: 19584269]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
330 hsa-miR-661 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000033 MTA1 metastasis associated 1 3 2
MIRT003632 STARD10 StAR-related lipid transfer (START) domain containing 10 2 1
MIRT004114 VCL vinculin 2 1
MIRT004117 MTA2 metastasis associated 1 family, member 2 2 1
MIRT004550 PVRL1 poliovirus receptor-related 1 (herpesvirus entry mediator C) 2 1
MIRT004743 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 3 1
MIRT086186 CDCA7 cell division cycle associated 7 1 2
MIRT114932 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT237526 GNL3 guanine nucleotide binding protein-like 3 (nucleolar) 1 2
MIRT307406 ABHD5 abhydrolase domain containing 5 1 2
MIRT364612 TBC1D13 TBC1 domain family, member 13 1 1
MIRT372949 SRGN serglycin 1 1
MIRT438538 MDM4 Mdm4 p53 binding protein homolog (mouse) 2 1
MIRT438539 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 3 2
MIRT438835 MGMT O-6-methylguanine-DNA methyltransferase 1 1
MIRT441987 TSTD2 thiosulfate sulfurtransferase (rhodanese)-like domain containing 2 1 1
MIRT442699 ZNF646 zinc finger protein 646 1 2
MIRT446922 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT452574 ZFP69B zinc finger protein 643 1 1
MIRT454095 TMEM209 transmembrane protein 209 1 1
MIRT458140 TLCD2 TLC domain containing 2 1 1
MIRT458171 LYRM4 LYR motif containing 4 1 2
MIRT458243 SLC9A7 solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 1 1
MIRT460296 MRPS17 mitochondrial ribosomal protein S17 1 1
MIRT461083 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT463384 ZER1 zer-1 homolog (C. elegans) 1 1
MIRT470129 PSMF1 proteasome (prosome, macropain) inhibitor subunit 1 (PI31) 1 1
MIRT470690 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT471829 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT475222 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT475666 HIC2 hypermethylated in cancer 2 1 1
MIRT478849 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT480289 C7orf73 chromosome 7 open reading frame 73 1 2
MIRT480756 BMP3 bone morphogenetic protein 3 1 2
MIRT481174 AVL9 AVL9 homolog (S. cerevisiase) 1 3
MIRT485695 CCDC64 coiled-coil domain containing 64 1 2
MIRT486317 SIPA1 signal-induced proliferation-associated 1 1 1
MIRT487779 GPR153 G protein-coupled receptor 153 1 1
MIRT487869 NKX2-2 NK2 homeobox 2 1 1
MIRT491208 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 2
MIRT496482 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif, 17 1 1
MIRT498393 KIF6 kinesin family member 6 1 1
MIRT498408 TXNDC16 thioredoxin domain containing 16 1 2
MIRT499695 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 4
MIRT505025 ZNF460 zinc finger protein 460 1 3
MIRT505119 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT507927 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT510463 ZDHHC18 zinc finger, DHHC-type containing 18 1 1
MIRT512213 C18orf25 chromosome 18 open reading frame 25 1 3
MIRT512611 CNTN4 contactin 4 1 1
MIRT514411 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT514447 ZNF865 zinc finger protein 865 1 4
MIRT514729 EIF3F eukaryotic translation initiation factor 3, subunit F 1 1
MIRT514905 DMKN dermokine 1 2
MIRT514949 CD36 CD36 molecule (thrombospondin receptor) 1 1
MIRT515531 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT515679 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT515746 ONECUT3 one cut homeobox 3 1 1
MIRT516067 RAB42 RAB42, member RAS oncogene family 1 1
MIRT516167 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT516302 F8A2 coagulation factor VIII-associated 2 1 1
MIRT516328 F8A3 coagulation factor VIII-associated 3 1 1
MIRT516392 NPR1 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) 1 1
MIRT516617 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT516632 ZNF277 zinc finger protein 277 1 2
MIRT516815 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT516952 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT517033 RNF222 ring finger protein 222 1 1
MIRT517063 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT517118 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT517577 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT517686 FAM175A family with sequence similarity 175, member A 1 1
MIRT517807 UGDH UDP-glucose 6-dehydrogenase 1 3
MIRT517834 CLK4 CDC-like kinase 4 1 1
MIRT517908 ANKRD62 ankyrin repeat domain 62 1 1
MIRT518138 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT518228 C7orf55 chromosome 7 open reading frame 55 1 1
MIRT518642 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT518741 C1orf35 chromosome 1 open reading frame 35 1 1
MIRT519061 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT519292 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT520580 TMEM59 transmembrane protein 59 1 1
MIRT520913 ST13 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) 1 1
MIRT522239 NPFFR1 neuropeptide FF receptor 1 1 1
MIRT522301 NKAP NFKB activating protein 1 1
MIRT522670 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 1 2
MIRT522700 LSM11 LSM11, U7 small nuclear RNA associated 1 1
MIRT524003 DSTYK dual serine/threonine and tyrosine protein kinase 1 2
MIRT524319 CRLF3 cytokine receptor-like factor 3 1 2
MIRT524487 CEP97 centrosomal protein 97kDa 1 1
MIRT525166 CLPP ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) 1 1
MIRT527338 COL18A1 collagen, type XVIII, alpha 1 1 1
MIRT527698 IL17REL interleukin 17 receptor E-like 1 1
MIRT539590 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT539668 ZBTB44 zinc finger and BTB domain containing 44 1 1
MIRT539702 EIF3H eukaryotic translation initiation factor 3, subunit H 1 1
MIRT539725 DNAH10OS dynein, axonemal, heavy chain 10 opposite strand 1 1
MIRT539783 EMC1 ER membrane protein complex subunit 1 1 2
MIRT539805 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT539846 ZNF766 zinc finger protein 766 1 1
MIRT539987 SLC24A4 solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 1 1
MIRT540069 SSH3 slingshot homolog 3 (Drosophila) 1 1
MIRT540086 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT540319 PIGR polymeric immunoglobulin receptor 1 1
MIRT540421 FAM83F family with sequence similarity 83, member F 1 1
MIRT540505 CXCL10 chemokine (C-X-C motif) ligand 10 1 1
MIRT540528 ZNF417 zinc finger protein 417 1 1
MIRT540618 F2RL2 coagulation factor II (thrombin) receptor-like 2 1 1
MIRT540906 PON1 paraoxonase 1 1 1
MIRT541505 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT541542 HIATL2 hippocampus abundant transcript-like 2 1 1
MIRT541565 ZNF43 zinc finger protein 43 1 2
MIRT541628 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT541660 ATP8B3 ATPase, aminophospholipid transporter, class I, type 8B, member 3 1 1
MIRT541732 ZC3HAV1 zinc finger CCCH-type, antiviral 1 1 1
MIRT541785 TBCCD1 TBCC domain containing 1 1 1
MIRT541809 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT541900 VWA7 von Willebrand factor A domain containing 7 1 1
MIRT541922 ORC1 origin recognition complex, subunit 1 1 2
MIRT541955 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT542001 XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 1
MIRT542015 PEX2 peroxisomal biogenesis factor 2 1 1
MIRT542183 FUT1 fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) 1 3
MIRT542200 C14orf142 chromosome 14 open reading frame 142 1 1
MIRT542230 FUT9 fucosyltransferase 9 (alpha (1,3) fucosyltransferase) 1 1
MIRT542283 POLR3K polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa 1 1
MIRT542297 QTRTD1 queuine tRNA-ribosyltransferase domain containing 1 1 2
MIRT542318 SERPING1 serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 1 1
MIRT542331 LIMD1 LIM domains containing 1 1 2
MIRT542365 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT542422 ZNF331 zinc finger protein 331 1 1
MIRT542440 C3 complement component 3 1 1
MIRT542453 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT542473 APOC3 apolipoprotein C-III 1 1
MIRT542488 WDR13 WD repeat domain 13 1 1
MIRT542519 PTK6 PTK6 protein tyrosine kinase 6 1 1
MIRT542532 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT542564 ZNF280B zinc finger protein 280B 1 1
MIRT542638 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT542696 RPS15A ribosomal protein S15a 1 1
MIRT542746 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 2
MIRT542786 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT542815 PDE12 phosphodiesterase 12 1 1
MIRT543966 RNF20 ring finger protein 20, E3 ubiquitin protein ligase 1 1
MIRT544255 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT549987 ZNF695 zinc finger protein 695 1 2
MIRT551564 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT552266 RAB3D RAB3D, member RAS oncogene family 1 1
MIRT553522 TMEM245 transmembrane protein 245 1 1
MIRT554127 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT563447 ISCA1 iron-sulfur cluster assembly 1 homolog (S. cerevisiae) 1 1
MIRT573177 P2RX3 purinergic receptor P2X, ligand-gated ion channel, 3 1 1
MIRT574935 Tbc1d13 TBC1 domain family, member 13 1 1
MIRT607387 LANCL3 LanC lantibiotic synthetase component C-like 3 (bacterial) 1 1
MIRT607449 ZNF543 zinc finger protein 543 1 1
MIRT607577 TANGO2 chromosome 22 open reading frame 25 1 1
MIRT607742 ANGPT4 angiopoietin 4 1 1
MIRT607901 SPRYD4 SPRY domain containing 4 1 1
MIRT608697 GMPR guanosine monophosphate reductase 1 1
MIRT614090 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT617042 ZNF610 zinc finger protein 610 1 1
MIRT617574 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT617705 RUSC2 RUN and SH3 domain containing 2 1 1
MIRT622082 SRPX2 sushi-repeat containing protein, X-linked 2 1 1
MIRT622540 PXMP4 peroxisomal membrane protein 4, 24kDa 1 1
MIRT622656 POU2F3 POU class 2 homeobox 3 1 2
MIRT623263 MED28 mediator complex subunit 28 1 2
MIRT623870 FUS fused in sarcoma 1 1
MIRT624835 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT625328 TNFRSF13B tumor necrosis factor receptor superfamily, member 13B 1 1
MIRT628623 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT631717 RNASEH2B ribonuclease H2, subunit B 1 1
MIRT631865 BBS5 Bardet-Biedl syndrome 5 1 1
MIRT631903 VEGFC vascular endothelial growth factor C 1 1
MIRT632262 USP1 ubiquitin specific peptidase 1 1 2
MIRT632306 TMEM65 transmembrane protein 65 1 1
MIRT632872 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT632942 ELOVL6 ELOVL fatty acid elongase 6 1 2
MIRT633984 SLC35E2 solute carrier family 35, member E2 1 1
MIRT635274 GK5 glycerol kinase 5 (putative) 1 1
MIRT635674 COX18 cytochrome c oxidase assembly homolog 18 (yeast) 1 2
MIRT635857 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT636618 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 2
MIRT636810 TBC1D24 TBC1 domain family, member 24 1 1
MIRT637469 DEFB105B defensin, beta 105B 1 2
MIRT637501 DEFB105A defensin, beta 105A 1 2
MIRT637859 SC5D sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like 1 1
MIRT639448 CTNNBL1 catenin, beta like 1 1 1
MIRT639667 PPEF2 protein phosphatase, EF-hand calcium binding domain 2 1 3
MIRT639699 IDE insulin-degrading enzyme 1 1
MIRT640873 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT641011 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT641188 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT641925 SLC25A16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 1 1
MIRT642586 KIAA0101 KIAA0101 1 2
MIRT642851 RNF135 ring finger protein 135 1 1
MIRT643237 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT643371 TRIM16L tripartite motif containing 16-like 1 1
MIRT645568 TACR2 tachykinin receptor 2 1 1
MIRT646927 MCCC2 methylcrotonoyl-CoA carboxylase 2 (beta) 1 1
MIRT647796 FRMD8 FERM domain containing 8 1 1
MIRT648973 ACAD8 acyl-CoA dehydrogenase family, member 8 1 1
MIRT652835 TACO1 translational activator of mitochondrially encoded cytochrome c oxidase I 1 1
MIRT655584 OTUD7B OTU domain containing 7B 1 1
MIRT657399 HM13 histocompatibility (minor) 13 1 2
MIRT657649 GPR75 G protein-coupled receptor 75 1 1
MIRT659355 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT660731 ALG14 asparagine-linked glycosylation 14 homolog (S. cerevisiae) 1 1
MIRT661169 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT661328 TBC1D15 TBC1 domain family, member 15 1 1
MIRT663043 SLC16A4 solute carrier family 16, member 4 (monocarboxylic acid transporter 5) 1 1
MIRT663354 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT663952 ZNF554 zinc finger protein 554 1 1
MIRT665159 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 2
MIRT666543 RNF115 ring finger protein 115 1 1
MIRT667288 MYPN myopalladin 1 2
MIRT667431 METTL8 methyltransferase like 8 1 1
MIRT668016 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT668604 EHD4 EH-domain containing 4 1 1
MIRT669151 CCNG1 cyclin G1 1 1
MIRT669728 ZBTB8B zinc finger and BTB domain containing 8B 1 2
MIRT669845 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT670084 ABCF3 ATP-binding cassette, sub-family F (GCN20), member 3 1 2
MIRT675626 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 1 1
MIRT677910 HIST1H2BN histone cluster 1, H2bn 1 1
MIRT678623 OLFML2A olfactomedin-like 2A 1 1
MIRT678787 NUPL2 nucleoporin like 2 1 1
MIRT679557 LIN9 lin-9 homolog (C. elegans) 1 2
MIRT680897 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT681030 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 1
MIRT681131 INTS7 integrator complex subunit 7 1 1
MIRT681719 KCNE4 potassium voltage-gated channel, Isk-related family, member 4 1 1
MIRT682297 RBM28 RNA binding motif protein 28 1 1
MIRT682404 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT682478 LIX1L Lix1 homolog (mouse)-like 1 2
MIRT682567 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT682699 PSMD9 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 1 1
MIRT682739 CA6 carbonic anhydrase VI 1 1
MIRT682809 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT682840 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT682865 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT682894 XIAP X-linked inhibitor of apoptosis 1 1
MIRT682909 FAM73A family with sequence similarity 73, member A 1 1
MIRT682929 ZNF292 zinc finger protein 292 1 1
MIRT682947 RPL12 ribosomal protein L12 1 1
MIRT682970 NF2 neurofibromin 2 (merlin) 1 1
MIRT683027 SUSD5 sushi domain containing 5 1 1
MIRT683078 A1BG alpha-1-B glycoprotein 1 1
MIRT683103 TIMM10B fracture callus 1 homolog (rat) 1 1
MIRT683428 ZNF878 zinc finger protein 878 1 1
MIRT684253 TBXA2R thromboxane A2 receptor 1 1
MIRT684382 MCTS1 malignant T cell amplified sequence 1 1 1
MIRT684420 TUFT1 tuftelin 1 1 1
MIRT685849 ANGEL1 angel homolog 1 (Drosophila) 1 1
MIRT686478 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686635 TMEM184C transmembrane protein 184C 1 1
MIRT687198 PLXNA3 plexin A3 1 1
MIRT687495 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT688208 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT688883 C3orf70 chromosome 3 open reading frame 70 1 1
MIRT689138 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT689223 RPS19 ribosomal protein S19 1 1
MIRT689301 C5AR2 G protein-coupled receptor 77 1 1
MIRT689359 ZNF101 zinc finger protein 101 1 1
MIRT689651 RBM23 RNA binding motif protein 23 1 1
MIRT690146 PPIL6 peptidylprolyl isomerase (cyclophilin)-like 6 1 1
MIRT690593 C17orf105 chromosome 17 open reading frame 105 1 1
MIRT690623 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT690797 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT690819 SGSM2 small G protein signaling modulator 2 1 1
MIRT691385 ATP13A4 ATPase type 13A4 1 1
MIRT691406 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT692232 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT692411 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT692533 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692911 EXOSC2 exosome component 2 1 1
MIRT693416 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT693436 TPGS1 tubulin polyglutamylase complex subunit 1 1 1
MIRT693459 HIST1H2AG histone cluster 1, H2ag 1 1
MIRT693611 CENPL centromere protein L 1 1
MIRT693753 ZNF383 zinc finger protein 383 1 1
MIRT693997 PPIL4 peptidylprolyl isomerase (cyclophilin)-like 4 1 1
MIRT694317 NLRP9 NLR family, pyrin domain containing 9 1 1
MIRT694342 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT694427 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 1
MIRT694804 STX4 syntaxin 4 1 1
MIRT694923 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT694980 PLAC8 placenta-specific 8 1 1
MIRT695013 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT695869 C19orf52 chromosome 19 open reading frame 52 1 1
MIRT696213 LYZ lysozyme 1 1
MIRT697227 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697795 UBXN2A UBX domain protein 2A 1 1
MIRT697938 TVP23C family with sequence similarity 18, member B2 1 1
MIRT698770 STK4 serine/threonine kinase 4 1 1
MIRT699528 SIX4 SIX homeobox 4 1 1
MIRT702452 KIAA1467 KIAA1467 1 1
MIRT702684 IRGQ immunity-related GTPase family, Q 1 1
MIRT702927 HMX3 H6 family homeobox 3 1 1
MIRT702988 HERPUD2 HERPUD family member 2 1 1
MIRT703718 FAM127A family with sequence similarity 127, member A 1 1
MIRT704292 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT704372 DAND5 DAN domain family, member 5 1 1
MIRT704700 CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 1 1
MIRT704827 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT705445 ATL2 atlastin GTPase 2 1 1
MIRT708434 CPM carboxypeptidase M 1 1
MIRT710216 JMJD4 jumonji domain containing 4 1 1
MIRT710448 BTNL3 butyrophilin-like 3 1 1
MIRT710905 KIAA2018 KIAA2018 1 1
MIRT713154 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT713871 FAM212B family with sequence similarity 212, member B 1 1
MIRT714157 NXPH3 neurexophilin 3 1 1
MIRT714173 PHF7 PHD finger protein 7 1 1
MIRT714504 SHE Src homology 2 domain containing E 1 1
MIRT714767 TERF1 telomeric repeat binding factor (NIMA-interacting) 1 1 1
MIRT715146 EHHADH enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase 1 1
MIRT715259 RNF125 ring finger protein 125, E3 ubiquitin protein ligase 1 1
MIRT715404 STON2 stonin 2 1 1
MIRT716444 TMPRSS11BNL TMPRSS11B N terminal-like 1 1
MIRT718088 ABHD12 abhydrolase domain containing 12 1 1
MIRT718841 SNX20 sorting nexin 20 1 1
MIRT719997 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT720572 SDHAF2 succinate dehydrogenase complex assembly factor 2 1 1
MIRT721227 CRCP CGRP receptor component 1 1
MIRT721257 SH3D19 SH3 domain containing 19 1 1
MIRT721883 TMPRSS6 transmembrane protease, serine 6 1 1
MIRT722904 COA4 cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae) 1 1
MIRT723904 PEX11A peroxisomal biogenesis factor 11 alpha 1 1
MIRT724686 DGCR6L DiGeorge syndrome critical region gene 6-like 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*