Accession ID: MIRT004115 [miRNA, hsa-miR-559 :: VCL, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-559LinkOut: [miRBase ]
Synonyms MIRN559, hsa-mir-559, MIR559
Description Homo sapiens miR-559 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-559
Mature Sequence 16| UAAAGUAAAUAUGCACCAAAA |36
Evidence Experimental
Experiments SAGE
Putative hsa-miR-559 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol VCL LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CMD1W, CMH15, MVCL
Description vinculin
Transcript NM_003373    LinkOut: [ RefSeq ]
Other Transcripts NM_014000   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on VCL LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of VCL
(miRNA target sites are highlighted)
>VCL|NM_003373|3'UTR
   1 GCACCTGGCTGAGCCTGGCTGGCACAGAAACCTCTACTAAAAAGAAGGAAAATGATCTGAGTCCCAGGAGCTGCCCAGAG
  81 TTGCTGGGAGCTGAAAAATCACATCCTGGCCTGGCACATCAGAAAGGAATGGGGGCCTCTTCAAATTAGAAGACATTTAT
 161 ACTCTTTTTTCATGGACACTTTGAAATGTGTTTCTGTATAAAGCCTGTATTCTCAAACACAGTTACACTTGTGCACCCTC
 241 TATCCCAATAGGCAGACTGGGTTTCTAGCCCATGGACTTCACATAAGCTCAGAATCCAAGTGAACACTAGCCAGACACTC
 321 TGCTCTGCCCTTGTTCCCTAGGGGACACTTCCCTCTGTTTCTCTTTCCTTGGCTCCCATTCACTCTTCCAGAATCCCAAG
 401 ACCCAGGGCCCAGGCAAATCAGTTACTAAGAAGAAAATTGCTGTGCCTCCCAAAATTGTTTTGAGCTTTCCATGTTGCTG
 481 CCAACCATACCTTCCTTCCCTGGGCTGTGCTACCTGGGTCCTTTTCAGAAGTGAGCTTTGCTGCTACAGGGGAAGGTGGC
 561 CTCTGTGGAGCCCCAGCATATGGGGGCCTGGATTCATTTCCTGCCCTTCCTCAGTTTAATCCTTCTAGTTTCCCACAATA
 641 TAAAACTGTACTTCACTGTCAGGAAGAAATCACAGAATCATATGATTCTGCTTTTACCATGCCCCTGAGCAATGTCTGTG
 721 CTAGGGAAACTTCCCGTCCCATATCCTGCCTCAGCCCGCCAAGGTAGCCATCCCATGAACACACTGTGTCCTGGTGCTCT
 801 CTGCCACTGGAAGGGCAGAGTAGCCAGGGTGTGGCCCTGCCATCTTCCCAGCAGGGCCACTCCCGGCACTCCATGCTTAG
 881 TCACTGCCTGCAGAGGTCTGTGCTGAGGCCTTATCATTCATTCTTAGCTCTTAATTGTTCATTTTGAGCTGAAATGCTGC
 961 ATTTTAATTTTAACCAAAACATGTCTCCTATCCTGGTTTTTGTAGCCTTCCTCCACATCCTTTCTAAACAAGATTTTAAA
1041 GACATGTAGGTGTTTGTTCATCTGTAACTCTAAAAGATCCTTTTTAAATTCAGTCCTAAGAAAGAGGAGTGCTTGTCCCC
1121 TAAGAGTGTTTAATGGCAAGGCAGCCCTGTCTGAAGGACACTTCCTGCCTAAGGGAGAGTGGTATTTGCAGACTAGAATT
1201 CTAGTGCTGCTGAAGATGAATCAATGGGAAATACTACTCCTGTAATTCCTACCTCCCTGCAACCAACTACAACCAAGCTC
1281 TCTGCATCTACTCCCAAGTATGGGGTTCAAGAGAGTAATGGGTTTCATATTTCTTATCACCACAGTAAGTTCCTACTAGG
1361 CAAAATGAGAGGGCAGTGTTTCCTTTTTGGTACTTATTACTGCTAAGTATTTCCCAGCACATGAAACCTTATTTTTTCCC
1441 AAAGCCAGAACCAGATGAGTAAAGGAGTAAGAACCTTGCCTGAACATCCTTCCTTCCCACCCATCGCTGTGTGTTAGTTC
1521 CCAACATCGAATGTGTACAACTTAAGTTGGTCCTTTACACTCAGGCTTTCACTATTTCCTTTATAATGAGGATGATTATT
1601 TTCAAGGCCCTCAGCATATTTGTATAGTTGCTTGCCTGATATAAATGCAATATTAATGCCTTTAAAGTATGAATCTATGC
1681 CAAAGATCACTTGTTGTTTTACTAAAGAAAGATTACTTAGAGGAAATAAGAAAAATCATGTTTGCTCTCCCGGTTCTTCC
1761 AGTGGTTTGAGACACTGGTTTACACTTTATGCCGGATGTGCTTTTCTCCAATATCAGTGCTCGAGACACAGTGAAGCAAA
1841 TTAAAAAAAAAAAAAAAAAAAATCCCTGAATGATGATTAGAGACATCACCGCTAAAAAACTACATTTATAAGCTAGGATT
1921 TGTTATATGCAAATATTTTCTGCCTCTTCTTTTGTTCTGTTTAAAACAATAAAATGCATTTGTATAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aaaACCACGUAUAAAUGAAAu 5'
             || ||||| |||| ||| 
Target 5' aaaTGCTGCAT-TTTAATTTt 3'
952 - 971 137.00 -6.50
2
miRNA  3' aaaacCACGU-AUAAAUGAAAu 5'
               | ||| |:||| |||| 
Target 5' tgagaGGGCAGTGTTTCCTTTt 3'
1366 - 1387 128.00 -8.50
3
miRNA  3' aaaaccACGUAUAAAUGAAau 5'
                ||:||| ||:|||  
Target 5' catattTGTATAGTTGCTTgc 3'
1615 - 1635 127.00 -6.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-559 :: VCL    [ Functional MTI ]
Validation Method Western blot , Other
Conditions ZR75 , MCF-7 , HeLa , MDA-MB-231
Location of target site 3'UTR
Original Description (Extracted from the article) ... To assess the effects of these miRs on MTA1 expression, we transfected human cancer cell lines with miR-559 or miR-661 or a negative control (designated con-miR) and MTA1 protein levels were determined by Western blot analysis. Both miRs inhibited the expression level of MTA1 but not MTA2 or vinculin. (Fig. 1B). ...

- Reddy, S. D. Pakala, S. B. Ohshiro, K. et al., 2009, Cancer Res.

Article - Reddy, S. D. Pakala, S. B. Ohshiro, K. et al.
- Cancer Res, 2009
MicroRNAs (miR) have been identified as posttranscriptional modifiers of target gene regulation and control the expression of gene products important in cancer progression. Here, we show that miR-661 inhibits the expression of metastatic tumor antigen 1 (MTA1), a widely up-regulated gene product in human cancer, by targeting the 3' untranslated region (UTR) of MTA1 mRNA. We found that endogenous miR-661 expression was positively regulated by the c/EBPalpha transcription factor, which is down-regulated during cancer progression. c/EBPalpha directly interacted with the miR-661 chromatin and bound to miR-661 putative promoter that contains a c/EBPalpha-consensus motif. In addition, we found that the level of MTA1 protein was progressively up-regulated, whereas that of miR-661 and its activator, c/EBPalpha, were down-regulated in a breast cancer progression model consisting of MCF-10A cell lines whose phenotypes ranged from noninvasive to highly invasive. c/EBPalpha expression in breast cancer cells resulted in increased miR-661 expression and reduced MTA1 3'UTR-luciferase activity and MTA1 protein level. We also provide evidence that the introduction of miR-661 inhibited the motility, invasiveness, anchorage-independent growth, and tumorigenicity of invasive breast cancer cells. We believe our findings show for the first time that c/EBPalpha regulates the level of miR-661 and in turn modifies the functions of the miR661-MTA1 pathway in human cancer cells. Based on these findings, we suggest that miR-661 be further investigated for therapeutic use in down-regulating the expression of MTA1 in cancer cells.
LinkOut: [PMID: 19584269]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
189 hsa-miR-559 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000036 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT004115 VCL vinculin 2 1
MIRT004116 MTA2 metastasis associated 1 family, member 2 2 1
MIRT004442 MTA1 metastasis associated 1 3 1
MIRT007228 FXN frataxin 1 1
MIRT057116 DDIT4 DNA-damage-inducible transcript 4 1 2
MIRT063357 ETNK1 ethanolamine kinase 1 1 1
MIRT072484 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT082176 ACTN4 actinin, alpha 4 1 3
MIRT083020 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT085179 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 2
MIRT088894 FOXN2 forkhead box N2 1 2
MIRT089479 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 3
MIRT092027 ABHD5 abhydrolase domain containing 5 1 1
MIRT094671 FEM1C fem-1 homolog c (C. elegans) 1 1
MIRT095383 UBE2D2 ubiquitin-conjugating enzyme E2D 2 1 1
MIRT096490 BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) 1 1
MIRT101287 FAM135A family with sequence similarity 135, member A 1 1
MIRT103345 CBX3 chromobox homolog 3 1 1
MIRT103861 FOXK1 forkhead box K1 1 1
MIRT104325 CLDN12 claudin 12 1 1
MIRT104491 PEG10 paternally expressed 10 1 3
MIRT111781 MPZL1 myelin protein zero-like 1 1 1
MIRT177226 BMI1 BMI1 polycomb ring finger oncogene 1 1
MIRT177261 COMMD3-BMI1 COMMD3-BMI1 readthrough 1 1
MIRT177616 UBE2D1 ubiquitin-conjugating enzyme E2D 1 1 3
MIRT178032 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT179094 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 3
MIRT179577 CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 1 3
MIRT195288 LEPROT leptin receptor overlapping transcript 1 1
MIRT203132 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT208422 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT214570 SMAD5 SMAD family member 5 1 2
MIRT216093 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 1
MIRT216346 CCNB1 cyclin B1 1 2
MIRT220042 MDFIC MyoD family inhibitor domain containing 1 1
MIRT226721 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 1 2
MIRT227688 TBC1D13 TBC1 domain family, member 13 1 1
MIRT230062 SH3BGRL SH3 domain binding glutamic acid-rich protein like 1 1
MIRT248628 HMGN2 high mobility group nucleosomal binding domain 2 1 2
MIRT254774 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 3
MIRT264357 YAP1 Yes-associated protein 1 1 1
MIRT266954 LRRC55 leucine rich repeat containing 55 1 2
MIRT273938 SPRYD4 SPRY domain containing 4 1 1
MIRT281792 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT293242 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 1
MIRT297089 RGPD4 RANBP2-like and GRIP domain containing 4 1 1
MIRT308160 PDE12 phosphodiesterase 12 1 1
MIRT309003 USP53 ubiquitin specific peptidase 53 1 1
MIRT311462 PRRC1 proline-rich coiled-coil 1 1 1
MIRT312575 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 2
MIRT328119 ZNF711 zinc finger protein 711 1 1
MIRT329305 FAM53C family with sequence similarity 53, member C 1 1
MIRT334629 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT340664 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT378847 ITGB8 integrin, beta 8 1 1
MIRT395778 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT405628 WBP4 WW domain binding protein 4 1 2
MIRT408278 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT442095 ZNRF2 zinc and ring finger 2 1 4
MIRT442838 GTF2H5 general transcription factor IIH, polypeptide 5 1 1
MIRT443114 VLDLR very low density lipoprotein receptor 1 1
MIRT443145 ZDHHC21 zinc finger, DHHC-type containing 21 1 1
MIRT443296 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 1 1
MIRT445078 ZNF207 zinc finger protein 207 1 1
MIRT445382 PTCHD1 patched domain containing 1 1 2
MIRT447068 MCC mutated in colorectal cancers 1 1
MIRT447298 ZNF562 zinc finger protein 562 1 1
MIRT447511 MRPS5 mitochondrial ribosomal protein S5 1 1
MIRT449509 TM6SF1 transmembrane 6 superfamily member 1 1 1
MIRT449900 C11orf34 chromosome 11 open reading frame 34 1 2
MIRT450549 SHFM1 split hand/foot malformation (ectrodactyly) type 1 1 1
MIRT450717 PVRL3 poliovirus receptor-related 3 1 1
MIRT454921 ANKEF1 ankyrin repeat domain 5 1 6
MIRT455890 KIF2C kinesin family member 2C 1 1
MIRT463730 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 4
MIRT471180 PHB2 prohibitin 2 1 1
MIRT472762 MTMR6 myotubularin related protein 6 1 4
MIRT474455 KLHL11 kelch-like 11 (Drosophila) 1 4
MIRT475983 GTPBP2 GTP binding protein 2 1 1
MIRT482274 AGO2 eukaryotic translation initiation factor 2C, 2 1 2
MIRT485856 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT486190 ERH enhancer of rudimentary homolog (Drosophila) 1 2
MIRT488607 FAM3C family with sequence similarity 3, member C 1 3
MIRT489982 DDB1 damage-specific DNA binding protein 1, 127kDa 1 1
MIRT493474 IPMK inositol polyphosphate multikinase 1 1
MIRT494278 CEP120 centrosomal protein 120kDa 1 1
MIRT497990 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT498471 PTBP2 polypyrimidine tract binding protein 2 1 5
MIRT498557 TMEM30B transmembrane protein 30B 1 1
MIRT499865 SVOP SV2 related protein homolog (rat) 1 5
MIRT500218 INHBA inhibin, beta A 1 5
MIRT500692 TRIM37 tripartite motif containing 37 1 1
MIRT500986 SPPL2A signal peptide peptidase like 2A 1 2
MIRT501021 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 3
MIRT502734 CLIP1 CAP-GLY domain containing linker protein 1 1 4
MIRT502796 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 3
MIRT502885 CDK4 cyclin-dependent kinase 4 1 4
MIRT503481 ZNF154 zinc finger protein 154 1 3
MIRT503715 GRM5 glutamate receptor, metabotropic 5 1 1
MIRT505135 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT505800 RSBN1 round spermatid basic protein 1 1 4
MIRT505839 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT509282 NPM3 nucleophosmin/nucleoplasmin 3 1 3
MIRT516827 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT520517 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT520721 TM9SF3 transmembrane 9 superfamily member 3 1 3
MIRT525401 SHISA9 shisa homolog 9 (Xenopus laevis) 1 2
MIRT525865 ARL13B ADP-ribosylation factor-like 13B 1 1
MIRT526011 RBM4B RNA binding motif protein 4B 1 1
MIRT526082 TMEM41B transmembrane protein 41B 1 1
MIRT527929 FRY furry homolog (Drosophila) 1 1
MIRT528816 RAB32 RAB32, member RAS oncogene family 1 1
MIRT531060 SLC9A4 solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4 1 2
MIRT535493 PANX1 pannexin 1 1 1
MIRT536680 IKZF5 IKAROS family zinc finger 5 (Pegasus) 1 1
MIRT536833 HMBOX1 homeobox containing 1 1 1
MIRT537200 GDE1 glycerophosphodiester phosphodiesterase 1 1 2
MIRT537832 EFNA5 ephrin-A5 1 1
MIRT538343 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 2
MIRT541240 GPC4 glypican 4 1 1
MIRT543233 PEX7 peroxisomal biogenesis factor 7 1 1
MIRT543448 PARP15 poly (ADP-ribose) polymerase family, member 15 1 1
MIRT543709 XKR9 XK, Kell blood group complex subunit-related family, member 9 1 1
MIRT543905 ESYT1 extended synaptotagmin-like protein 1 1 1
MIRT543997 KLRC3 killer cell lectin-like receptor subfamily C, member 3 1 1
MIRT544067 METTL8 methyltransferase like 8 1 1
MIRT544185 ANGPTL3 angiopoietin-like 3 1 1
MIRT544806 ACSM2B acyl-CoA synthetase medium-chain family member 2B 1 1
MIRT545044 PRELID1 PRELI domain containing 1 1 1
MIRT545212 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT545287 SPC25 SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT545548 GIMAP4 GTPase, IMAP family member 4 1 1
MIRT546495 SIK1 salt-inducible kinase 1 1 1
MIRT546912 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT547673 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 2
MIRT547768 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT548685 CRNKL1 crooked neck pre-mRNA splicing factor-like 1 (Drosophila) 1 1
MIRT548899 CHEK2 checkpoint kinase 2 1 2
MIRT549955 RPL7L1 ribosomal protein L7-like 1 1 2
MIRT550487 TMEM241 transmembrane protein 241 1 1
MIRT551047 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT552809 XIAP X-linked inhibitor of apoptosis 1 2
MIRT553143 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT553828 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT554256 SIX4 SIX homeobox 4 1 1
MIRT555779 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT556316 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT556497 LIPA lipase A, lysosomal acid, cholesterol esterase 1 1
MIRT556691 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT556750 KLF7 Kruppel-like factor 7 (ubiquitous) 1 1
MIRT556988 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT557144 HOXA13 homeobox A13 1 1
MIRT557485 GPR27 G protein-coupled receptor 27 1 2
MIRT558100 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 1
MIRT559342 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT560333 ZWINT ZW10 interactor 1 1
MIRT561297 ZBTB43 zinc finger and BTB domain containing 43 1 1
MIRT561881 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT561925 MFSD9 major facilitator superfamily domain containing 9 1 1
MIRT562933 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT563289 BBS10 Bardet-Biedl syndrome 10 1 1
MIRT563403 KIF3A kinesin family member 3A 1 1
MIRT563560 KIAA1586 KIAA1586 1 1
MIRT565874 NHS Nance-Horan syndrome (congenital cataracts and dental anomalies) 1 1
MIRT566079 RCC2 regulator of chromosome condensation 2 1 1
MIRT566394 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT567257 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT571466 CCDC80 coiled-coil domain containing 80 1 1
MIRT572937 VDAC2 voltage-dependent anion channel 2 1 1
MIRT573626 ZNF724P zinc finger protein 724, pseudogene 1 1
MIRT573715 KHSRP KH-type splicing regulatory protein 1 1
MIRT609086 SMIM15 chromosome 5 open reading frame 43 1 3
MIRT617934 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT618377 PRKG2 protein kinase, cGMP-dependent, type II 1 1
MIRT619625 PLEKHG7 pleckstrin homology domain containing, family G (with RhoGef domain) member 7 1 1
MIRT623453 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT629143 CTCFL CCCTC-binding factor (zinc finger protein)-like 1 1
MIRT638519 LYRM2 LYR motif containing 2 1 1
MIRT649481 CLDN16 claudin 16 1 1
MIRT683146 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT691658 SLC43A3 solute carrier family 43, member 3 1 1
MIRT693199 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT695332 AQP3 aquaporin 3 (Gill blood group) 1 1
MIRT701021 PCGF5 polycomb group ring finger 5 1 1
MIRT708751 RYBP RING1 and YY1 binding protein 1 1
MIRT717556 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT719284 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT725170 SDAD1 SDA1 domain containing 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*