Accession ID: MIRT004115 [miRNA, hsa-miR-559 :: VCL, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-559LinkOut: [miRBase ]
Synonyms MIRN559, hsa-mir-559, MIR559
Description Homo sapiens miR-559 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-559
Mature Sequence 16| UAAAGUAAAUAUGCACCAAAA |36
Evidence Experimental
Experiments SAGE
Putative hsa-miR-559 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol VCL LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CMD1W, CMH15, MVCL
Description vinculin
Transcript NM_0033    LinkOut: [ RefSeq ]
Other Transcripts NM_0140   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on VCL LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of VCL
(miRNA target sites are highlighted)
>VCL|NM_0033|3'UTR
   1 TAGGCACCTGGCTGAGCCTGGCTGGCACAGAAACCTCTACTAAAAAGAAGGAAAATGATCTGAGTCCCAGGAGCTGCCCA
  81 GAGTTGCTGGGAGCTGAAAAATCACATCCTGGCCTGGCACATCAGAAAGGAATGGGGGCCTCTTCAAATTAGAAGACATT
 161 TATACTCTTTTTTCATGGACACTTTGAAATGTGTTTCTGTATAAAGCCTGTATTCTCAAACACAGTTACACTTGTGCACC
 241 CTCTATCCCAATAGGCAGACTGGGTTTCTAGCCCATGGACTTCACATAAGCTCAGAATCCAAGTGAACACTAGCCAGACA
 321 CTCTGCTCTGCCCTTGTTCCCTAGGGGACACTTCCCTCTGTTTCTCTTTCCTTGGCTCCCATTCACTCTTCCAGAATCCC
 401 AAGACCCAGGGCCCAGGCAAATCAGTTACTAAGAAGAAAATTGCTGTGCCTCCCAAAATTGTTTTGAGCTTTCCATGTTG
 481 CTGCCAACCATACCTTCCTTCCCTGGGCTGTGCTACCTGGGTCCTTTTCAGAAGTGAGCTTTGCTGCTACAGGGGAAGGT
 561 GGCCTCTGTGGAGCCCCAGCATATGGGGGCCTGGATTCATTTCCTGCCCTTCCTCAGTTTAATCCTTCTAGTTTCCCACA
 641 ATATAAAACTGTACTTCACTGTCAGGAAGAAATCACAGAATCATATGATTCTGCTTTTACCATGCCCCTGAGCAATGTCT
 721 GTGCTAGGGAAACTTCCCGTCCCATATCCTGCCTCAGCCCGCCAAGGTAGCCATCCCATGAACACACTGTGTCCTGGTGC
 801 TCTCTGCCACTGGAAGGGCAGAGTAGCCAGGGTGTGGCCCTGCCATCTTCCCAGCAGGGCCACTCCCGGCACTCCATGCT
 881 TAGTCACTGCCTGCAGAGGTCTGTGCTGAGGCCTTATCATTCATTCTTAGCTCTTAATTGTTCATTTTGAGCTGAAATGC
 961 TGCATTTTAATTTTAACCAAAACATGTCTCCTATCCTGGTTTTTGTAGCCTTCCTCCACATCCTTTCTAAACAAGATTTT
1041 AAAGACATGTAGGTGTTTGTTCATCTGTAACTCTAAAAGATCCTTTTTAAATTCAGTCCTAAGAAAGAGGAGTGCTTGTC
1121 CCCTAAGAGTGTTTAATGGCAAGGCAGCCCTGTCTGAAGGACACTTCCTGCCTAAGGGAGAGTGGTATTTGCAGACTAGA
1201 ATTCTAGTGCTGCTGAAGATGAATCAATGGGAAATACTACTCCTGTAATTCCTACCTCCCTGCAACCAACTACAACCAAG
1281 CTCTCTGCATCTACTCCCAAGTATGGGGTTCAAGAGAGTAATGGGTTTCATATTTCTTATCACCACAGTAAGTTCCTACT
1361 AGGCAAAATGAGAGGGCAGTGTTTCCTTTTTGGTACTTATTACTGCTAAGTATTTCCCAGCACATGAAACCTTATTTTTT
1441 CCCAAAGCCAGAACCAGATGAGTAAAGGAGTAAGAACCTTGCCTGAACATCCTTCCTTCCCACCCATCGCTGTGTGTTAG
1521 TTCCCAACATCGAATGTGTACAACTTAAGTTGGTCCTTTACACTCAGGCTTTCACTATTTCCTTTATAATGAGGATGATT
1601 ATTTTCAAGGCCCTCAGCATATTTGTATAGTTGCTTGCCTGATATAAATGCAATATTAATGCCTTTAAAGTATGAATCTA
1681 TGCCAAAGATCACTTGTTGTTTTACTAAAGAAAGATTACTTAGAGGAAATAAGAAAAATCATGTTTGCTCTCCCGGTTCT
1761 TCCAGTGGTTTGAGACACTGGTTTACACTTTATGCCGGATGTGCTTTTCTCCAATATCAGTGCTCGAGACACAGTGAAGC
1841 AAATTAAAAAAAAAAAAAAAAAAAATCCCTGAATGATGATTAGAGACATCACCGCTAAAAAACTACATTTATAAGCTAGG
1921 ATTTGTTATATGCAAATATTTTCTGCCTCTTCTTTTGTTCTGTTTAAAACAATAAAATGCATTTGTATAAAAAAAAAAAA
2001 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
2081 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aaaACCACGUAUAAAUGAAAu 5'
             || ||||| |||| ||| 
Target 5' aaaTGCTGCAT-TTTAATTTt 3'
955 - 974 137.00 -6.50
2
miRNA  3' aaaacCACGU-AUAAAUGAAAu 5'
               | ||| |:||| |||| 
Target 5' tgagaGGGCAGTGTTTCCTTTt 3'
1369 - 1390 128.00 -8.50
3
miRNA  3' aaaaccACGUAUAAAUGAAau 5'
                ||:||| ||:|||  
Target 5' catattTGTATAGTTGCTTgc 3'
1618 - 1638 127.00 -6.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-559 :: VCL    [ Functional MTI ]
Validation Method Western blot , Other
Conditions ZR75 , MCF-7 , HeLa , MDA-MB-231
Location of target site 3'UTR
Original Description (Extracted from the article) ... To assess the effects of these miRs on MTA1 expression, we transfected human cancer cell lines with miR-559 or miR-661 or a negative control (designated con-miR) and MTA1 protein levels were determined by Western blot analysis. Both miRs inhibited the expression level of MTA1 but not MTA2 or vinculin. (Fig. 1B). ...

- Reddy, S. D. Pakala, S. B. Ohshiro, K. et al., 2009, Cancer Res.

Article - Reddy, S. D. Pakala, S. B. Ohshiro, K. et al.
- Cancer Res, 2009
MicroRNAs (miR) have been identified as posttranscriptional modifiers of target gene regulation and control the expression of gene products important in cancer progression. Here, we show that miR-661 inhibits the expression of metastatic tumor antigen 1 (MTA1), a widely up-regulated gene product in human cancer, by targeting the 3' untranslated region (UTR) of MTA1 mRNA. We found that endogenous miR-661 expression was positively regulated by the c/EBPalpha transcription factor, which is down-regulated during cancer progression. c/EBPalpha directly interacted with the miR-661 chromatin and bound to miR-661 putative promoter that contains a c/EBPalpha-consensus motif. In addition, we found that the level of MTA1 protein was progressively up-regulated, whereas that of miR-661 and its activator, c/EBPalpha, were down-regulated in a breast cancer progression model consisting of MCF-10A cell lines whose phenotypes ranged from noninvasive to highly invasive. c/EBPalpha expression in breast cancer cells resulted in increased miR-661 expression and reduced MTA1 3'UTR-luciferase activity and MTA1 protein level. We also provide evidence that the introduction of miR-661 inhibited the motility, invasiveness, anchorage-independent growth, and tumorigenicity of invasive breast cancer cells. We believe our findings show for the first time that c/EBPalpha regulates the level of miR-661 and in turn modifies the functions of the miR661-MTA1 pathway in human cancer cells. Based on these findings, we suggest that miR-661 be further investigated for therapeutic use in down-regulating the expression of MTA1 in cancer cells.
LinkOut: [PMID: 19584269]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
5 hsa-miR-559 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000036 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT004115 VCL vinculin 2 1
MIRT004116 MTA2 metastasis associated 1 family, member 2 2 1
MIRT004442 MTA1 metastasis associated 1 3 1
MIRT007228 FXN frataxin 1 1