Accession ID: MIRT004242 [miRNA, hsa-miR-143-3p :: COL1A1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-143LinkOut: [miRBase ]
Description Homo sapiens miR-143 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse has a 1 nt 3' extension (A), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-143-3p
Mature Sequence 61| UGAGAUGAAGCACUGUAGCUC |81
Evidence Experimental
Experiments Cloned
Putative hsa-miR-143-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol COL1A1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms OI4
Description collagen, type I, alpha 1
Transcript NM_0000    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on COL1A1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of COL1A1
(miRNA target sites are highlighted)
>COL1A1|NM_0000|3'UTR
   1 TAAACTCCCTCCATCCCAACCTGGCTCCCTCCCACCCAACCAACTTTCCCCCCAACCCGGAAACAGACAAGCAACCCAAA
  81 CTGAACCCCCTCAAAAGCCAAAAAATGGGAGACAATTTCACATGGACTTTGGAAAATATTTTTTTCCTTTGCATTCATCT
 161 CTCAAACTTAGTTTTTATCTTTGACCAACCGAACATGACCAAAAACCAAAAGTGCATTCAACCTTACCAAAAAAAAAAAA
 241 AAAAAAAGAATAAATAAATAACTTTTTAAAAAAGGAAGCTTGGTCCACTTGCTTGAAGACCCATGCGGGGGTAAGTCCCT
 321 TTCTGCCCGTTGGGCTTATGAAACCCCAATGCTGCCCTTTCTGCTCCTTTCTCCACACCCCCCTTGGGGCCTCCCCTCCA
 401 CTCCTTCCCAAATCTGTCTCCCCAGAAGACACAGGAAACAATGTATTGTCTGCCCAGCAATCAAAGGCAATGCTCAAACA
 481 CCCAAGTGGCCCCCACCCTCAGCCCGCTCCTGCCCGCCCAGCACCCCCAGGCCCTGGGGGACCTGGGGTTCTCAGACTGC
 561 CAAAGAAGCCTTGCCATCTGGCGCTCCCATGGCTCTTGCAACATCTCCCCTTCGTTTTTGAGGGGGTCATGCCGGGGGAG
 641 CCACCAGCCCCTCACTGGGTTCGGAGGAGAGTCAGGAAGGGCCACGACAAAGCAGAAACATCGGATTTGGGGAACGCGTG
 721 TCAATCCCTTGTGCCGCAGGGCTGGGCGGGAGAGACTGTTCTGTTCCTTGTGTAACTGTGTTGCTGAAAGACTACCTCGT
 801 TCTTGTCTTGATGTGTCACCGGGGCAACTGCCTGGGGGCGGGGATGGGGGCAGGGTGGAAGCGGCTCCCCATTTTATACC
 881 AAAGGTGCTACATCTATGTGATGGGTGGGGTGGGGAGGGAATCACTGGTGCTATAGAAATTGAGATGCCCCCCCAGGCCA
 961 GCAAATGTTCCTTTTTGTTCAAAGTCTATTTTTATTCCTTGATATTTTTCTTTTTTTTTTTTTTTTTTTGTGGATGGGGA
1041 CTTGTGAATTTTTCTAAAGGTGCTATTTAACATGGGAGGAGAGCGTGTGCGGCTCCAGCCCAGCCCGCTGCTCACTTTCC
1121 ACCCTCTCTCCACCTGCCTCTGGCTTCTCAGGCCTCTGCTCTCCGACCTCTCTCCTCTGAAACCCTCCTCCACAGCTGCA
1201 GCCCATCCTCCCGGCTCCCTCCTAGTCTGTCCTGCGTCCTCTGTCCCCGGGTTTCAGAGACAACTTCCCAAAGCACAAAG
1281 CAGTTTTTCCCCCTAGGGGTGGGAGGAAGCAAAAGACTCTGTACCTATTTTGTATGTGTATAATAATTTGAGATGTTTTT
1361 AATTATTTTGATTGCTGGAATAAAGCATGTGGAAATGACCCAAACATAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cucGAUGUCACG-AAGUAGAGu 5'
             :| |  ||| |||||||| 
Target 5' tttTTCCTTTGCATTCATCTCt 3'
141 - 162 154.00 -11.30
2
miRNA  3' cuCGAUGUCACGAAGUAGAGu 5'
            ||| :  |||  |||||| 
Target 5' tgGCTCT--TGCAACATCTCc 3'
590 - 608 123.00 -11.10
3
miRNA  3' cucGAUGUCACGAAGUAGAgu 5'
             | | :||||| |||||  
Target 5' tacCAAAGGTGCTACATCTat 3'
877 - 897 118.00 -12.50
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: COL1A1    [ Non-Functional MTI ]
Validation Method Immunoblot , Luciferase reporter assay , qRT-PCR
Conditions LX-2
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... As a result, the miR- 29b and -218 precursors inhibited luciferase activity derived from the vectors carrying Col1A1 or SP1 30UTRs (Fig. 3D). In contrast, the miR-143 precursors had no effect on luciferase activity of the vec- tor carrying Col1A1 30UTR (Fig. 3D). ...

- Ogawa, T. Iizuka, M. Sekiya, Y. Yoshizato, et al., 2010, Biochem Biophys Res Commun.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cucGAUGUCACG-AAGUAGAGu 5'
             :| |  ||| |||||||| 
Target 5' uuuUUCCUUUGCAUUCAUCUCu 3'
2 - 23
Article - Ogawa, T. Iizuka, M. Sekiya, Y. Yoshizato, et al.
- Biochem Biophys Res Commun, 2010
MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression through imperfect base pairing with the 3' untranslated region (3'UTR) of target mRNA. We studied the regulation of alpha 1 (I) collagen (Col1A1) expression by miRNAs in human stellate cells, which are involved in liver fibrogenesis. Among miR-29b, -143, and -218, whose expressions were altered in response to transforming growth factor-beta1 or interferon-alpha stimulation, miR-29b was the most effective suppressor of type I collagen at the mRNA and protein level via its direct binding to Col1A1 3'UTR. miR-29b also had an effect on SP1 expression. These results suggested that miR-29b is involved in the regulation of type I collagen expression by interferon-alpha in hepatic stellate cells. It is anticipated that miR-29b will be used for the regulation of stellate cell activation and lead to antifibrotic therapy.
LinkOut: [PMID: 19913496]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: COL1A1    [ Functional MTI ]
Validation Method Other
Article - Osaki, M. Takeshita, F. Sugimoto, Y. et al.
- Molecular therapy : the journal of the American Society of Gene Therapy, 2011
Pulmonary metastases are the main cause of death in patients with osteosarcoma, however, the molecular mechanisms of metastasis are not well understood. To detect lung metastasis-related microRNA (miRNA) in human osteosarcoma, we compared parental (HOS) and its subclone (143B) human osteosarcoma cell lines showing lung metastasis in a mouse model. miR-143 was the most downregulated miRNA (P < 0.01), and transfection of miR-143 into 143B significantly decreased its invasiveness, but not cell proliferation. Noninvasive optical imaging technologies revealed that intravenous injection of miR-143, but not negative control miRNA, significantly suppressed lung metastasis of 143B (P < 0.01). To search for miR-143 target mRNA in 143B, microarray analyses were performed using an independent RNA pool extracted by two different comprehensive miR-143-target mRNA collecting systems. Western blot analyses revealed that MMP-13 was mostly protein downregulated by miR-143. Immunohistochemistry using clinical samples clearly revealed MMP-13-positive cells in lung metastasis-positive cases, but not in at least three cases showing higher miR-143 expression in the no metastasis group. Taken together, these data indicated that the downregulation of miR-143 correlates with the lung metastasis of human osteosarcoma cells by promoting cellular invasion, probably via MMP-13 upregulation, suggesting that miRNA could be used to develop new molecular targets for osteosarcoma metastasis.
LinkOut: [PMID: 21427707]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
20 hsa-miR-143-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000312 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 3
MIRT000314 KLF4 Kruppel-like factor 4 (gut) 1 2
MIRT000458 MYO6 myosin VI 4 7
MIRT000716 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 4 2
MIRT003060 FNDC3B fibronectin type III domain containing 3B 4 3
MIRT003759 MAPK7 mitogen-activated protein kinase 7 5 14
MIRT003964 COX2 cytochrome c oxidase subunit II 1 1
MIRT004242 COL1A1 collagen, type I, alpha 1 3 2
MIRT005644 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 2
MIRT005771 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 3 2
MIRT006301 HK2 hexokinase 2 1 4
MIRT006316 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 3 1
MIRT006362 FHIT fragile histidine triad gene 1 1
MIRT006469 MACC1 metastasis associated in colon cancer 1 3 1
MIRT006757 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT006846 JAG1 jagged 1 (Alagille syndrome) 4 1
MIRT007179 AKT1 v-akt murine thymoma viral oncogene homolog 1 3 1
MIRT007256 MDM2 Mdm2 p53 binding protein homolog (mouse) 1 1
MIRT007348 BCL2 B-cell CLL/lymphoma 2 1 2
MIRT021540 MMP13 matrix metallopeptidase 13 (collagenase 3) 2 1