Accession ID: MIRT004243 [miRNA, hsa-miR-99a-5p :: FGFR3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-99aLinkOut: [miRBase ]
Description Homo sapiens miR-99a stem-loop
Comment This sequence is localised to chromosome 21 and was named mir-99-21 in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-99a-5p
Mature Sequence 13| AACCCGUAGAUCCGAUCUUGUG |34
Evidence Experimental
Experiments Cloned
Putative hsa-miR-99a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGFR3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ACH, CD333, CEK2, HSFGFR3EX, JTK4
Description fibroblast growth factor receptor 3
Transcript NM_0001    LinkOut: [ RefSeq ]
Other Transcripts NM_0011632 , NM_0229   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGFR3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGFR3
(miRNA target sites are highlighted)
>FGFR3|NM_0001|3'UTR
   1 CCCCCGGCCCCACCCAGCAGTGGGGGCTCGCGGACGTGAAGGGCCACTGGTCCCCAACAATGTGAGGGGTCCCTAGCAGC
  81 CCACCCTGCTGCTGGTGCACAGCCACTCCCCGGCATGAGACTCAGTGCAGATGGAGAGACAGCTACACAGAGCTTTGGTC
 161 TGTGTGTGTGTGTGTGCGTGTGTGTGTGTGTGTGTGCACATCCGCGTGTGCCTGTGTGCGTGCGCATCTTGCCTCCAGGT
 241 GCAGAGGTACCCTGGGTGTCCCCGCTGCTGTGCAACGGTCTCCTGACTGGTGCTGCAGCACCGAGGGGCCTTTGTTCTGG
 321 GGGGACCCAGTGCAGAATGTAAGTGGGCCCACCCGGTGGGACCCCCGTGGGGCAGGGAGCTGGGCCCGACATGGCTCCGG
 401 CCTCTGCCTTTGCACCACGGGACATCACAGGGTGGGCCTCGGCCCCTCCCACACCCAAAGCTGAGCCTGCAGGGAAGCCC
 481 CACATGTCCAGCACCTTGTGCCTGGGGTGTTAGTGGCACCGCCTCCCCACCTCCAGGCTTTCCCACTTCCCACCCTGCCC
 561 CTCAGAGACTGAAATTACGGGTACCTGAAGATGGGAGCCTTTACCTTTTATGCAAAAGGTTTATTCCGGAAACTAGTGTA
 641 CATTTCTATAAATAGATGCTGTGTATATGGTATATATACATATATATATATAACATATATGGAAGAGGAAAAGGCTGGTA
 721 CAACGGAGGCCTGCGACCCTGGGGGCACAGGAGGCAGGCATGGCCCTGGGCGGGGCGTGGGGGGGCGTGGAGGGAGGCCC
 801 CAGGGGGTCTCACCCATGCAAGCAGAGGACCAGGGCCTTTTCTGGCACCGCAGTTTTGTTTTAAAACTGGACCTGTATAT
 881 TTGTAAAGCTATTTATGGGCCCCTGGCACTCTTGTTCCCACACCCCAACACTTCCAGCATTTAGCTGGCCACATGGCGGA
 961 GAGTTTTAATTTTTAACTTATTGACAACCGAGAAGGTTTATCCCGCCGATAGAGGGACGGCCAAGAATGTACGTCCAGCC
1041 TGCCCCGGAGCTGGAGGATCCCCTCCAAGCCTAAAAGGTTGTTAATAGTTGGAGGTGATTCCAGTGAAGATATTTTATTT
1121 CCTTTGTCCTTTTTCAGGAGAATTAGATTTCTATAGGATTTTTCTTTAGGAGATTTATTTTTTGGACTTCAAAGCAAGCT
1201 GGTATTTTCATACAAATTCTTCTAATTGCTGTGTGTCCCAGGCAGGGAGACGGTTTCCAGGGAGGGGCCGGCCCTGTGTG
1281 CAGGTTCCGATGTTATTAGATGTTACAAGTTTATATATATCTATATATATAATTTATTGAGTTTTTACAAGATGTATTTG
1361 TTGTAGACTTAACACTTCTTACGCAATGCTTCTAGAGTTTTATAGCCTGGACTGCTACCTTTCAAAGCTTGGAGGGAAGC
1441 CGTGAATTCAGTTGGTTCGTTCTGTACTGTTACTGGGCCCTGAGTCTGGGCAGCTGTCCCTTGCTTGCCTGCAGGGCCAT
1521 GGCTCAGGGTGGTCTCTTCTTGGGGCCCAGTGCATGGTGGCCAGAGGTGTCACCCAAACCGGCAGGTGCGATTTTGTTAA
1601 CCCAGCGACGAACTTTCCGAAAAATAAAGACACCTGGTTGCTAACCTGGAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-99a-5p :: FGFR3    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions RT112 , EJ/T24 , RT4
Disease bladder urothelial carcinoma//urothelial cell carcinoma//low-grade nonmuscle invasive urothelial cell carcinoma;
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Direct targeting of the 3' UTR region of the FGFR3 gene was confirmed by a Luciferase reporter assay (Fig. 4). Transfection of NHU cells with anti-miRs to 99a/100 and a plasmid containing Luciferase and a partial FGFR3 3'UTR resulted in a 2-fold (miR-99a) and 3.4-fold (miR-100) increase in Luciferase expression, when compared with cells transfected with a scrambled UTR sequence.// ...

- Catto, J. W. Miah, S. Owen, H. C. Bryant, et al., 2009, Cancer Res.

Article - Catto, J. W. Miah, S. Owen, H. C. Bryant, et al.
- Cancer Res, 2009
Urothelial carcinoma of the bladder (UCC) is a common disease that arises by at least two different molecular pathways. The biology of UCC is incompletely understood, making the management of this disease difficult. Recent evidence implicates a regulatory role for microRNA in cancer. We hypothesized that altered microRNA expression contributes to UCC carcinogenesis. To test this hypothesis, we examined the expression of 322 microRNAs and their processing machinery in 78 normal and malignant urothelial samples using real-time rtPCR. Genes targeted by differentially expressed microRNA were investigated using real-time quantification and microRNA knockdown. We also examined the role of aberrant DNA hypermethylation in microRNA downregulation. We found that altered microRNA expression is common in UCC and occurs early in tumorogenesis. In normal urothelium from patients with UCC, 11% of microRNAs had altered expression when compared with disease-free controls. This was associated with upregulation of Dicer, Drosha, and Exportin 5. In UCC, microRNA alterations occur in a tumor phenotype-specific manner and can predict disease progression. High-grade UCC were characterized by microRNA upregulation, including microRNA-21 that suppresses p53 function. In low-grade UCC, there was downregulation of many microRNA molecules. In particular, loss of microRNAs-99a/100 leads to upregulation of FGFR3 before its mutation. Promoter hypermethylation is partly responsible for microRNA downregulation. In conclusion, distinct microRNA alterations characterize UCC and target genes in a pathway-specific manner. These data reveal new insights into the disease biology and have implications regarding tumor diagnosis, prognosis and therapy.
LinkOut: [PMID: 19843843]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-99a-5p :: FGFR3    [ Functional MTI ]
Validation Method Reporter assay;Western blot
Article - Oneyama, C. Ikeda, J. Okuzaki, D. Suzuki, et al.
- Oncogene, 2011
The tyrosine kinase c-Src is upregulated in various human cancers, but the molecular mechanisms underlying c-Src-mediated tumor growth remain unclear. Here we examined the involvement of microRNAs in the c-Src-mediated tumor growth. Microarray profiling revealed that c-Src activation downregulates a limited set of microRNAs, including miR-99a, which targets oncogenic mammalian target of rapamycin (mTOR) and fibroblast growth factor receptor 3 (FGFR3). Re-expression of miR-99a suppressed tumor growth of c-Src-transformed cells, and this effect was restored by the overexpression of mTOR. The downregulation of miR-99a was also observed in epidermal growth factor- and Ras-transformed cells, and it was suppressed by inhibiting the mitogen-activated protein kinase (MAPK) pathway. Furthermore, miR-99a downregulation is associated with mTOR/FGFR3 upregulation in various human lung cancer cells/tissues. The tumorigenicity of these cells was suppressed by the introduction of miR-99a. These findings suggest that the miR-99a-mTOR/FGFR3 pathway is crucial for controlling tumor growth in a wide range of human cancers that harbor upregulation of the Src-related oncogenic pathways.Oncogene advance online publication, 7 March 2011; doi:10.1038/onc.2011.63.
LinkOut: [PMID: 21383697]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
120 hsa-miR-99a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002306 RAVER2 ribonucleoprotein, PTB-binding 2 3 1
MIRT004243 FGFR3 fibroblast growth factor receptor 3 4 2
MIRT005973 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT006145 IGF1R insulin-like growth factor 1 receptor 4 3
MIRT006146 MTOR mechanistic target of rapamycin (serine/threonine kinase) 4 5
MIRT027393 RPTOR regulatory associated protein of MTOR, complex 1 1 1
MIRT027394 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT027395 MEF2D myocyte enhancer factor 2D 1 1
MIRT027396 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT027397 COQ2 coenzyme Q2 homolog, prenyltransferase (yeast) 1 1
MIRT027398 TRIB1 tribbles homolog 1 (Drosophila) 1 1
MIRT048601 MRPS33 mitochondrial ribosomal protein S33 1 1
MIRT048602 CCDC6 coiled-coil domain containing 6 1 1
MIRT048603 RASAL2 RAS protein activator like 2 1 1
MIRT048604 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 1
MIRT048605 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT048606 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT048607 METTL23 chromosome 17 open reading frame 95 1 1
MIRT048608 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT048609 ZNF367 zinc finger protein 367 1 1
MIRT048610 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 1
MIRT048611 N4BP2 NEDD4 binding protein 2 1 1
MIRT048612 RCN2 reticulocalbin 2, EF-hand calcium binding domain 1 1
MIRT048613 RPL36A ribosomal protein L36a 1 1
MIRT048614 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT048615 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT048616 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT048617 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT048618 STEAP4 STEAP family member 4 1 1
MIRT048619 RPS26 ribosomal protein S26 1 1
MIRT048620 DLD dihydrolipoamide dehydrogenase 1 1
MIRT048621 ORMDL1 ORM1-like 1 (S. cerevisiae) 1 1
MIRT048622 RARS arginyl-tRNA synthetase 1 1
MIRT048623 CUL2 cullin 2 1 1
MIRT048624 FOSL2 FOS-like antigen 2 1 1
MIRT048625 GPR126 G protein-coupled receptor 126 1 1
MIRT048626 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 1
MIRT048627 MON1B MON1 homolog B (yeast) 1 1
MIRT048628 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT048629 TOMM22 translocase of outer mitochondrial membrane 22 homolog (yeast) 1 1
MIRT048630 ORC5 origin recognition complex, subunit 5-like (yeast) 1 1
MIRT048631 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT048632 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT048633 UBB ubiquitin B 1 1
MIRT048634 SRPK1 SFRS protein kinase 1 1 1
MIRT048635 CAPNS1 calpain, small subunit 1 1 1
MIRT048636 RPS6 ribosomal protein S6 1 1
MIRT048637 SNRNP200 small nuclear ribonucleoprotein 200kDa (U5) 1 1
MIRT048638 SRSF10 splicing factor, arginine/serine-rich 13A 1 1
MIRT048639 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT048640 LMAN2 lectin, mannose-binding 2 1 1
MIRT048641 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT048642 N6AMT1 N-6 adenine-specific DNA methyltransferase 1 (putative) 1 1
MIRT048643 SGPP2 sphingosine-1-phosphate phosphatase 2 1 1
MIRT048644 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT048645 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 1 1
MIRT048646 FAM171B family with sequence similarity 171, member B 1 1
MIRT048647 UQCR10 ubiquinol-cytochrome c reductase, complex III subunit X 1 1
MIRT048648 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT048649 AKAP2 A kinase (PRKA) anchor protein 2 1 1
MIRT048650 EXTL3 exostoses (multiple)-like 3 1 1
MIRT048651 NFU1 NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) 1 1
MIRT048652 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT048653 RB1 retinoblastoma 1 1 1
MIRT048654 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT048655 PLSCR1 phospholipid scramblase 1 1 1
MIRT048656 WHAMM WAS protein homolog associated with actin, golgi membranes and microtubules 1 1
MIRT048657 ITM2B integral membrane protein 2B 1 1
MIRT048658 POGK pogo transposable element with KRAB domain 1 1
MIRT048659 SEC13 SEC13 homolog (S. cerevisiae) 1 1
MIRT048660 TPPP3 tubulin polymerization-promoting protein family member 3 1 1
MIRT048661 RPS15 ribosomal protein S15 1 1
MIRT048662 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT048663 TMEM209 transmembrane protein 209 1 1
MIRT048664 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT048665 MED12 mediator complex subunit 12 1 1
MIRT048666 DOCK11 dedicator of cytokinesis 11 1 1
MIRT048667 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 1 1
MIRT048668 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT048669 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT048670 NPM3 nucleophosmin/nucleoplasmin 3 1 1
MIRT048671 MYL2 myosin, light chain 2, regulatory, cardiac, slow 1 1
MIRT048672 CBWD1 COBW domain containing 1 1 1
MIRT048673 JPH1 junctophilin 1 1 1
MIRT048674 GTF2I general transcription factor IIi 1 1
MIRT048675 NDUFA2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa 1 1
MIRT048676 COL4A1 collagen, type IV, alpha 1 1 1
MIRT048677 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT048678 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT048679 RUNDC3B RUN domain containing 3B 1 1
MIRT048680 COX2 cytochrome c oxidase subunit II 1 1
MIRT048681 TUBG1 tubulin, gamma 1 1 1
MIRT048682 DDX42 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 1 1
MIRT048683 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT048684 ADCY9 adenylate cyclase 9 1 1
MIRT048685 CTC1 chromosome 17 open reading frame 68 1 1
MIRT048686 MCM8 minichromosome maintenance complex component 8 1 1
MIRT048687 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT048688 DNAJA3 DnaJ (Hsp40) homolog, subfamily A, member 3 1 1
MIRT048689 RAD51C RAD51 homolog C (S. cerevisiae) 1 1
MIRT048690 DDX46 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 1 1
MIRT048691 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT048692 RPL37A ribosomal protein L37a 1 1
MIRT048693 TYMS thymidylate synthetase 1 1
MIRT048694 DDHD1 DDHD domain containing 1 1 1
MIRT048695 SALL2 sal-like 2 (Drosophila) 1 1
MIRT048696 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT048697 SUDS3 suppressor of defective silencing 3 homolog (S. cerevisiae) 1 1
MIRT048698 P2RY11 purinergic receptor P2Y, G-protein coupled, 11 1 1
MIRT048699 E4F1 E4F transcription factor 1 1 1
MIRT048700 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT048701 GLUD1 glutamate dehydrogenase 1 1 1
MIRT048702 RNF187 ring finger protein 187 1 1
MIRT048703 CUL3 cullin 3 1 1
MIRT048704 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT048705 GOLGA3 golgin A3 1 1
MIRT048706 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT048707 BRD7 bromodomain containing 7 1 1
MIRT048708 CERS1 LAG1 homolog, ceramide synthase 1 1 1
MIRT048709 TTC38 tetratricopeptide repeat domain 38 1 1