Accession ID: MIRT004248 [miRNA, hsa-miR-203a :: TP63, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-203aLinkOut: [miRBase ]
Description Homo sapiens miR-203a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-203a
Mature Sequence 65| GUGAAAUGUUUAGGACCACUAG |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-203a Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP63 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIS, B(p51A), B(p51B), EEC3, KET, LMS, NBP, OFC8, RHS, SHFM4, TP53CP, TP53L, TP73L, p40, p51, p53CP, p63, p73H, p73L
Description tumor protein p63
Transcript NM_0011149    LinkOut: [ RefSeq ]
Other Transcripts NM_0011149 , NM_0011149 , NM_0011149 , NM_0011149 , NM_0037   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP63 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP63
(miRNA target sites are highlighted)
>TP63|NM_0011149|3'UTR
   1 TGAAAATCCCTGAGCAATTTCGACATGCGATCTGGAAGGGCATCCTGGACCACCGGCAGCTCCACGAATTCTCCTCCCCT
  81 TCTCATCTCCTGCGGACCCCAAGCAGTGCCTCTACAGTCAGTGTGGGCTCCAGTGAGACCCGGGGTGAGCGTGTTATTGA
 161 TGCTGTGCGATTCACCCTCCGCCAGACCATCTCTTTCCCACCCCGAGATGAGTGGAATGACTTCAACTTTGACATGGATG
 241 CTCGCCGCAATAAGCAACAGCGCATCAAAGAGGAGGGGGAGTGAGCCTCACCATGTGAGCTCTTCCTATCCCTCTCCTAA
 321 CTGCCAGCCCCCTAAAAGCACTCCTGCTTAATCTTCAAAGCCTTCTCCCTAGCTCCTCCCCTTCCTCTTGTCTGATTTCT
 401 TAGGGGAAGGAGAAGTAAGAGGCTACCTCTTACCTAACATCTGACCTGGCATCTAATTCTGATTCTGGCTTTAAGCCTTC
 481 AAAACTATAGCTTGCAGAACTGTAGCTGCCATGGCTAGGTAGAAGTGAGCAAAAAAGAGTTGGGTGTCTCCTTAAGCTGC
 561 AGAGATTTCTCATTGACTTTTATAAAGCATGTTCACCCTTATAGTCTAAGACTATATATATAAATGTATAAATATACAGT
 641 ATAGATTTTTGGGTGGGGGGCATTGAGTATTGTTTAAAATGTAATTTAAATGAAAGAAAATTGAGTTGCACTTATTGACC
 721 ATTTTTTAATTTACTTGTTTTGGATGGCTTGTCTATACTCCTTCCCTTAAGGGGTATCATGTATGGTGATAGGTATCTAG
 801 AGCTTAATGCTACATGTGAGTGACGATGATGTACAGATTCTTTCAGTTCTTTGGATTCTAAATACATGCCACATCAAACC
 881 TTTGAGTAGATCCATTTCCATTGCTTATTATGTAGGTAAGACTGTAGATATGTATTCTTTTCTCAGTGTTGGTATATTTT
 961 ATATTACTGACATTTCTTCTAGTGATGATGGTTCACGTTGGGGTGATTTAATCCAGTTATAAGAAGAAGTTCATGTCCAA
1041 ACGTCCTCTTTAGTTTTTGGTTGGGAATGAGGAAAATTCTTAAAAGGCCCATAGCAGCCAGTTCAAAAACACCCGACGTC
1121 ATGTATTTGAGCATATCAGTAACCCCCTTAAATTTAATACCAGATACCTTATCTTACAATATTGATTGGGAAAACATTTG
1201 CTGCCATTACAGAGGTATTAAAACTAAATTTCACTACTAGATTGACTAACTCAAATACACATTTGCTACTGTTGTAAGAA
1281 TTCTGATTGATTTGATTGGGATGAATGCCATCTATCTAGTTCTAACAGTGAAGTTTTACTGTCTATTAATATTCAGGGTA
1361 AATAGGAATCATTCAGAAATGTTGAGTCTGTACTAAACAGTAAGATATCTCAATGAACCATAAATTCAACTTTGTAAAAA
1441 TCTTTTGAAGCATAGATAATATTGTTTGGTAAATGTTTCTTTTGTTTGGTAAATGTTTCTTTTAAAGACCCTCCTATTCT
1521 ATAAAACTCTGCATGTAGAGGCTTGTTTACCTTTCTCTCTCTAAGGTTTACAATAGGAGTGGTGATTTGAAAAATATAAA
1601 ATTATGAGATTGGTTTTCCTGTGGCATAAATTGCATCACTGTATCATTTTCTTTTTTAACCGGTAAGAGTTTCAGTTTGT
1681 TGGAAAGTAACTGTGAGAACCCAGTTTCCCGTCCATCTCCCTTAGGGACTACCCATAGACATGAAAGGTCCCCACAGAGC
1761 AAGAGATAAGTCTTTCATGGCTGCTGTTGCTTAAACCACTTAAACGAAGAGTTCCCTTGAAACTTTGGGAAAACATGTTA
1841 ATGACAATATTCCAGATCTTTCAGAAATATAACACATTTTTTTGCATGCATGCAAATGAGCTCTGAAATCTTCCCATGCA
1921 TTCTGGTCAAGGGCTGTCATTGCACATAAGCTTCCATTTTAATTTTAAAGTGCAAAAGGGCCAGCGTGGCTCTAAAAGGT
2001 AATGTGTGGATTGCCTCTGAAAAGTGTGTATATATTTTGTGTGAAATTGCATACTTTGTATTTTGATTATTTTTTTTTTC
2081 TTCTTGGGATAGTGGGATTTCCAGAACCACACTTGAAACCTTTTTTTATCGTTTTTGTATTTTCATGAAAATACCATTTA
2161 GTAAGAATACCACATCAAATAAGAAATAATGCTACAATTTTAAGAGGGGAGGGAAGGGAAAGTTTTTTTTTATTATTTTT
2241 TTAAAATTTTGTATGTTAAAGAGAATGAGTCCTTGATTTCAAAGTTTTGTTGTACTTAAATGGTAATAAGCACTGTAAAC
2321 TTCTGCAACAAGCATGCAGCTTTGCAAACCCATTAAGGGGAAGAATGAAAGCTGTTCCTTGGTCCTAGTAAGAAGACAAA
2401 CTGCTTCCCTTACTTTGCTGAGGGTTTGAATAAACCTAGGACTTCCGAGCTATGTCAGTACTATTCAGGTAACACTAGGG
2481 CCTTGGAAATTCCTGTACTGTGTCTCATGGATTTGGCACTAGCCAAAGCGAGGCACCCTTACTGGCTTACCTCCTCATGG
2561 CAGCCTACTCTCCTTGAGTGTATGAGTAGCCAGGGTAAGGGGTAAAAGGATAGTAAGCATAGAAACCACTAGAAAGTGGG
2641 CTTAATGGAGTTCTTGTGGCCTCAGCTCAATGCAGTTAGCTGAAGAATTGAAAAGTTTTTGTTTGGAGACGTTTATAAAC
2721 AGAAATGGAAAGCAGAGTTTTCATTAAATCCTTTTACCTTTTTTTTTTCTTGGTAATCCCCTAAAATAACAGTATGTGGG
2801 ATATTGAATGTTAAAGGGATATTTTTTTCTATTATTTTTATAATTGTACAAAATTAAGCAAATGTTAAAAGTTTTATATG
2881 CTTTATTAATGTTTTCAAAAGGTATTATACATGTGATACATTTTTTAAGCTTCAGTTGCTTGTCTTCTGGTACTTTCTGT
2961 TATGGGCTTTTGGGGAGCCAGAAGCCAATCTACAATCTCTTTTTGTTTGCCAGGACATGCAATAAAATTTAAAAAATAAA
3041 TAAAAACTAATTAAGAAATTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-203a :: TP63    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions Not mention
Location of target site 3'UTR
Original Description (Extracted from the article) ... these results indicate that miR-203’s effect on p63 is direct and is mediated through these 3'UTR target sites. ...

- Yi, R. Poy, M. N. Stoffel, M. Fuchs, E., 2008, Nature.

Article - Yi, R. Poy, M. N. Stoffel, M. Fuchs, E.
- Nature, 2008
In stratified epithelial tissues, homeostasis relies on the self-renewing capacity of stem cells located within the innermost basal layer. As basal cells become suprabasal, they lose proliferative potential and embark on a terminal differentiation programme. Here, we show that microRNA-203 is induced in the skin concomitantly with stratification and differentiation. By altering miR-203's spatiotemporal expression in vivo, we show that miR-203 promotes epidermal differentiation by restricting proliferative potential and inducing cell-cycle exit. We identify p63 as one of the conserved targets of miR-203 across vertebrates. Notably, p63 is an essential regulator of stem-cell maintenance in stratified epithelial tissues. We show that miR-203 directly represses the expression of p63: it fails to switch off suprabasally when either Dicer1 or miR-203 is absent and it becomes repressed basally when miR-203 is prematurely expressed. Our findings suggest that miR-203 defines a molecular boundary between proliferative basal progenitors and terminally differentiating suprabasal cells, ensuring proper identity of neighbouring layers.
LinkOut: [PMID: 18311128]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-203a :: TP63    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Luciferase reporter assay , Other
Conditions HEK293E
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Together, the data presented here indicate that miR-203, by targeting ΔNp63 mRNA, acts as a switch between keratinocyte proliferation and differentiation in adult epidermis. ...

- Lena, A. M. Shalom-Feuerstein, R. Rivetti et al., 2008, Cell Death Differ.

Article - Lena, A. M. Shalom-Feuerstein, R. Rivetti et al.
- Cell Death Differ, 2008
The epidermis, the outer layer of the skin composed of keratinocytes, is a stratified epithelium that functions as a barrier to protect the organism from dehydration and external insults. The epidermis develops depending on the transcription factor p63, a member of the p53 family of transcription factors. p63 is strongly expressed in the innermost basal layer where epithelial cells with high clonogenic and proliferative capacity reside. Deletion of p63 in mice results in a dramatic loss of all keratinocytes and loss of stratified epithelia, probably due to a premature proliferative rundown of the stem and transient amplifying cells. Here we report that microRNA (miR)-203 is induced in vitro in primary keratinocytes in parallel with differentiation. We found that miR-203 specifically targets human and mouse p63 3'-UTRs and not SOCS-3, despite bioinformatics alignment between miR-203 and SOCS-3 3'-UTR. We also show that miR-203 overexpression in proliferating keratinocytes is not sufficient to induce full epidermal differentiation in vitro. In addition, we demonstrate that miR-203 is downregulated during the epithelial commitment of embryonic stem cells, and that overexpression of miR-203 in rapidly proliferating human primary keratinocytes significantly reduces their clonogenic capacity. The results suggest that miR-203, by regulating the DeltaNp63 expression level, is a key molecule controlling the p63-dependent proliferative potential of epithelial precursor cells both during keratinocyte differentiation and in epithelial development. In addition, we have shown that miR-203 can regulate DeltaNp63 levels upon genotoxic damage in head and neck squamous cell carcinoma cells, thus controlling cell survival.
LinkOut: [PMID: 18483491]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
32 hsa-miR-203a Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000947 UVRAG UV radiation resistance associated gene 1 1
MIRT003032 ABL1 c-abl oncogene 1, receptor tyrosine kinase 2 2
MIRT004248 TP63 tumor protein p63 4 2
MIRT004713 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 4 1
MIRT004723 CDK6 cyclin-dependent kinase 6 4 1
MIRT005062 SOCS3 suppressor of cytokine signaling 3 5 3
MIRT005453 BCL2L2 BCL2-like 2 4 1
MIRT005684 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT005747 GDAP1 ganglioside-induced differentiation-associated protein 1 2 1
MIRT005749 EDNRA endothelin receptor type A 3 1
MIRT005750 EYA4 eyes absent homolog 4 (Drosophila) 3 1
MIRT006035 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT006036 BMI1 BMI1 polycomb ring finger oncogene 4 2
MIRT006037 RUNX2 runt-related transcription factor 2 3 1
MIRT006038 SMAD4 SMAD family member 4 3 1
MIRT006039 E2F1 E2F transcription factor 1 3 1
MIRT006040 MMP10 matrix metallopeptidase 10 (stromelysin 2) 3 1
MIRT006041 DLX5 distal-less homeobox 5 3 1
MIRT006061 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT006062 MMP1 matrix metallopeptidase 1 (interstitial collagenase) 1 1
MIRT006104 AKT2 v-akt murine thymoma viral oncogene homolog 2 2 1
MIRT006256 BIRC5 baculoviral IAP repeat-containing 5 2 2
MIRT006268 E2F3 E2F transcription factor 3 1 1
MIRT006269 ZNF148 zinc finger protein 148 1 1
MIRT006496 CREB1 cAMP responsive element binding protein 1 2 1
MIRT006684 TJP2 tight junction protein 2 (zona occludens 2) 2 1
MIRT006856 SOCS6 suppressor of cytokine signaling 6 1 1
MIRT006857 TNF tumor necrosis factor 1 1
MIRT006858 IL24 interleukin 24 1 1
MIRT007227 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT007353 CBLL1 Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 2 1
MIRT007368 MYD88 myeloid differentiation primary response gene (88) 3 1