Accession ID: MIRT004248 [miRNA, hsa-miR-203a-3p :: TP63, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-203aLinkOut: [miRBase ]
Description Homo sapiens miR-203a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-203a-3p
Mature Sequence 65| GUGAAAUGUUUAGGACCACUAG |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-203a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP63 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIS, B(p51A), B(p51B), EEC3, KET, LMS, NBP, OFC8, RHS, SHFM4, TP53CP, TP53L, TP73L, p40, p51, p53CP, p63, p73H, p73L
Description tumor protein p63
Transcript NM_001114978    LinkOut: [ RefSeq ]
Other Transcripts NM_001114979 , NM_001114980 , NM_001114981 , NM_001114982 , NM_003722   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP63 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP63
(miRNA target sites are highlighted)
>TP63|NM_001114978|3'UTR
   1 AAATCCCTGAGCAATTTCGACATGCGATCTGGAAGGGCATCCTGGACCACCGGCAGCTCCACGAATTCTCCTCCCCTTCT
  81 CATCTCCTGCGGACCCCAAGCAGTGCCTCTACAGTCAGTGTGGGCTCCAGTGAGACCCGGGGTGAGCGTGTTATTGATGC
 161 TGTGCGATTCACCCTCCGCCAGACCATCTCTTTCCCACCCCGAGATGAGTGGAATGACTTCAACTTTGACATGGATGCTC
 241 GCCGCAATAAGCAACAGCGCATCAAAGAGGAGGGGGAGTGAGCCTCACCATGTGAGCTCTTCCTATCCCTCTCCTAACTG
 321 CCAGCCCCCTAAAAGCACTCCTGCTTAATCTTCAAAGCCTTCTCCCTAGCTCCTCCCCTTCCTCTTGTCTGATTTCTTAG
 401 GGGAAGGAGAAGTAAGAGGCTACCTCTTACCTAACATCTGACCTGGCATCTAATTCTGATTCTGGCTTTAAGCCTTCAAA
 481 ACTATAGCTTGCAGAACTGTAGCTGCCATGGCTAGGTAGAAGTGAGCAAAAAAGAGTTGGGTGTCTCCTTAAGCTGCAGA
 561 GATTTCTCATTGACTTTTATAAAGCATGTTCACCCTTATAGTCTAAGACTATATATATAAATGTATAAATATACAGTATA
 641 GATTTTTGGGTGGGGGGCATTGAGTATTGTTTAAAATGTAATTTAAATGAAAGAAAATTGAGTTGCACTTATTGACCATT
 721 TTTTAATTTACTTGTTTTGGATGGCTTGTCTATACTCCTTCCCTTAAGGGGTATCATGTATGGTGATAGGTATCTAGAGC
 801 TTAATGCTACATGTGAGTGACGATGATGTACAGATTCTTTCAGTTCTTTGGATTCTAAATACATGCCACATCAAACCTTT
 881 GAGTAGATCCATTTCCATTGCTTATTATGTAGGTAAGACTGTAGATATGTATTCTTTTCTCAGTGTTGGTATATTTTATA
 961 TTACTGACATTTCTTCTAGTGATGATGGTTCACGTTGGGGTGATTTAATCCAGTTATAAGAAGAAGTTCATGTCCAAACG
1041 TCCTCTTTAGTTTTTGGTTGGGAATGAGGAAAATTCTTAAAAGGCCCATAGCAGCCAGTTCAAAAACACCCGACGTCATG
1121 TATTTGAGCATATCAGTAACCCCCTTAAATTTAATACCAGATACCTTATCTTACAATATTGATTGGGAAAACATTTGCTG
1201 CCATTACAGAGGTATTAAAACTAAATTTCACTACTAGATTGACTAACTCAAATACACATTTGCTACTGTTGTAAGAATTC
1281 TGATTGATTTGATTGGGATGAATGCCATCTATCTAGTTCTAACAGTGAAGTTTTACTGTCTATTAATATTCAGGGTAAAT
1361 AGGAATCATTCAGAAATGTTGAGTCTGTACTAAACAGTAAGATATCTCAATGAACCATAAATTCAACTTTGTAAAAATCT
1441 TTTGAAGCATAGATAATATTGTTTGGTAAATGTTTCTTTTGTTTGGTAAATGTTTCTTTTAAAGACCCTCCTATTCTATA
1521 AAACTCTGCATGTAGAGGCTTGTTTACCTTTCTCTCTCTAAGGTTTACAATAGGAGTGGTGATTTGAAAAATATAAAATT
1601 ATGAGATTGGTTTTCCTGTGGCATAAATTGCATCACTGTATCATTTTCTTTTTTAACCGGTAAGAGTTTCAGTTTGTTGG
1681 AAAGTAACTGTGAGAACCCAGTTTCCCGTCCATCTCCCTTAGGGACTACCCATAGACATGAAAGGTCCCCACAGAGCAAG
1761 AGATAAGTCTTTCATGGCTGCTGTTGCTTAAACCACTTAAACGAAGAGTTCCCTTGAAACTTTGGGAAAACATGTTAATG
1841 ACAATATTCCAGATCTTTCAGAAATATAACACATTTTTTTGCATGCATGCAAATGAGCTCTGAAATCTTCCCATGCATTC
1921 TGGTCAAGGGCTGTCATTGCACATAAGCTTCCATTTTAATTTTAAAGTGCAAAAGGGCCAGCGTGGCTCTAAAAGGTAAT
2001 GTGTGGATTGCCTCTGAAAAGTGTGTATATATTTTGTGTGAAATTGCATACTTTGTATTTTGATTATTTTTTTTTTCTTC
2081 TTGGGATAGTGGGATTTCCAGAACCACACTTGAAACCTTTTTTTATCGTTTTTGTATTTTCATGAAAATACCATTTAGTA
2161 AGAATACCACATCAAATAAGAAATAATGCTACAATTTTAAGAGGGGAGGGAAGGGAAAGTTTTTTTTTATTATTTTTTTA
2241 AAATTTTGTATGTTAAAGAGAATGAGTCCTTGATTTCAAAGTTTTGTTGTACTTAAATGGTAATAAGCACTGTAAACTTC
2321 TGCAACAAGCATGCAGCTTTGCAAACCCATTAAGGGGAAGAATGAAAGCTGTTCCTTGGTCCTAGTAAGAAGACAAACTG
2401 CTTCCCTTACTTTGCTGAGGGTTTGAATAAACCTAGGACTTCCGAGCTATGTCAGTACTATTCAGGTAACACTAGGGCCT
2481 TGGAAATTCCTGTACTGTGTCTCATGGATTTGGCACTAGCCAAAGCGAGGCACCCTTACTGGCTTACCTCCTCATGGCAG
2561 CCTACTCTCCTTGAGTGTATGAGTAGCCAGGGTAAGGGGTAAAAGGATAGTAAGCATAGAAACCACTAGAAAGTGGGCTT
2641 AATGGAGTTCTTGTGGCCTCAGCTCAATGCAGTTAGCTGAAGAATTGAAAAGTTTTTGTTTGGAGACGTTTATAAACAGA
2721 AATGGAAAGCAGAGTTTTCATTAAATCCTTTTACCTTTTTTTTTTCTTGGTAATCCCCTAAAATAACAGTATGTGGGATA
2801 TTGAATGTTAAAGGGATATTTTTTTCTATTATTTTTATAATTGTACAAAATTAAGCAAATGTTAAAAGTTTTATATGCTT
2881 TATTAATGTTTTCAAAAGGTATTATACATGTGATACATTTTTTAAGCTTCAGTTGCTTGTCTTCTGGTACTTTCTGTTAT
2961 GGGCTTTTGGGGAGCCAGAAGCCAATCTACAATCTCTTTTTGTTTGCCAGGACATGCAATAAAATTTAAAAAATAAATAA
3041 AAACTAATTAAGAAATTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaUCACCAGGAUU----UGUAAAGUg 5'
            || ||| :|||    | |||||| 
Target 5' acAGAGGTATTAAAACTAAATTTCAc 3'
1206 - 1231 134.00 -12.00
2
miRNA  3' gaUCAC-CAGGAUUUGUAAAGUg 5'
            | || ||||| :  |||||| 
Target 5' agAATGAGTCCTTG--ATTTCAa 3'
2259 - 2279 131.00 -10.80
3
miRNA  3' gaucaccAGGAUUUGUAAAGug 5'
                 | || :|||||||  
Target 5' tttatatTACT-GACATTTCtt 3'
955 - 975 130.00 -6.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-203a-3p :: TP63    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions Not mention
Location of target site 3'UTR
Original Description (Extracted from the article) ... these results indicate that miR-203’s effect on p63 is direct and is mediated through these 3'UTR target sites. ...

- Yi, R. Poy, M. N. Stoffel, M. Fuchs, E., 2008, Nature.

Article - Yi, R. Poy, M. N. Stoffel, M. Fuchs, E.
- Nature, 2008
In stratified epithelial tissues, homeostasis relies on the self-renewing capacity of stem cells located within the innermost basal layer. As basal cells become suprabasal, they lose proliferative potential and embark on a terminal differentiation programme. Here, we show that microRNA-203 is induced in the skin concomitantly with stratification and differentiation. By altering miR-203's spatiotemporal expression in vivo, we show that miR-203 promotes epidermal differentiation by restricting proliferative potential and inducing cell-cycle exit. We identify p63 as one of the conserved targets of miR-203 across vertebrates. Notably, p63 is an essential regulator of stem-cell maintenance in stratified epithelial tissues. We show that miR-203 directly represses the expression of p63: it fails to switch off suprabasally when either Dicer1 or miR-203 is absent and it becomes repressed basally when miR-203 is prematurely expressed. Our findings suggest that miR-203 defines a molecular boundary between proliferative basal progenitors and terminally differentiating suprabasal cells, ensuring proper identity of neighbouring layers.
LinkOut: [PMID: 18311128]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-203a-3p :: TP63    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Luciferase reporter assay , Other
Conditions HEK293E
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Together, the data presented here indicate that miR-203, by targeting ΔNp63 mRNA, acts as a switch between keratinocyte proliferation and differentiation in adult epidermis. ...

- Lena, A. M. Shalom-Feuerstein, R. Rivetti et al., 2008, Cell Death Differ.

Article - Lena, A. M. Shalom-Feuerstein, R. Rivetti et al.
- Cell Death Differ, 2008
The epidermis, the outer layer of the skin composed of keratinocytes, is a stratified epithelium that functions as a barrier to protect the organism from dehydration and external insults. The epidermis develops depending on the transcription factor p63, a member of the p53 family of transcription factors. p63 is strongly expressed in the innermost basal layer where epithelial cells with high clonogenic and proliferative capacity reside. Deletion of p63 in mice results in a dramatic loss of all keratinocytes and loss of stratified epithelia, probably due to a premature proliferative rundown of the stem and transient amplifying cells. Here we report that microRNA (miR)-203 is induced in vitro in primary keratinocytes in parallel with differentiation. We found that miR-203 specifically targets human and mouse p63 3'-UTRs and not SOCS-3, despite bioinformatics alignment between miR-203 and SOCS-3 3'-UTR. We also show that miR-203 overexpression in proliferating keratinocytes is not sufficient to induce full epidermal differentiation in vitro. In addition, we demonstrate that miR-203 is downregulated during the epithelial commitment of embryonic stem cells, and that overexpression of miR-203 in rapidly proliferating human primary keratinocytes significantly reduces their clonogenic capacity. The results suggest that miR-203, by regulating the DeltaNp63 expression level, is a key molecule controlling the p63-dependent proliferative potential of epithelial precursor cells both during keratinocyte differentiation and in epithelial development. In addition, we have shown that miR-203 can regulate DeltaNp63 levels upon genotoxic damage in head and neck squamous cell carcinoma cells, thus controlling cell survival.
LinkOut: [PMID: 18483491]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-203a-3p :: TP63    [ Functional MTI ]
Validation Method
Article - Bracke, S. Desmet, E. Guerrero-Aspizua, S. et al.
- Arch Dermatol Res, 2013
Diseases of the skin are amenable to RNAi-based therapies and targeting key components in the pathophysiology of psoriasis using RNAi may represent a successful new therapeutic strategy. We aimed to develop a straightforward and highly reproducible in vitro psoriasis model useful to study the effects of gene knockdown by RNAi and to identify new targets for topical RNAi therapeutics. We evaluated the use of keratinocytes derived from psoriatic plaques and normal human keratinocytes (NHKs). To induce a psoriatic phenotype in NHKs, combinations of pro-inflammatory cytokines (IL-1alpha, IL-17A, IL-6 and TNF-alpha) were tested. The model based on NHK met our needs of a reliable and predictive preclinical model, and this model was further selected for gene expression analyses, comprising a panel of 55 psoriasis-associated genes and five micro-RNAs (miRNAs). Gene silencing studies were conducted by using small interfering RNAs (siRNAs) and miRNA inhibitors directed against potential target genes such as CAMP and DEFB4 and miRNAs such as miR-203. We describe a robust and highly reproducible in vitro psoriasis model that recapitulates expression of a large panel of genes and miRNAs relevant to the pathogenesis of psoriasis. Furthermore, we show that our model is a powerful first step model system for testing and screening RNAi-based therapeutics.
LinkOut: [PMID: 23775225]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
285 hsa-miR-203a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000947 UVRAG UV radiation resistance associated gene 3 2
MIRT003032 ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 4 4
MIRT004248 TP63 tumor protein p63 4 4
MIRT004713 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 4 1
MIRT004723 CDK6 cyclin-dependent kinase 6 4 2
MIRT005062 SOCS3 suppressor of cytokine signaling 3 5 4
MIRT005453 BCL2L2 BCL2-like 2 4 2
MIRT005684 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT005747 GDAP1 ganglioside induced differentiation associated protein 1 2 1
MIRT005749 EDNRA endothelin receptor type A 3 1
MIRT005750 EYA4 eyes absent homolog 4 (Drosophila) 3 1
MIRT006035 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT006036 BMI1 BMI1 polycomb ring finger oncogene 4 3
MIRT006037 RUNX2 runt-related transcription factor 2 3 1
MIRT006038 SMAD4 SMAD family member 4 3 1
MIRT006039 E2F1 E2F transcription factor 1 3 1
MIRT006040 MMP10 matrix metallopeptidase 10 (stromelysin 2) 3 1
MIRT006041 DLX5 distal-less homeobox 5 3 1
MIRT006061 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT006062 MMP1 matrix metallopeptidase 1 (interstitial collagenase) 1 1
MIRT006104 AKT2 v-akt murine thymoma viral oncogene homolog 2 2 1
MIRT006256 BIRC5 baculoviral IAP repeat containing 5 3 4
MIRT006268 E2F3 E2F transcription factor 3 1 1
MIRT006269 ZNF148 zinc finger protein 148 1 1
MIRT006496 CREB1 cAMP responsive element binding protein 1 2 1
MIRT006684 TJP2 tight junction protein 2 2 1
MIRT006856 SOCS6 suppressor of cytokine signaling 6 1 1
MIRT006857 TNF tumor necrosis factor 1 1
MIRT006858 IL24 interleukin 24 1 1
MIRT007227 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT007353 CBLL1 Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1 2 1
MIRT007368 MYD88 myeloid differentiation primary response gene (88) 3 1
MIRT052913 LIFR leukemia inhibitory factor receptor alpha 3 2
MIRT053001 LASP1 LIM and SH3 protein 1 3 2
MIRT053050 JUN jun proto-oncogene 2 1
MIRT053072 PRKCA protein kinase C, alpha 1 1
MIRT053074 VEGFA vascular endothelial growth factor A 3 1
MIRT053162 ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 2 1
MIRT053182 CAV1 caveolin 1, caveolae protein, 22kDa 2 1
MIRT053284 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 4 3
MIRT053439 RASAL2 RAS protein activator like 2 1 1
MIRT053440 MAP3K13 mitogen-activated protein kinase kinase kinase 13 1 1
MIRT053441 NFYA nuclear transcription factor Y, alpha 1 1
MIRT053442 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT053443 TCF4 transcription factor 4 1 1
MIRT053444 ZEB1 zinc finger E-box binding homeobox 1 1 1
MIRT053445 SMAD9 SMAD family member 9 1 1
MIRT053446 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT053447 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT053448 FOXK1 forkhead box K1 1 1
MIRT054036 RAN RAN, member RAS oncogene family 3 3
MIRT054037 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 3 1
MIRT054155 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 3 1
MIRT054650 PLD2 phospholipase D2 3 1
MIRT055312 DUSP5 dual specificity phosphatase 5 1 4
MIRT057675 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT065601 DAZAP2 DAZ associated protein 2 1 1
MIRT066772 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT077699 ZNF652 zinc finger protein 652 1 1
MIRT080180 PRKACB protein kinase, cAMP-dependent, catalytic, beta 1 1
MIRT085787 FMNL2 formin-like 2 1 1
MIRT088207 NUP50 nucleoporin 50kDa 1 1
MIRT093685 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT093985 SLAIN2 SLAIN motif family, member 2 1 1
MIRT102957 EN2 engrailed homeobox 2 1 2
MIRT103094 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 2
MIRT126758 KIF5B kinesin family member 5B 1 1
MIRT128546 ATM ataxia telangiectasia mutated 3 3
MIRT145264 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT154739 GPCPD1 glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) 1 1
MIRT175932 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT178788 RNF141 ring finger protein 141 1 1
MIRT181056 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT186625 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 4
MIRT191635 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT201887 C20ORF24 chromosome 20 open reading frame 24 1 1
MIRT208759 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT209229 PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha 3 1
MIRT223291 TRIM4 tripartite motif containing 4 1 1
MIRT238790 TPD52L1 tumor protein D52-like 1 1 1
MIRT238940 DYNLT1 dynein, light chain, Tctex-type 1 1 2
MIRT244403 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 2
MIRT265630 LDHA lactate dehydrogenase A 1 1
MIRT271109 ZNF268 zinc finger protein 268 1 1
MIRT279268 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT282645 SYNM synemin, intermediate filament protein 1 1
MIRT288811 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 1 1
MIRT301214 SH3BP4 SH3-domain binding protein 4 1 1
MIRT397242 IPO7 importin 7 1 1
MIRT437408 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 3 1
MIRT437575 ALOX15 arachidonate 15-lipoxygenase 2 1
MIRT438097 KIF2A kinesin heavy chain member 2A 1 1
MIRT438895 SNAI1 snail homolog 1 (Drosophila) 5 1
MIRT441555 TBCEL tubulin folding cofactor E-like 1 1
MIRT441676 CXXC4 CXXC finger protein 4 1 1
MIRT441699 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT442592 SIX1 SIX homeobox 1 1 1
MIRT443012 PDE7A phosphodiesterase 7A 1 1
MIRT443416 HOXA1 homeobox A1 1 1
MIRT443954 MIDN midnolin 1 1
MIRT444028 GREM1 gremlin 1 1 1
MIRT444191 TRIML2 tripartite motif family-like 2 1 1
MIRT444573 NCOA4 nuclear receptor coactivator 4 1 1
MIRT444666 CDKL2 cyclin-dependent kinase-like 2 (CDC2-related kinase) 1 1
MIRT444687 ARHGEF28 Rho guanine nucleotide exchange factor (GEF) 28 1 1
MIRT444820 CERKL ceramide kinase-like 1 1
MIRT444825 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 1
MIRT445215 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT445262 LOH12CR2 loss of heterozygosity, 12, chromosomal region 2 (non-protein coding) 1 2
MIRT445782 BMPR1A bone morphogenetic protein receptor, type IA 1 1
MIRT445929 UFL1 UFM1-specific ligase 1 1 1
MIRT446101 TSC22D2 TSC22 domain family, member 2 1 2
MIRT446239 HELZ helicase with zinc finger 1 1
MIRT446361 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT446789 KIF1C kinesin family member 1C 1 1
MIRT446893 MCM9 minichromosome maintenance complex component 9 1 1
MIRT447329 PEAR1 platelet endothelial aggregation receptor 1 1 1
MIRT447353 STOM stomatin 1 1
MIRT447363 RASA2 RAS p21 protein activator 2 1 1
MIRT447614 CUL3 cullin 3 1 1
MIRT447665 IL7 interleukin 7 1 1
MIRT447681 ASPA aspartoacylase 1 1
MIRT447817 ZCCHC11 zinc finger, CCHC domain containing 11 1 1
MIRT447867 TRNT1 tRNA nucleotidyl transferase, CCA-adding, 1 1 1
MIRT447936 NUDCD1 NudC domain containing 1 1 1
MIRT447958 WDR77 WD repeat domain 77 1 1
MIRT447982 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT448274 ZNF704 zinc finger protein 704 1 1
MIRT448504 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 1 1
MIRT448518 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT448547 RGS17 regulator of G-protein signaling 17 1 1
MIRT448662 NCALD neurocalcin delta 1 1
MIRT448681 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT448799 GLIS3 GLIS family zinc finger 3 1 1
MIRT448805 GABRB1 gamma-aminobutyric acid (GABA) A receptor, beta 1 1 2
MIRT448897 CNNM3 cyclin M3 1 1
MIRT448898 CLOCK clock homolog (mouse) 1 1
MIRT449317 MRO maestro 1 1
MIRT449585 SLC44A1 solute carrier family 44, member 1 1 1
MIRT449762 ENAH enabled homolog (Drosophila) 1 2
MIRT449767 PRAMEF7 PRAME family member 7 1 1
MIRT449803 PRAMEF8 PRAME family member 8 1 1
MIRT449979 OIT3 oncoprotein induced transcript 3 1 1
MIRT450380 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT450520 ZBED3 zinc finger, BED-type containing 3 1 2
MIRT450637 ZNF654 zinc finger protein 654 1 1
MIRT450647 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT450651 TMEM70 transmembrane protein 70 1 1
MIRT450661 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT450850 HTR2A 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled 1 1
MIRT457938 LCE1A late cornified envelope 1A 1 1
MIRT464203 VGLL4 vestigial like 4 (Drosophila) 1 2
MIRT465075 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 2
MIRT465195 TRPS1 trichorhinophalangeal syndrome I 1 1
MIRT465208 TRMT5 tRNA methyltransferase 5 homolog (S. cerevisiae) 1 2
MIRT465754 TMPPE transmembrane protein with metallophosphoesterase domain 1 1
MIRT469008 RNF41 ring finger protein 41 1 1
MIRT469357 RGL2 ral guanine nucleotide dissociation stimulator-like 2 1 1
MIRT475962 GXYLT1 glucoside xylosyltransferase 1 1 2
MIRT476756 FOXK2 forkhead box K2 1 1
MIRT476888 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 1 1
MIRT477804 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478139 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT480069 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT480097 CALR calreticulin 1 1
MIRT481591 ARID2 AT rich interactive domain 2 (ARID, RFX-like) 1 1
MIRT483717 MXRA7 matrix-remodelling associated 7 1 2
MIRT490883 OSBP oxysterol binding protein 1 1
MIRT491783 ZNF24 zinc finger protein 24 1 1
MIRT492496 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT493641 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 1 1
MIRT493765 GNAS GNAS complex locus 1 1
MIRT494798 ANKRD13B ankyrin repeat domain 13B 1 2
MIRT495219 DSCR3 Down syndrome critical region gene 3 1 1
MIRT496213 PAX6 paired box 6 1 1
MIRT496509 G6PC glucose-6-phosphatase, catalytic subunit 1 1
MIRT497059 C6orf223 chromosome 6 open reading frame 223 1 1
MIRT497205 CDH7 cadherin 7, type 2 1 1
MIRT497444 ZUFSP zinc finger with UFM1-specific peptidase domain 1 1
MIRT497586 SLC23A1 solute carrier family 23 (nucleobase transporters), member 1 1 1
MIRT497605 PCGF6 polycomb group ring finger 6 1 1
MIRT497955 DGAT2 diacylglycerol O-acyltransferase 2 1 1
MIRT498109 PRR14L proline rich 14-like 1 1
MIRT498213 ACVR2B activin A receptor, type IIB 1 1
MIRT498670 SOD2 superoxide dismutase 2, mitochondrial 1 2
MIRT501139 SLC12A5 solute carrier family 12 (potassium/chloride transporter), member 5 1 1
MIRT501195 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501966 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT504620 DNAAF2 dynein, axonemal, assembly factor 2 1 2
MIRT505037 ZNF451 zinc finger protein 451 1 1
MIRT506309 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 2
MIRT507667 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 2
MIRT508806 MTPN myotrophin 1 2
MIRT510935 PRNP prion protein 1 2
MIRT513454 NARS asparaginyl-tRNA synthetase 1 3
MIRT514047 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 3
MIRT516494 GLRX2 glutaredoxin 2 1 2
MIRT521434 RAP2B RAP2B, member of RAS oncogene family 1 1
MIRT521616 PSAT1 phosphoserine aminotransferase 1 1 2
MIRT523769 FBXL5 F-box and leucine-rich repeat protein 5 1 3
MIRT525030 FRK fyn-related kinase 1 1
MIRT527124 NPPC natriuretic peptide C 1 1
MIRT529125 HOMEZ homeobox and leucine zipper encoding 1 1
MIRT529628 SERINC1 serine incorporator 1 1 1
MIRT531326 SEMA3D sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D 1 1
MIRT537324 FOXN3 forkhead box N3 1 1
MIRT538062 DLC1 deleted in liver cancer 1 1 1
MIRT538670 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT541003 ZNF367 zinc finger protein 367 1 2
MIRT541386 CDC42SE2 CDC42 small effector 2 1 1
MIRT541454 C15orf48 chromosome 15 open reading frame 48 1 1
MIRT542969 FBXL3 F-box and leucine-rich repeat protein 3 1 1
MIRT543744 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT544102 IPMK inositol polyphosphate multikinase 1 1
MIRT544354 EGLN1 egl nine homolog 1 (C. elegans) 1 1
MIRT545164 SPATA18 spermatogenesis associated 18 1 1
MIRT545661 TMEM97 transmembrane protein 97 1 2
MIRT545878 ZNF200 zinc finger protein 200 1 2
MIRT546522 SERTAD3 SERTA domain containing 3 1 1
MIRT546769 RLIM ring finger protein, LIM domain interacting 1 1
MIRT547018 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT547307 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 2
MIRT547330 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT547935 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT548130 GAS1 growth arrest-specific 1 1 1
MIRT548147 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT548751 CNNM4 cyclin M4 1 1
MIRT549150 BOLA3 bolA homolog 3 (E. coli) 1 1
MIRT550013 KIAA0408 KIAA0408 1 1
MIRT553089 UBXN2A UBX domain protein 2A 1 2
MIRT554078 SNX4 sorting nexin 4 1 2
MIRT555244 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT555743 PDCD10 programmed cell death 10 1 1
MIRT556686 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT557679 GATA6 GATA binding protein 6 1 1
MIRT558042 EXT1 exostosin 1 1 1
MIRT558428 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT561547 SON SON DNA binding protein 1 1
MIRT562014 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT562150 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT562666 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT562980 PARK7 parkinson protein 7 1 1
MIRT563486 ZWINT ZW10 interactor 1 1
MIRT563698 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT565224 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT566421 PIM3 pim-3 oncogene 1 1
MIRT567553 FGFR1OP FGFR1 oncogene partner 1 1
MIRT568079 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT568462 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT571878 NCL nucleolin 1 1
MIRT574669 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 1
MIRT575532 Map4 microtubule-associated protein 4 1 1
MIRT576358 Pxdn peroxidasin homolog (Drosophila) 1 1
MIRT576727 Wars tryptophanyl-tRNA synthetase 1 1
MIRT614707 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT616036 SCO1 SCO1 cytochrome c oxidase assembly protein 1 1
MIRT618699 KIF13A kinesin family member 13A 1 1
MIRT620744 CCR5 chemokine (C-C motif) receptor 5 (gene/pseudogene) 1 1
MIRT622330 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT623629 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT624467 CADM2 cell adhesion molecule 2 1 1
MIRT631737 NKX2-1 NK2 homeobox 1 1 1
MIRT643533 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT647868 HEPHL1 hephaestin-like 1 1 1
MIRT651564 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT653193 SPATA13 spermatogenesis associated 13 1 1
MIRT653359 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT656417 MCTP1 multiple C2 domains, transmembrane 1 1 1
MIRT657543 GSTO2 glutathione S-transferase omega 2 1 1
MIRT657873 GINS4 GINS complex subunit 4 (Sld5 homolog) 1 1
MIRT658413 FAM208A family with sequence similarity 208, member A 1 1
MIRT669999 GPR156 G protein-coupled receptor 156 1 2
MIRT685433 PM20D2 peptidase M20 domain containing 2 1 1
MIRT690898 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT691541 FLYWCH2 FLYWCH family member 2 1 1
MIRT699171 SMAD2 SMAD family member 2 1 1
MIRT702974 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT705181 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT707672 EXOC2 exocyst complex component 2 1 1
MIRT707886 SLC45A4 solute carrier family 45, member 4 1 1
MIRT708053 MARCH3 membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase 1 1
MIRT709776 SYK spleen tyrosine kinase 1 1
MIRT710009 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT722945 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT723522 CLPTM1L CLPTM1-like 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*