Accession ID: MIRT004281 [miRNA, hsa-miR-92a-3p :: TP63, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-92a-1LinkOut: [miRBase ]
Synonyms MIR92-1, MIRN92-1, MIRN92A-1, MIRN92A1, miRNA92-1, MIR92A1
Description Homo sapiens miR-92a-1 stem-loop
Comment Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (named mir-92-13 in .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-92a-3p
Mature Sequence 48| UAUUGCACUUGUCCCGGCCUGU |69
Evidence Experimental
Experiments Cloned
Putative hsa-miR-92a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP63 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIS, B(p51A), B(p51B), EEC3, KET, LMS, NBP, OFC8, RHS, SHFM4, TP53CP, TP53L, TP73L, p40, p51, p53CP, p63, p73H, p73L
Description tumor protein p63
Transcript NM_001114978    LinkOut: [ RefSeq ]
Other Transcripts NM_001114979 , NM_001114980 , NM_001114981 , NM_001114982 , NM_003722   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP63 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP63
(miRNA target sites are highlighted)
>TP63|NM_001114978|3'UTR
   1 AAATCCCTGAGCAATTTCGACATGCGATCTGGAAGGGCATCCTGGACCACCGGCAGCTCCACGAATTCTCCTCCCCTTCT
  81 CATCTCCTGCGGACCCCAAGCAGTGCCTCTACAGTCAGTGTGGGCTCCAGTGAGACCCGGGGTGAGCGTGTTATTGATGC
 161 TGTGCGATTCACCCTCCGCCAGACCATCTCTTTCCCACCCCGAGATGAGTGGAATGACTTCAACTTTGACATGGATGCTC
 241 GCCGCAATAAGCAACAGCGCATCAAAGAGGAGGGGGAGTGAGCCTCACCATGTGAGCTCTTCCTATCCCTCTCCTAACTG
 321 CCAGCCCCCTAAAAGCACTCCTGCTTAATCTTCAAAGCCTTCTCCCTAGCTCCTCCCCTTCCTCTTGTCTGATTTCTTAG
 401 GGGAAGGAGAAGTAAGAGGCTACCTCTTACCTAACATCTGACCTGGCATCTAATTCTGATTCTGGCTTTAAGCCTTCAAA
 481 ACTATAGCTTGCAGAACTGTAGCTGCCATGGCTAGGTAGAAGTGAGCAAAAAAGAGTTGGGTGTCTCCTTAAGCTGCAGA
 561 GATTTCTCATTGACTTTTATAAAGCATGTTCACCCTTATAGTCTAAGACTATATATATAAATGTATAAATATACAGTATA
 641 GATTTTTGGGTGGGGGGCATTGAGTATTGTTTAAAATGTAATTTAAATGAAAGAAAATTGAGTTGCACTTATTGACCATT
 721 TTTTAATTTACTTGTTTTGGATGGCTTGTCTATACTCCTTCCCTTAAGGGGTATCATGTATGGTGATAGGTATCTAGAGC
 801 TTAATGCTACATGTGAGTGACGATGATGTACAGATTCTTTCAGTTCTTTGGATTCTAAATACATGCCACATCAAACCTTT
 881 GAGTAGATCCATTTCCATTGCTTATTATGTAGGTAAGACTGTAGATATGTATTCTTTTCTCAGTGTTGGTATATTTTATA
 961 TTACTGACATTTCTTCTAGTGATGATGGTTCACGTTGGGGTGATTTAATCCAGTTATAAGAAGAAGTTCATGTCCAAACG
1041 TCCTCTTTAGTTTTTGGTTGGGAATGAGGAAAATTCTTAAAAGGCCCATAGCAGCCAGTTCAAAAACACCCGACGTCATG
1121 TATTTGAGCATATCAGTAACCCCCTTAAATTTAATACCAGATACCTTATCTTACAATATTGATTGGGAAAACATTTGCTG
1201 CCATTACAGAGGTATTAAAACTAAATTTCACTACTAGATTGACTAACTCAAATACACATTTGCTACTGTTGTAAGAATTC
1281 TGATTGATTTGATTGGGATGAATGCCATCTATCTAGTTCTAACAGTGAAGTTTTACTGTCTATTAATATTCAGGGTAAAT
1361 AGGAATCATTCAGAAATGTTGAGTCTGTACTAAACAGTAAGATATCTCAATGAACCATAAATTCAACTTTGTAAAAATCT
1441 TTTGAAGCATAGATAATATTGTTTGGTAAATGTTTCTTTTGTTTGGTAAATGTTTCTTTTAAAGACCCTCCTATTCTATA
1521 AAACTCTGCATGTAGAGGCTTGTTTACCTTTCTCTCTCTAAGGTTTACAATAGGAGTGGTGATTTGAAAAATATAAAATT
1601 ATGAGATTGGTTTTCCTGTGGCATAAATTGCATCACTGTATCATTTTCTTTTTTAACCGGTAAGAGTTTCAGTTTGTTGG
1681 AAAGTAACTGTGAGAACCCAGTTTCCCGTCCATCTCCCTTAGGGACTACCCATAGACATGAAAGGTCCCCACAGAGCAAG
1761 AGATAAGTCTTTCATGGCTGCTGTTGCTTAAACCACTTAAACGAAGAGTTCCCTTGAAACTTTGGGAAAACATGTTAATG
1841 ACAATATTCCAGATCTTTCAGAAATATAACACATTTTTTTGCATGCATGCAAATGAGCTCTGAAATCTTCCCATGCATTC
1921 TGGTCAAGGGCTGTCATTGCACATAAGCTTCCATTTTAATTTTAAAGTGCAAAAGGGCCAGCGTGGCTCTAAAAGGTAAT
2001 GTGTGGATTGCCTCTGAAAAGTGTGTATATATTTTGTGTGAAATTGCATACTTTGTATTTTGATTATTTTTTTTTTCTTC
2081 TTGGGATAGTGGGATTTCCAGAACCACACTTGAAACCTTTTTTTATCGTTTTTGTATTTTCATGAAAATACCATTTAGTA
2161 AGAATACCACATCAAATAAGAAATAATGCTACAATTTTAAGAGGGGAGGGAAGGGAAAGTTTTTTTTTATTATTTTTTTA
2241 AAATTTTGTATGTTAAAGAGAATGAGTCCTTGATTTCAAAGTTTTGTTGTACTTAAATGGTAATAAGCACTGTAAACTTC
2321 TGCAACAAGCATGCAGCTTTGCAAACCCATTAAGGGGAAGAATGAAAGCTGTTCCTTGGTCCTAGTAAGAAGACAAACTG
2401 CTTCCCTTACTTTGCTGAGGGTTTGAATAAACCTAGGACTTCCGAGCTATGTCAGTACTATTCAGGTAACACTAGGGCCT
2481 TGGAAATTCCTGTACTGTGTCTCATGGATTTGGCACTAGCCAAAGCGAGGCACCCTTACTGGCTTACCTCCTCATGGCAG
2561 CCTACTCTCCTTGAGTGTATGAGTAGCCAGGGTAAGGGGTAAAAGGATAGTAAGCATAGAAACCACTAGAAAGTGGGCTT
2641 AATGGAGTTCTTGTGGCCTCAGCTCAATGCAGTTAGCTGAAGAATTGAAAAGTTTTTGTTTGGAGACGTTTATAAACAGA
2721 AATGGAAAGCAGAGTTTTCATTAAATCCTTTTACCTTTTTTTTTTCTTGGTAATCCCCTAAAATAACAGTATGTGGGATA
2801 TTGAATGTTAAAGGGATATTTTTTTCTATTATTTTTATAATTGTACAAAATTAAGCAAATGTTAAAAGTTTTATATGCTT
2881 TATTAATGTTTTCAAAAGGTATTATACATGTGATACATTTTTTAAGCTTCAGTTGCTTGTCTTCTGGTACTTTCTGTTAT
2961 GGGCTTTTGGGGAGCCAGAAGCCAATCTACAATCTCTTTTTGTTTGCCAGGACATGCAATAAAATTTAAAAAATAAATAA
3041 AAACTAATTAAGAAATTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugucCGGCCCUGUUCACGUUAu 5'
              ||| |||||  |||||| 
Target 5' gtttGCCAGGACA--TGCAATa 3'
3002 - 3021 141.00 -17.00
2
miRNA  3' uguccGGCCCUGUUCACGUUAu 5'
               ||| ||::|||| ||| 
Target 5' ccaccCCGAGATGAGTGGAATg 3'
195 - 216 137.00 -15.60
3
miRNA  3' uguccggcccugUUCACGUUau 5'
                      ||||||||  
Target 5' attttaattttaAAGTGCAAaa 3'
1953 - 1974 130.00 -7.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-92a-3p :: TP63    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions HaCaT
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... As shown in Fig. 4A, transient overexpression of miR-92 in 32D cells resulted in a decrease of the Np63 protein level compared with that observed in cells transfected with the scrambled oligonucleotide or in nontransfected cells ...

- Manni, I. Artuso, S. Careccia, S. Rizzo, M. et al., 2009, FASEB J.

Article - Manni, I. Artuso, S. Careccia, S. Rizzo, M. et al.
- FASEB J, 2009
MicroRNAs (miRs) are 21- to 23-nucleotide RNA molecules that regulate the stability or translational efficiency of target messenger RNAs of proteins involved in cell growth and apoptosis. miR-92 is part of the mir-17-92 cluster, which comprises members with an effect on cell proliferation. However, the role of miR-92 is unknown, and its targets have not been identified. Here, we describe a mechanism through which miR-92 contributes to regulate cell proliferation. Using a miR-92 synthetic double-strand oligonucleotide, we demonstrate that miR-92 increases 32D myeloid cell proliferation and 5-bromo-2-deoxyuridine (BrdU) incorporation and inhibits cell death. The effect is miR-92 specific since the miR-92 antagomir inhibits cell proliferation. Moreover, we show that miR-92 acts by modulating p63-isoform abundance through down-regulatation of endogenous DeltaNp63beta. Using luciferase reporters containing p63 3;UTR fragments with wild-type or mutant miR-92 complementary sites, we demonstrate that the wild-type 3;UTR is a direct target of miR-92. Finally, we observed that a miR-92-resistant DeltaNp63beta isoform (without 3;UTR) inhibits cell proliferation and parallels the effect of the antagomir. We conclude that one of the molecular mechanisms through which miR-92 increases cell proliferation is by negative regulation of an isoform of the cell-cycle regulator p63.-Manni, I., Artuso, S., Careccia, S., Rizzo, M. G., Baserga, R., Piaggio, G., Sacchi, A. The microRNA miR-92 increases proliferation of myeloid cells and by targeting p63 modulates the abundance of its isoforms.
LinkOut: [PMID: 19608627]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1334 hsa-miR-92a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001199 UVRAG UV radiation resistance associated gene 1 1
MIRT003031 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 4 1
MIRT004089 ARID4B AT rich interactive domain 4B (RBP1-like) 2 1
MIRT004090 HIPK3 homeodomain interacting protein kinase 3 2 1
MIRT004091 MYLIP myosin regulatory light chain interacting protein 3 5
MIRT004281 TP63 tumor protein p63 4 1
MIRT004331 KAT2B K(lysine) acetyltransferase 2B 4 2
MIRT004563 ESR2 estrogen receptor 2 (ER beta) 2 1
MIRT004737 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 4 2
MIRT004932 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 5 2
MIRT005590 CPEB2 cytoplasmic polyadenylation element binding protein 2 4 2
MIRT005628 THBS1 thrombospondin 1 3 1
MIRT005632 SMAD4 SMAD family member 4 2 1
MIRT006029 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 2 1
MIRT006148 BCL2L11 BCL2-like 11 (apoptosis facilitator) 4 8
MIRT006372 KLF2 Kruppel-like factor 2 (lung) 2 1
MIRT048915 TPD52L3 tumor protein D52-like 3 1 1
MIRT048916 TXLNA taxilin alpha 1 3
MIRT048917 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 1 1
MIRT048918 EFNB1 ephrin-B1 1 1
MIRT048919 RPL39 ribosomal protein L39 1 1
MIRT048920 TMF1 TATA element modulatory factor 1 1 6
MIRT048921 KCTD7 potassium channel tetramerisation domain containing 7 1 1
MIRT048922 VBP1 von Hippel-Lindau binding protein 1 1 1
MIRT048923 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048924 TRAPPC13 chromosome 5 open reading frame 44 1 1
MIRT048925 NEK2 NIMA (never in mitosis gene a)-related kinase 2 1 1
MIRT048926 CYP7A1 cytochrome P450, family 7, subfamily A, polypeptide 1 1 1
MIRT048927 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT048928 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 1 1
MIRT048929 RPS24 ribosomal protein S24 1 1
MIRT048930 FAM83G family with sequence similarity 83, member G 1 1
MIRT048931 BCS1L BC1 (ubiquinol-cytochrome c reductase) synthesis-like 1 1
MIRT048932 DTWD2 DTW domain containing 2 1 1
MIRT048933 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 1
MIRT048934 C1orf174 chromosome 1 open reading frame 174 1 1
MIRT048935 CUX1 cut-like homeobox 1 2 1
MIRT048936 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 1 1
MIRT048937 PON2 paraoxonase 2 1 1
MIRT048938 STK4 serine/threonine kinase 4 1 1
MIRT048939 CHST9 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 1 1
MIRT048940 SHISA5 shisa homolog 5 (Xenopus laevis) 1 1
MIRT048941 CD3EAP CD3e molecule, epsilon associated protein 1 1
MIRT048942 GCHFR GTP cyclohydrolase I feedback regulator 1 1
MIRT048943 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT048944 CEP97 centrosomal protein 97kDa 1 1
MIRT048945 IPO4 importin 4 1 1
MIRT048946 POLE polymerase (DNA directed), epsilon, catalytic subunit 1 1
MIRT048947 SETDB1 SET domain, bifurcated 1 1 1
MIRT048948 GABPA GA binding protein transcription factor, alpha subunit 60kDa 1 1
MIRT048949 ATAD3A ATPase family, AAA domain containing 3A 1 1
MIRT048950 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT048951 TYMP thymidine phosphorylase 1 1
MIRT048952 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT048953 IK IK cytokine, down-regulator of HLA II 1 1
MIRT048954 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT048955 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT048956 QTRT1 queuine tRNA-ribosyltransferase 1 1 1
MIRT048957 ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1 1 1
MIRT048958 SAP30BP SAP30 binding protein 1 1
MIRT048959 RORA RAR-related orphan receptor A 2 1
MIRT048960 ELAC2 elaC homolog 2 (E. coli) 1 1
MIRT048961 HNRNPLL heterogeneous nuclear ribonucleoprotein L-like 1 1
MIRT048962 ETV6 ets variant 6 1 1
MIRT048963 PRRC2B proline-rich coiled-coil 2B 1 3
MIRT048964 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT048965 ALKBH4 alkB, alkylation repair homolog 4 (E. coli) 1 1
MIRT048966 DAZAP1 DAZ associated protein 1 1 1
MIRT048967 IPO7 importin 7 1 1
MIRT048968 CTC1 CTS telomere maintenance complex component 1 1 1
MIRT048969 CHCHD10 coiled-coil-helix-coiled-coil-helix domain containing 10 1 1
MIRT048970 BSG basigin (Ok blood group) 1 1
MIRT048971 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT048972 NMD3 NMD3 homolog (S. cerevisiae) 1 1
MIRT048973 MRPL32 mitochondrial ribosomal protein L32 1 1
MIRT048974 RPL11 ribosomal protein L11 1 1
MIRT048975 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT048976 BAK1 BCL2-antagonist/killer 1 1 2
MIRT048977 MYH2 myosin, heavy chain 2, skeletal muscle, adult 1 1
MIRT048978 INSIG1 insulin induced gene 1 1 3
MIRT048979 GARNL3 GTPase activating Rap/RanGAP domain-like 3 1 1
MIRT048980 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 1 2
MIRT048981 TUBB2B tubulin, beta 2B class IIb 1 1
MIRT048982 RPL24 ribosomal protein L24 1 1
MIRT048983 HELQ helicase, POLQ-like 1 1
MIRT048984 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like 1 1
MIRT048985 PLA2G4F phospholipase A2, group IVF 1 1
MIRT048986 HERC1 HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 1 1
MIRT048987 RASAL2 RAS protein activator like 2 2 1
MIRT048988 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT048989 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT048990 TALDO1 transaldolase 1 1 1
MIRT048991 CCDC6 coiled-coil domain containing 6 1 1
MIRT048992 RNF128 ring finger protein 128, E3 ubiquitin protein ligase 1 1
MIRT048993 CLNS1A chloride channel, nucleotide-sensitive, 1A 1 1
MIRT048994 NUCB1 nucleobindin 1 1 1
MIRT048995 POTEG POTE ankyrin domain family, member G 1 1
MIRT048996 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT048997 USP9X ubiquitin specific peptidase 9, X-linked 1 1
MIRT048998 BLMH bleomycin hydrolase 1 1
MIRT048999 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT049000 SEC14L1 SEC14-like 1 (S. cerevisiae) 1 1
MIRT049001 EIF3I eukaryotic translation initiation factor 3, subunit I 1 1
MIRT049002 NCL nucleolin 1 1
MIRT049003 MAP1B microtubule-associated protein 1B 1 3
MIRT049004 GOLIM4 golgi integral membrane protein 4 1 1
MIRT049005 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT049006 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT049007 PLEKHB1 pleckstrin homology domain containing, family B (evectins) member 1 1 1
MIRT049008 CCNI cyclin I 1 1
MIRT049009 RPS25 ribosomal protein S25 1 1
MIRT049010 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT049011 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT049012 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 1
MIRT049013 GANAB glucosidase, alpha; neutral AB 1 1
MIRT049014 CRBN cereblon 1 1
MIRT049015 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT049016 LPIN1 lipin 1 1 1
MIRT049017 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT049018 GPR89A G protein-coupled receptor 89A 1 1
MIRT049019 CBX6 chromobox homolog 6 1 1
MIRT049020 ANKLE2 ankyrin repeat and LEM domain containing 2 1 1
MIRT049021 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT049022 NUDCD3 NudC domain containing 3 1 1
MIRT049023 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT049024 PKM pyruvate kinase, muscle 1 1
MIRT049025 NUP205 nucleoporin 205kDa 1 1
MIRT049026 RASA3 RAS p21 protein activator 3 1 1
MIRT049027 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT049028 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 1 1
MIRT049029 GHITM growth hormone inducible transmembrane protein 1 1
MIRT049030 PLEKHH3 pleckstrin homology domain containing, family H (with MyTH4 domain) member 3 1 1
MIRT049031 RCAN1 regulator of calcineurin 1 1 1
MIRT049032 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT049033 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT049034 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT049035 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT049036 SLAIN1 SLAIN motif family, member 1 1 1
MIRT049037 NPLOC4 nuclear protein localization 4 homolog (S. cerevisiae) 1 1
MIRT049038 DOT1L DOT1-like, histone H3 methyltransferase (S. cerevisiae) 1 1
MIRT049039 TPRN taperin 1 1
MIRT049040 RPL27 ribosomal protein L27 1 1
MIRT049041 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT049042 DHRS3 dehydrogenase/reductase (SDR family) member 3 1 1
MIRT049043 FKBP1A FK506 binding protein 1A, 12kDa 1 3
MIRT049044 HIST1H3D histone cluster 1, H3d 1 1
MIRT049045 ZNF785 zinc finger protein 785 1 1
MIRT049046 ACAT2 acetyl-CoA acetyltransferase 2 1 1
MIRT049047 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1 1
MIRT049048 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT049049 TAOK2 TAO kinase 2 1 1
MIRT049050 POLRMT polymerase (RNA) mitochondrial (DNA directed) 1 1
MIRT049051 EFNA5 ephrin-A5 1 1
MIRT049052 SHC3 SHC (Src homology 2 domain containing) transforming protein 3 1 1
MIRT049053 POLI polymerase (DNA directed) iota 1 1
MIRT049054 CDK11A cyclin-dependent kinase 11A 1 1
MIRT049055 MAML1 mastermind-like 1 (Drosophila) 1 1
MIRT049056 TUBB3 tubulin, beta 3 class III 1 1
MIRT049057 CDK1 cyclin-dependent kinase 1 1 1
MIRT049058 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT049059 FAF1 Fas (TNFRSF6) associated factor 1 1 1
MIRT049060 RPL7A ribosomal protein L7a 1 1
MIRT049061 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT049062 DNM2 dynamin 2 1 1
MIRT049063 ACADS acyl-CoA dehydrogenase, C-2 to C-3 short chain 1 1
MIRT049064 EIF3B eukaryotic translation initiation factor 3, subunit B 1 1
MIRT049065 CPSF6 cleavage and polyadenylation specific factor 6, 68kDa 1 1
MIRT049066 PSMB1 proteasome (prosome, macropain) subunit, beta type, 1 1 1
MIRT049067 PDE4DIP phosphodiesterase 4D interacting protein 1 1
MIRT049068 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT049069 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT049070 TRAF4 TNF receptor-associated factor 4 1 1
MIRT049071 SLC25A38 solute carrier family 25, member 38 1 1
MIRT049072 CEP85 centrosomal protein 85kDa 1 1
MIRT049073 CD59 CD59 molecule, complement regulatory protein 1 1
MIRT049074 RPA2 replication protein A2, 32kDa 1 1
MIRT049075 B4GALT2 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 1 1
MIRT049076 MLX MAX-like protein X 1 1
MIRT049077 SELRC1 Sel1 repeat containing 1 1 1
MIRT049078 CXorf56 chromosome X open reading frame 56 1 1
MIRT049079 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT049080 USP10 ubiquitin specific peptidase 10 1 1
MIRT049081 TRMT61A tRNA methyltransferase 61 homolog A (S. cerevisiae) 1 1
MIRT049082 ENO1 enolase 1, (alpha) 1 1
MIRT049083 PPP1R3G protein phosphatase 1, regulatory subunit 3G 1 1
MIRT049084 SNF8 SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) 1 1
MIRT049085 EBP emopamil binding protein (sterol isomerase) 1 1
MIRT049086 NTPCR nucleoside-triphosphatase, cancer-related 1 1
MIRT049087 LRRC37A2 leucine rich repeat containing 37, member A2 1 1
MIRT049088 TNRC18 trinucleotide repeat containing 18 1 1
MIRT049089 SRPRB signal recognition particle receptor, B subunit 1 1
MIRT049090 RCC1 regulator of chromosome condensation 1 1 1
MIRT049091 PFDN6 prefoldin subunit 6 1 1
MIRT049092 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT049093 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT049094 MRPL9 mitochondrial ribosomal protein L9 1 1
MIRT049095 KLHL15 kelch-like 15 (Drosophila) 1 5
MIRT049096 RPS15 ribosomal protein S15 1 1
MIRT049097 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT049098 HDAC1 histone deacetylase 1 1 1
MIRT049099 MINK1 misshapen-like kinase 1 1 1
MIRT049100 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT049101 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT049102 NXN nucleoredoxin 1 1
MIRT049103 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT049104 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT049105 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 1 1
MIRT049106 DDX17 DEAD (Asp-Glu-Ala-Asp) box helicase 17 1 1
MIRT049107 PSMC3 proteasome (prosome, macropain) 26S subunit, ATPase, 3 1 1
MIRT049108 HIP1R huntingtin interacting protein 1 related 1 1
MIRT049109 CCAR1 cell division cycle and apoptosis regulator 1 1 1
MIRT049110 TUBA1C tubulin, alpha 1c 1 1
MIRT049111 SNX9 sorting nexin 9 1 1
MIRT049112 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT049113 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT049114 YBX3 cold shock domain protein A 1 1
MIRT049115 CHAF1A chromatin assembly factor 1, subunit A (p150) 1 1
MIRT049116 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT049117 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT049118 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT049119 RANBP2 RAN binding protein 2 1 1
MIRT049120 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT049121 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT049122 TRIM28 tripartite motif containing 28 1 1
MIRT049123 RPL3 ribosomal protein L3 2 1
MIRT049124 CKB creatine kinase, brain 1 1
MIRT049125 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT049126 PDS5B PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) 1 1
MIRT049127 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT049128 CC2D2A coiled-coil and C2 domain containing 2A 1 1
MIRT049129 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT049130 POR P450 (cytochrome) oxidoreductase 1 1
MIRT049131 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT049132 TANC2 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 2 1
MIRT049133 AURKB aurora kinase B 1 1
MIRT049134 AIDA axin interactor, dorsalization associated 1 1
MIRT049135 DNAJA3 DnaJ (Hsp40) homolog, subfamily A, member 3 1 1
MIRT049136 PXN paxillin 1 1
MIRT049137 PARK7 parkinson protein 7 1 1
MIRT049138 HDGF hepatoma-derived growth factor 1 1
MIRT049139 LIMD1 LIM domains containing 1 1 1
MIRT049140 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT049141 COX18 cytochrome c oxidase assembly homolog 18 (yeast) 1 1
MIRT049142 MYO19 myosin XIX 1 1
MIRT049143 ZNF276 zinc finger protein 276 1 1
MIRT049144 AARS2 alanyl-tRNA synthetase 2, mitochondrial 1 1
MIRT049145 ETFA electron-transfer-flavoprotein, alpha polypeptide 1 1
MIRT049146 SART3 squamous cell carcinoma antigen recognized by T cells 3 1 1
MIRT049147 TEX10 testis expressed 10 1 1
MIRT049148 PFN1 profilin 1 1 1
MIRT049149 EPHA7 EPH receptor A7 1 1
MIRT049150 WDR6 WD repeat domain 6 1 1
MIRT049151 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT049152 TESK1 testis-specific kinase 1 1 2
MIRT049153 ZNF503 zinc finger protein 503 1 1
MIRT049154 DENND5A DENN/MADD domain containing 5A 1 1
MIRT049155 PRR12 proline rich 12 1 1
MIRT049156 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 1 1
MIRT049157 MYO5C myosin VC 1 1
MIRT049158 MRPL3 mitochondrial ribosomal protein L3 1 1
MIRT049159 CDKN3 cyclin-dependent kinase inhibitor 3 1 1
MIRT049160 RBBP7 retinoblastoma binding protein 7 1 1
MIRT049161 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT049162 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT049163 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT049164 PKN1 protein kinase N1 1 1
MIRT049165 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT049166 RPL18A ribosomal protein L18a 1 1
MIRT049167 ISM2 isthmin 2 homolog (zebrafish) 1 1
MIRT049168 QSOX2 quiescin Q6 sulfhydryl oxidase 2 1 1
MIRT049169 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT049170 RIOK1 RIO kinase 1 (yeast) 1 1
MIRT049171 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT049172 IGSF1 immunoglobulin superfamily, member 1 1 1
MIRT049173 PPIB peptidylprolyl isomerase B (cyclophilin B) 1 1
MIRT049174 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT049175 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT049176 NFIB nuclear factor I/B 1 1
MIRT049177 STARD7 StAR-related lipid transfer (START) domain containing 7 1 1
MIRT049178 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT049179 FNDC3B fibronectin type III domain containing 3B 1 2
MIRT049180 SRSF5 serine/arginine-rich splicing factor 5 1 1
MIRT049181 KIFC1 kinesin family member C1 1 1
MIRT049182 EARS2 glutamyl-tRNA synthetase 2, mitochondrial 1 2
MIRT049183 MCM3 minichromosome maintenance complex component 3 1 1
MIRT049184 TUSC2 tumor suppressor candidate 2 1 1
MIRT049185 CLDND1 claudin domain containing 1 1 1
MIRT049186 BRCC3 BRCA1/BRCA2-containing complex, subunit 3 1 1
MIRT049187 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT049188 DHX16 DEAH (Asp-Glu-Ala-His) box polypeptide 16 1 1
MIRT049189 KIAA0100 KIAA0100 1 1
MIRT049190 DUSP11 dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) 1 1
MIRT049191 ARRB1 arrestin, beta 1 1 1
MIRT049192 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT049193 VARS valyl-tRNA synthetase 1 1
MIRT049194 ITPR3 inositol 1,4,5-trisphosphate receptor, type 3 1 1
MIRT049195 AXIN1 axin 1 1 1
MIRT049196 RPL13A ribosomal protein L13a 1 1
MIRT049197 STX3 syntaxin 3 1 1
MIRT049198 GLOD4 glyoxalase domain containing 4 1 1
MIRT049199 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT049200 KCTD5 potassium channel tetramerisation domain containing 5 1 1
MIRT049201 GSTP1 glutathione S-transferase pi 1 1 1
MIRT049202 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT049203 COL18A1 collagen, type XVIII, alpha 1 1 1
MIRT049204 NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 1 1
MIRT049205 USP31 ubiquitin specific peptidase 31 1 1
MIRT049206 RBX1 ring-box 1, E3 ubiquitin protein ligase 1 1
MIRT049207 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT049208 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT049209 CCDC86 coiled-coil domain containing 86 1 1
MIRT049210 P4HB prolyl 4-hydroxylase, beta polypeptide 1 1
MIRT049211 LMBR1L limb region 1 homolog (mouse)-like 1 1
MIRT049212 CDK9 cyclin-dependent kinase 9 1 1
MIRT049213 BCL9L B-cell CLL/lymphoma 9-like 1 1
MIRT049214 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT049215 RPL15 ribosomal protein L15 1 1
MIRT049216 ALMS1 Alstrom syndrome 1 1 1
MIRT049217 MLLT4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 1 1
MIRT049218 CUL5 cullin 5 1 1
MIRT049219 KPNB1 karyopherin (importin) beta 1 1 1
MIRT049220 MYO1C myosin IC 1 1
MIRT049221 TLR10 toll-like receptor 10 1 1
MIRT049222 COX4I1 cytochrome c oxidase subunit IV isoform 1 1 1
MIRT049223 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT049224 CTNNBL1 catenin, beta like 1 1 1
MIRT049225 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT049226 BRD2 bromodomain containing 2 1 1
MIRT049227 PFKM phosphofructokinase, muscle 1 1
MIRT049228 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT049229 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT049230 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT049231 KIAA1671 KIAA1671 1 1
MIRT049232 HIST1H1E histone cluster 1, H1e 1 1
MIRT049233 R3HDM4 R3H domain containing 4 1 1
MIRT049234 SURF4 surfeit 4 1 1
MIRT049235 METTL16 methyltransferase like 16 1 1
MIRT049236 ZNF420 zinc finger protein 420 1 1
MIRT049237 ARPC2 actin related protein 2/3 complex, subunit 2, 34kDa 1 1
MIRT049238 RRP9 ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT049239 HEATR1 HEAT repeat containing 1 1 1
MIRT049240 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT049241 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT049242 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT049243 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT049244 VCPIP1 valosin containing protein (p97)/p47 complex interacting protein 1 1 1
MIRT049245 CORO7 coronin 7 1 1
MIRT049246 UNC13B unc-13 homolog B (C. elegans) 1 1
MIRT049247 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT049248 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT049249 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 2
MIRT049250 HS3ST3A1 heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1 1 1
MIRT049251 ALKBH5 alkB, alkylation repair homolog 5 (E. coli) 1 1
MIRT049252 TKT transketolase 1 1
MIRT049253 DLX6 distal-less homeobox 6 1 1
MIRT049254 OSBPL2 oxysterol binding protein-like 2 2 1
MIRT049255 CDC37 cell division cycle 37 homolog (S. cerevisiae) 1 1
MIRT049256 CLTC clathrin, heavy chain (Hc) 1 1
MIRT049257 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT049258 GLO1 glyoxalase I 1 1
MIRT049259 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT049260 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT049261 EIF3K eukaryotic translation initiation factor 3, subunit K 1 1
MIRT049262 DCTD dCMP deaminase 1 1
MIRT049263 MYL6 myosin, light chain 6, alkali, smooth muscle and non-muscle 1 1
MIRT049264 FAM135A family with sequence similarity 135, member A 1 2
MIRT049265 ZNF507 zinc finger protein 507 1 1
MIRT049266 EDC4 enhancer of mRNA decapping 4 1 1
MIRT049267 SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 1 1
MIRT049268 PFDN2 prefoldin subunit 2 1 1
MIRT049269 ZFHX4 zinc finger homeobox 4 1 1
MIRT049270 HOGA1 4-hydroxy-2-oxoglutarate aldolase 1 1 1
MIRT049271 IL17RA interleukin 17 receptor A 1 1
MIRT049272 LXN latexin 1 1
MIRT049273 PDCD6IP programmed cell death 6 interacting protein 1 1
MIRT049274 CD2AP CD2-associated protein 1 2
MIRT049275 RPS14 ribosomal protein S14 1 1
MIRT049276 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 1 1
MIRT049277 HOXA5 homeobox A5 1 1
MIRT049278 FBXO45 F-box protein 45 1 1
MIRT049279 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT049280 HIST1H4C histone cluster 1, H4c 1 1
MIRT049281 KIF1A kinesin family member 1A 1 1
MIRT049282 HSPA8 heat shock 70kDa protein 8 1 1
MIRT049283 BAG6 BCL2-associated athanogene 6 1 1
MIRT049284 SYNPR synaptoporin 1 1
MIRT049285 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT049286 PYGL phosphorylase, glycogen, liver 1 1
MIRT049287 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 1
MIRT049288 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT049289 DIDO1 death inducer-obliterator 1 1 1
MIRT049290 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT049291 PHF12 PHD finger protein 12 1 1
MIRT049292 ANKS1A ankyrin repeat and sterile alpha motif domain containing 1A 1 1
MIRT049293 CBS cystathionine-beta-synthase 1 1
MIRT049294 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 1
MIRT049295 SERINC1 serine incorporator 1 1 1
MIRT049296 GNG7 guanine nucleotide binding protein (G protein), gamma 7 1 1
MIRT049297 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT049298 ERAP1 endoplasmic reticulum aminopeptidase 1 1 1
MIRT049299 TMEM55B transmembrane protein 55B 1 1
MIRT049300 HIST1H2AB histone cluster 1, H2ab 1 1
MIRT049301 TNPO1 transportin 1 1 2
MIRT049302 COL4A2 collagen, type IV, alpha 2 1 1
MIRT049303 CBX2 chromobox homolog 2 1 1
MIRT049304 EPHA4 EPH receptor A4 1 1
MIRT049305 COPG1 coatomer protein complex, subunit gamma 1 1 1
MIRT049306 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT049307 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT049308 TMEM161A transmembrane protein 161A 1 1
MIRT049309 KHSRP KH-type splicing regulatory protein 1 1
MIRT049310 GOLGA3 golgin A3 1 4
MIRT049311 ZNF622 zinc finger protein 622 1 1
MIRT049312 FAM168B family with sequence similarity 168, member B 1 1
MIRT049313 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT049314 SIN3A SIN3 transcription regulator homolog A (yeast) 1 1
MIRT049315 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 2
MIRT049316 MAP4 microtubule-associated protein 4 1 1
MIRT049317 MAVS mitochondrial antiviral signaling protein 1 1
MIRT049318 CBFB core-binding factor, beta subunit 1 1
MIRT049319 CTLA4 cytotoxic T-lymphocyte-associated protein 4 1 1
MIRT049320 PCNXL4 pecanex-like 4 (Drosophila) 1 1
MIRT049321 SIN3B SIN3 transcription regulator homolog B (yeast) 1 1
MIRT049322 NPC2 Niemann-Pick disease, type C2 1 1
MIRT049323 POLR2I polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa 1 1
MIRT049324 HIST1H2AM histone cluster 1, H2am 1 1
MIRT049325 RNF123 ring finger protein 123 1 1
MIRT049326 WDR18 WD repeat domain 18 1 1
MIRT049327 RPS28 ribosomal protein S28 1 1
MIRT049328 FAM129B family with sequence similarity 129, member B 1 1
MIRT049329 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT049330 EPB41L3 erythrocyte membrane protein band 4.1-like 3 1 1
MIRT049331 MAPRE1 microtubule-associated protein, RP/EB family, member 1 3 1
MIRT049332 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT049333 AHCYL1 adenosylhomocysteinase-like 1 1 1
MIRT049334 KLC2 kinesin light chain 2 1 1
MIRT049335 ZBTB22 zinc finger and BTB domain containing 22 1 1
MIRT049336 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT049337 NUP155 nucleoporin 155kDa 1 1
MIRT049338 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT049339 DDX39A DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A 1 1
MIRT049340 CAMTA2 calmodulin binding transcription activator 2 1 1
MIRT049341 RNF40 ring finger protein 40, E3 ubiquitin protein ligase 1 1
MIRT049342 NCAPH non-SMC condensin I complex, subunit H 1 1
MIRT049343 MYO1D myosin ID 1 2
MIRT049344 APOBEC3C apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C 1 1
MIRT049345 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT049346 SARS2 seryl-tRNA synthetase 2, mitochondrial 1 1
MIRT049347 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT049348 RAB11A RAB11A, member RAS oncogene family 1 1
MIRT049349 EIF4B eukaryotic translation initiation factor 4B 1 1
MIRT049350 OTUD6A OTU domain containing 6A 1 1
MIRT049351 CERS1 ceramide synthase 1 1 1
MIRT049352 ENOPH1 enolase-phosphatase 1 1 1
MIRT049353 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT049354 KIAA1549 KIAA1549 1 1
MIRT049355 CELSR1 cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) 1 1
MIRT049356 PSMB6 proteasome (prosome, macropain) subunit, beta type, 6 1 1
MIRT049357 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT049358 ORC5 origin recognition complex, subunit 5 1 1
MIRT049359 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 4 2
MIRT049360 PKDCC protein kinase domain containing, cytoplasmic homolog (mouse) 1 1
MIRT049361 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT049362 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT049363 FASN fatty acid synthase 1 1
MIRT049364 SMC3 structural maintenance of chromosomes 3 1 1
MIRT049365 RNF2 ring finger protein 2 1 1
MIRT049366 ZNF84 zinc finger protein 84 1 1
MIRT049367 CCNE1 cyclin E1 1 1
MIRT049368 RTCB chromosome 22 open reading frame 28 1 1
MIRT049369 TBL1X transducin (beta)-like 1X-linked 1 1
MIRT049370 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT049371 TGFBRAP1 transforming growth factor, beta receptor associated protein 1 1 1
MIRT049372 TRAP1 TNF receptor-associated protein 1 2 1
MIRT049373 ACLY ATP citrate lyase 1 1
MIRT049374 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT049375 SLC25A44 solute carrier family 25, member 44 1 1
MIRT049376 SMAP2 small ArfGAP2 1 1
MIRT049377 DDX56 DEAD (Asp-Glu-Ala-Asp) box helicase 56 1 1
MIRT049378 TWISTNB TWIST neighbor 1 1
MIRT049379 CCDC57 coiled-coil domain containing 57 1 1
MIRT049380 SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1 1
MIRT049381 DYNLL1 dynein, light chain, LC8-type 1 1 1
MIRT049382 STEAP3 STEAP family member 3, metalloreductase 1 1
MIRT049383 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT049384 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT049385 RPLP1 ribosomal protein, large, P1 1 1
MIRT049386 AUP1 ancient ubiquitous protein 1 1 1
MIRT049387 MRGBP MRG/MORF4L binding protein 1 1
MIRT049388 PSMG3 proteasome (prosome, macropain) assembly chaperone 3 1 1
MIRT049389 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT049390 AK2 adenylate kinase 2 1 1
MIRT049391 GBAS glioblastoma amplified sequence 1 1
MIRT049392 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT049393 CKMT1B creatine kinase, mitochondrial 1B 1 1
MIRT049394 WDR19 WD repeat domain 19 1 1
MIRT049395 AAGAB alpha- and gamma-adaptin binding protein 1 1
MIRT049396 TMEM160 transmembrane protein 160 1 1
MIRT049397 KPNA3 karyopherin alpha 3 (importin alpha 4) 1 1
MIRT049398 SCYL2 SCY1-like 2 (S. cerevisiae) 1 1
MIRT049399 ATG16L1 autophagy related 16-like 1 (S. cerevisiae) 1 1
MIRT049400 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT049401 KIF18B kinesin family member 18B 1 1
MIRT049402 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT049403 DNAJC21 DnaJ (Hsp40) homolog, subfamily C, member 21 1 1
MIRT049404 TUBB tubulin, beta class I 1 1
MIRT049405 ERGIC1 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 1 1
MIRT049406 ACTB actin, beta 1 1
MIRT049407 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT049408 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 1 1
MIRT049409 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT049410 STAG1 stromal antigen 1 1 1
MIRT049411 H1FX H1 histone family, member X 1 1
MIRT049412 ATP11A ATPase, class VI, type 11A 1 1
MIRT049413 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT049414 CDV3 CDV3 homolog (mouse) 1 1
MIRT049415 EIF3G eukaryotic translation initiation factor 3, subunit G 1 1
MIRT049416 CD276 CD276 molecule 1 1
MIRT049417 DOPEY2 dopey family member 2 1 1
MIRT049418 ATXN1 ataxin 1 1 2
MIRT049419 EHBP1 EH domain binding protein 1 2 1
MIRT049420 GEMIN6 gem (nuclear organelle) associated protein 6 1 1
MIRT049421 NSMAF neutral sphingomyelinase (N-SMase) activation associated factor 1 1
MIRT049422 PTPN13 protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase) 1 1
MIRT049423 CBFA2T2 core-binding factor, runt domain, alpha subunit 2; translocated to, 2 1 1
MIRT049424 RPL8 ribosomal protein L8 1 1
MIRT049425 POP4 processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT049426 FNIP1 folliculin interacting protein 1 2 2
MIRT049427 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT049428 TMEM184B transmembrane protein 184B 1 2
MIRT049429 CLSPN claspin 1 1
MIRT049430 EGLN2 egl nine homolog 2 (C. elegans) 1 1
MIRT049431 ARHGEF25 Rho guanine nucleotide exchange factor (GEF) 25 1 1
MIRT049432 TTLL7 tubulin tyrosine ligase-like family, member 7 1 1
MIRT049433 TPM3 tropomyosin 3 1 1
MIRT049434 PDLIM1 PDZ and LIM domain 1 1 1
MIRT049435 ARF1 ADP-ribosylation factor 1 1 2
MIRT049436 RHOT2 ras homolog family member T2 1 1
MIRT049437 CLIC1 chloride intracellular channel 1 1 1
MIRT049438 ARID1B AT rich interactive domain 1B (SWI1-like) 1 4
MIRT049439 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 1 1
MIRT049440 KANSL3 KAT8 regulatory NSL complex subunit 3 1 1
MIRT049441 ATP13A1 ATPase type 13A1 1 1
MIRT049442 OGFR opioid growth factor receptor 1 1
MIRT049443 BTF3 basic transcription factor 3 1 1
MIRT049444 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 1 1
MIRT049445 WDR83OS WD repeat domain 83 opposite strand 1 1
MIRT049446 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT049447 RPS3A ribosomal protein S3A 1 1
MIRT049448 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 1 1
MIRT049449 TAX1BP3 Tax1 (human T-cell leukemia virus type I) binding protein 3 1 1
MIRT049450 HIPK1 homeodomain interacting protein kinase 1 5 2
MIRT049451 TGFA transforming growth factor, alpha 1 1
MIRT049452 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT049453 ERGIC2 ERGIC and golgi 2 1 3
MIRT049454 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT049455 MEN1 multiple endocrine neoplasia I 1 1
MIRT049456 LTBP1 latent transforming growth factor beta binding protein 1 1 1
MIRT049457 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT049458 DDRGK1 DDRGK domain containing 1 1 1
MIRT049459 PURB purine-rich element binding protein B 1 1
MIRT049460 CRTC2 CREB regulated transcription coactivator 2 1 1
MIRT049461 ZFYVE16 zinc finger, FYVE domain containing 16 1 1
MIRT049462 WDR37 WD repeat domain 37 1 1
MIRT049463 HSPH1 heat shock 105kDa/110kDa protein 1 1 1
MIRT049464 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT049465 PHF13 PHD finger protein 13 1 1
MIRT049466 FAM189B family with sequence similarity 189, member B 1 1
MIRT049467 ATXN2L ataxin 2-like 1 1
MIRT049468 RAVER1 ribonucleoprotein, PTB-binding 1 1 1
MIRT049469 STK25 serine/threonine kinase 25 1 1
MIRT049470 FLYWCH1 FLYWCH-type zinc finger 1 1 1
MIRT049471 TRAPPC11 trafficking protein particle complex 11 1 1
MIRT049472 RRM1 ribonucleotide reductase M1 1 1
MIRT049473 NRXN3 neurexin 3 1 1
MIRT049474 PPP6R2 protein phosphatase 6, regulatory subunit 2 1 1
MIRT049475 PRR14L proline rich 14-like 1 1
MIRT049476 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 1 1
MIRT049477 CCNB1 cyclin B1 1 1
MIRT049478 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT049479 MAP3K6 mitogen-activated protein kinase kinase kinase 6 1 1
MIRT049480 MTMR14 myotubularin related protein 14 1 1
MIRT049481 RXRB retinoid X receptor, beta 1 1
MIRT049482 RBM10 RNA binding motif protein 10 2 1
MIRT049483 COL4A1 collagen, type IV, alpha 1 1 1
MIRT049484 KLHL11 kelch-like 11 (Drosophila) 1 1
MIRT049485 SETD1B SET domain containing 1B 1 1
MIRT049486 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT049487 ME2 malic enzyme 2, NAD(+)-dependent, mitochondrial 1 1
MIRT049488 PLCG1 phospholipase C, gamma 1 1 1
MIRT049489 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 1 1
MIRT049490 IPO5 importin 5 1 1
MIRT049491 COX1 cytochrome c oxidase subunit I 1 1
MIRT049492 RCC2 regulator of chromosome condensation 2 1 1
MIRT049493 TCEB2 transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) 1 1
MIRT049494 HES1 hairy and enhancer of split 1, (Drosophila) 1 1
MIRT049495 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT049496 SV2A synaptic vesicle glycoprotein 2A 1 1
MIRT049497 SHPRH SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase 1 1
MIRT049498 HSPBP1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 1 1
MIRT049499 CTTN cortactin 1 1
MIRT049500 FAM136A family with sequence similarity 136, member A 1 1
MIRT049501 TTC32 tetratricopeptide repeat domain 32 1 1
MIRT049502 NDUFA7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa 1 1
MIRT049503 GPX3 glutathione peroxidase 3 (plasma) 1 1
MIRT049504 LMNB2 lamin B2 1 1
MIRT049505 ATM ataxia telangiectasia mutated 1 1
MIRT049506 GAK cyclin G associated kinase 1 1
MIRT049507 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT049508 SREBF2 sterol regulatory element binding transcription factor 2 1 1
MIRT049509 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT049510 RPS5 ribosomal protein S5 2 1
MIRT049511 SMAD7 SMAD family member 7 1 2
MIRT049512 FAM73B family with sequence similarity 73, member B 1 1
MIRT049513 SUCLG1 succinate-CoA ligase, alpha subunit 1 1
MIRT049514 HLA-E major histocompatibility complex, class I, E 1 1
MIRT049515 JAG2 jagged 2 1 1
MIRT049516 SCARB2 scavenger receptor class B, member 2 1 1
MIRT049517 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT049518 MLF2 myeloid leukemia factor 2 1 1
MIRT049519 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 1 1
MIRT049520 TECPR2 tectonin beta-propeller repeat containing 2 1 2
MIRT049521 ADRM1 adhesion regulating molecule 1 1 1
MIRT049522 TBCEL tubulin folding cofactor E-like 1 1
MIRT049523 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT049524 CD2BP2 CD2 (cytoplasmic tail) binding protein 2 1 1
MIRT049525 MTHFSD methenyltetrahydrofolate synthetase domain containing 1 1
MIRT049526 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 2
MIRT049527 NHSL1 NHS-like 1 1 1
MIRT049528 TFAM transcription factor A, mitochondrial 1 1
MIRT049529 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT049530 RAB8A RAB8A, member RAS oncogene family 1 1
MIRT049531 PSMA4 proteasome (prosome, macropain) subunit, alpha type, 4 1 1
MIRT049532 FLNB filamin B, beta 1 1
MIRT049533 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 5
MIRT049534 ZNF703 zinc finger protein 703 1 1
MIRT049535 ASS1 argininosuccinate synthase 1 1 1
MIRT049536 CBR1 carbonyl reductase 1 1 1
MIRT049537 HEATR6 HEAT repeat containing 6 1 1
MIRT049538 DEDD2 death effector domain containing 2 1 1
MIRT049539 STMN3 stathmin-like 3 1 1
MIRT049540 KIF20A kinesin family member 20A 1 1
MIRT049541 TCHP trichoplein, keratin filament binding 1 1
MIRT049542 PTS 6-pyruvoyltetrahydropterin synthase 1 1
MIRT049543 METTL2A methyltransferase like 2A 1 1
MIRT049544 NOTCH2 notch 2 1 1
MIRT049545 NDRG3 NDRG family member 3 1 1
MIRT049546 NTHL1 nth endonuclease III-like 1 (E. coli) 1 1
MIRT049547 UBE2R2 ubiquitin-conjugating enzyme E2R 2 1 1
MIRT049548 METTL2B methyltransferase like 2B 1 1
MIRT049549 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT049550 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT049551 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT049552 DNPH1 chromosome 6 open reading frame 108 1 1
MIRT049553 GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa 1 1
MIRT049554 FAM160B2 family with sequence similarity 160, member B2 1 1
MIRT049555 EIF6 eukaryotic translation initiation factor 6 1 1
MIRT049556 SF3A3 splicing factor 3a, subunit 3, 60kDa 1 1
MIRT049557 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT049558 IFT172 intraflagellar transport 172 homolog (Chlamydomonas) 1 1
MIRT049559 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT049560 FLNA filamin A, alpha 1 1
MIRT049561 MYEF2 myelin expression factor 2 1 1
MIRT049562 TTC7B tetratricopeptide repeat domain 7B 1 1
MIRT049563 KIF2C kinesin family member 2C 1 1
MIRT049564 ESD esterase D 1 1
MIRT049565 GBP4 guanylate binding protein 4 1 1
MIRT049566 RPS15A ribosomal protein S15a 1 1
MIRT049567 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT049568 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT049569 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT049570 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 1
MIRT049571 RIC8A resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) 1 1
MIRT049572 WDR1 WD repeat domain 1 1 1
MIRT049573 BBX bobby sox homolog (Drosophila) 1 1
MIRT049574 TONSL tonsoku-like, DNA repair protein 1 1
MIRT049575 HBB hemoglobin, beta 1 1
MIRT049576 FBXL19 F-box and leucine-rich repeat protein 19 1 1
MIRT049577 CES2 carboxylesterase 2 1 1
MIRT049578 IQGAP1 IQ motif containing GTPase activating protein 1 1 1
MIRT049579 UBE4B ubiquitination factor E4B 1 1
MIRT049580 FKBPL FK506 binding protein like 1 1
MIRT049581 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT049582 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 1 1
MIRT049583 SCAF8 SR-related CTD-associated factor 8 1 1
MIRT049584 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT049585 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 1 1
MIRT049586 YIPF5 Yip1 domain family, member 5 1 1
MIRT049587 SCLY selenocysteine lyase 2 1
MIRT049588 ARCN1 archain 1 1 1
MIRT049589 NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa 1 1
MIRT049590 MPG N-methylpurine-DNA glycosylase 1 1
MIRT049591 SYNJ1 synaptojanin 1 1 2
MIRT049592 MCCD1 mitochondrial coiled-coil domain 1 1 1
MIRT049593 CARS cysteinyl-tRNA synthetase 1 1
MIRT049594 MINA MYC induced nuclear antigen 1 1
MIRT049595 MYO6 myosin VI 1 1
MIRT049596 ZNF174 zinc finger protein 174 1 1
MIRT049597 SIPA1L1 signal-induced proliferation-associated 1 like 1 1 1
MIRT049598 ABHD2 abhydrolase domain containing 2 1 1
MIRT049599 MTFP1 mitochondrial fission process 1 1 1
MIRT049600 ZNF629 zinc finger protein 629 1 1
MIRT049601 ELF4 E74-like factor 4 (ets domain transcription factor) 1 1
MIRT049602 ZC3HAV1 zinc finger CCCH-type, antiviral 1 1 1
MIRT049603 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT049604 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT049605 MAU2 MAU2 chromatid cohesion factor homolog (C. elegans) 1 1
MIRT049606 RCN3 reticulocalbin 3, EF-hand calcium binding domain 1 1
MIRT049607 CACFD1 calcium channel flower domain containing 1 2 1
MIRT049608 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT049609 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT049610 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT049611 AMOTL1 angiomotin like 1 1 1
MIRT049612 KAT2A K(lysine) acetyltransferase 2A 2 1
MIRT049613 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT049614 ZNF282 zinc finger protein 282 1 1
MIRT049615 RAB36 RAB36, member RAS oncogene family 1 1
MIRT049616 LSM7 LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT049617 PSMA7 proteasome (prosome, macropain) subunit, alpha type, 7 1 1
MIRT049618 NDUFB10 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa 1 1
MIRT049619 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT049620 C12orf57 chromosome 12 open reading frame 57 1 1
MIRT049621 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT049622 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT049623 PCBP2 poly(rC) binding protein 2 1 1
MIRT049624 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT049625 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT049626 VANGL2 vang-like 2 (van gogh, Drosophila) 1 1
MIRT049627 RFFL ring finger and FYVE-like domain containing E3 ubiquitin protein ligase 2 1
MIRT049628 SNRPE small nuclear ribonucleoprotein polypeptide E 1 1
MIRT049629 GABARAPL2 GABA(A) receptor-associated protein-like 2 1 1
MIRT049630 FKBP8 FK506 binding protein 8, 38kDa 1 1
MIRT049631 TSPAN18 tetraspanin 18 1 1
MIRT049632 KCNC1 potassium voltage-gated channel, Shaw-related subfamily, member 1 1 1
MIRT049633 BRF1 BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) 1 1
MIRT049634 ATXN7 ataxin 7 1 1
MIRT049635 CDC42SE1 CDC42 small effector 1 1 1
MIRT049636 PRKCA protein kinase C, alpha 1 1
MIRT049637 RPAIN RPA interacting protein 1 1
MIRT049638 KIAA1468 KIAA1468 1 1
MIRT049639 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT049640 MYBBP1A MYB binding protein (P160) 1a 1 1
MIRT049641 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT049642 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 2
MIRT049643 TTC5 tetratricopeptide repeat domain 5 1 1
MIRT049644 PRC1 protein regulator of cytokinesis 1 1 1
MIRT049645 ORC6 origin recognition complex, subunit 6 1 1
MIRT049646 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT049647 DNAJB12 DnaJ (Hsp40) homolog, subfamily B, member 12 1 2
MIRT049648 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT049649 LRIG1 leucine-rich repeats and immunoglobulin-like domains 1 1 1
MIRT049650 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT049651 PLCXD2 phosphatidylinositol-specific phospholipase C, X domain containing 2 1 1
MIRT049652 CHN1 chimerin 1 1 1
MIRT049653 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT049654 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT049655 BID BH3 interacting domain death agonist 1 1
MIRT049656 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT049657 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT049658 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT049659 RNF121 ring finger protein 121 1 1
MIRT049660 PITPNA phosphatidylinositol transfer protein, alpha 1 2
MIRT049661 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT049662 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT049663 HIST1H2AH histone cluster 1, H2ah 1 1
MIRT049664 ZNF776 zinc finger protein 776 1 1
MIRT049665 FTSJ1 FtsJ RNA methyltransferase homolog 1 (E. coli) 1 1
MIRT049666 MED16 mediator complex subunit 16 1 1
MIRT049667 MFSD1 major facilitator superfamily domain containing 1 1 1
MIRT049668 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT049669 UBAC2 UBA domain containing 2 1 1
MIRT049670 SLC6A8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT049671 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT049672 IRGQ immunity-related GTPase family, Q 1 2
MIRT049673 ARL2 ADP-ribosylation factor-like 2 1 1
MIRT049674 USP13 ubiquitin specific peptidase 13 (isopeptidase T-3) 1 1
MIRT049675 NADK NAD kinase 1 1
MIRT049676 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 1 1
MIRT049677 TLN1 talin 1 1 1
MIRT049678 SELENBP1 selenium binding protein 1 1 1
MIRT049679 PTK7 PTK7 protein tyrosine kinase 7 1 1
MIRT049680 LDLR low density lipoprotein receptor 1 1
MIRT049681 TTL tubulin tyrosine ligase 1 1
MIRT049682 CA5B carbonic anhydrase VB, mitochondrial 1 1
MIRT049683 MCOLN2 mucolipin 2 1 5
MIRT049684 FGF2 fibroblast growth factor 2 (basic) 1 6
MIRT049685 POGZ pogo transposable element with ZNF domain 1 1
MIRT049686 FAM58A family with sequence similarity 58, member A 1 1
MIRT049687 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT049688 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT049689 LRRC27 leucine rich repeat containing 27 1 1
MIRT049690 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT049691 MEF2C myocyte enhancer factor 2C 1 1
MIRT049692 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT049693 PPAN peter pan homolog (Drosophila) 1 1
MIRT049694 DTL denticleless E3 ubiquitin protein ligase homolog (Drosophila) 1 1
MIRT049695 POLR2L polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa 1 1
MIRT049696 SRPR signal recognition particle receptor (docking protein) 2 2
MIRT049697 PDAP1 PDGFA associated protein 1 1 1
MIRT049698 CYP4V2 cytochrome P450, family 4, subfamily V, polypeptide 2 1 1
MIRT049699 TERF2 telomeric repeat binding factor 2 1 1
MIRT049700 C22orf29 chromosome 22 open reading frame 29 1 1
MIRT049701 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 1 1
MIRT049702 CTSB cathepsin B 1 1
MIRT049703 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT049704 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT049705 SCARB1 scavenger receptor class B, member 1 1 1
MIRT049706 OSBPL8 oxysterol binding protein-like 8 2 1
MIRT049707 CHTOP chromatin target of PRMT1 1 1
MIRT049708 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT049709 ABHD15 abhydrolase domain containing 15 1 1
MIRT049710 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT049711 FAM20C family with sequence similarity 20, member C 1 1
MIRT049712 RECQL RecQ protein-like (DNA helicase Q1-like) 1 1
MIRT049713 TMEM66 transmembrane protein 66 1 1
MIRT049714 MFN2 mitofusin 2 1 1
MIRT049715 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT049716 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT049717 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT049718 CYBRD1 cytochrome b reductase 1 1 1
MIRT049719 CSPG5 chondroitin sulfate proteoglycan 5 (neuroglycan C) 1 1
MIRT049720 FAM3A family with sequence similarity 3, member A 1 1
MIRT049721 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT049722 NEK6 NIMA (never in mitosis gene a)-related kinase 6 1 1
MIRT049723 RUVBL2 RuvB-like 2 (E. coli) 1 1
MIRT049724 RPS23 ribosomal protein S23 1 1
MIRT049725 TMED9 transmembrane emp24 protein transport domain containing 9 1 1
MIRT049726 XPOT exportin, tRNA 1 1
MIRT049727 EPHB2 EPH receptor B2 1 1
MIRT049728 CCDC181 chromosome 1 open reading frame 114 1 1
MIRT049729 FUK fucokinase 1 1
MIRT049730 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 1
MIRT049731 UBR1 ubiquitin protein ligase E3 component n-recognin 1 1 1
MIRT049732 ELOF1 elongation factor 1 homolog (S. cerevisiae) 1 1
MIRT049733 MARS methionyl-tRNA synthetase 1 1
MIRT049734 ZNF551 zinc finger protein 551 1 1
MIRT049735 TOM1L1 target of myb1 (chicken)-like 1 1 1
MIRT049736 DHRS7B dehydrogenase/reductase (SDR family) member 7B 1 1
MIRT049737 PCGF5 polycomb group ring finger 5 2 1
MIRT049738 KLHL3 kelch-like 3 (Drosophila) 1 1
MIRT049739 PDIA4 protein disulfide isomerase family A, member 4 1 1
MIRT049740 KLHL36 kelch-like 36 (Drosophila) 1 1
MIRT049741 C5orf42 chromosome 5 open reading frame 42 1 1
MIRT049742 NCDN neurochondrin 1 1
MIRT049743 EP300 E1A binding protein p300 1 1
MIRT049744 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT049745 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT049746 DENND6A DENN/MADD domain containing 6A 1 1
MIRT049747 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT049748 LDLRAP1 low density lipoprotein receptor adaptor protein 1 1 1
MIRT049749 PSMF1 proteasome (prosome, macropain) inhibitor subunit 1 (PI31) 1 1
MIRT049750 JMJD6 jumonji domain containing 6 1 1
MIRT049751 XYLT2 xylosyltransferase II 1 1
MIRT049752 IRF2BPL interferon regulatory factor 2 binding protein-like 1 1
MIRT049753 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT049754 GATA3 GATA binding protein 3 1 1
MIRT049755 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT049756 WDR26 WD repeat domain 26 1 1
MIRT049757 PANK2 pantothenate kinase 2 1 1
MIRT049758 ERH enhancer of rudimentary homolog (Drosophila) 1 1
MIRT049759 HMGB1 high mobility group box 1 1 1
MIRT049760 HAUS1 HAUS augmin-like complex, subunit 1 1 1
MIRT049761 SURF6 surfeit 6 1 1
MIRT049762 NUP210 nucleoporin 210kDa 1 1
MIRT049763 RPS10 ribosomal protein S10 1 1
MIRT049764 CHEK1 checkpoint kinase 1 1 1
MIRT049765 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT049766 MKRN2 makorin ring finger protein 2 1 1
MIRT049767 CACUL1 CDK2-associated, cullin domain 1 1 1
MIRT049768 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT049769 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT049770 MRPL2 mitochondrial ribosomal protein L2 1 1
MIRT049771 KHNYN KH and NYN domain containing 1 1
MIRT049772 MSL3 male-specific lethal 3 homolog (Drosophila) 2 1
MIRT049773 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT049774 DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 1 1
MIRT049775 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT049776 EXOSC6 exosome component 6 1 1
MIRT049777 PPARD peroxisome proliferator-activated receptor delta 1 1
MIRT049778 RHEB Ras homolog enriched in brain 1 1
MIRT049779 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT049780 UFSP2 UFM1-specific peptidase 2 1 1
MIRT049781 FAU Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed 1 1
MIRT049782 LARS leucyl-tRNA synthetase 1 1
MIRT049783 ANKH ankylosis, progressive homolog (mouse) 1 1
MIRT049784 POMGNT1 protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase 1 1
MIRT049785 NBR1 neighbor of BRCA1 gene 1 1 1
MIRT049786 CISD1 CDGSH iron sulfur domain 1 1 1
MIRT049787 DENND4B DENN/MADD domain containing 4B 1 2
MIRT049788 RPL22 ribosomal protein L22 1 1
MIRT049789 PITX1 paired-like homeodomain 1 1 1
MIRT049790 DMXL1 Dmx-like 1 1 1
MIRT049791 FHOD1 formin homology 2 domain containing 1 1 1
MIRT049792 PPP4C protein phosphatase 4, catalytic subunit 1 1
MIRT049793 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT049794 ZFYVE26 zinc finger, FYVE domain containing 26 1 1
MIRT049795 TMA16 translation machinery associated 16 homolog (S. cerevisiae) 1 1
MIRT049796 CBX5 chromobox homolog 5 1 1
MIRT049797 OCIAD2 OCIA domain containing 2 1 1
MIRT049798 NAPRT1 nicotinate phosphoribosyltransferase domain containing 1 1 1
MIRT049799 CREB3L2 cAMP responsive element binding protein 3-like 2 1 2
MIRT049800 SAP30 Sin3A-associated protein, 30kDa 1 1
MIRT049801 FAM69B family with sequence similarity 69, member B 1 1
MIRT049802 YIF1B Yip1 interacting factor homolog B (S. cerevisiae) 1 1
MIRT049803 KANSL2 KAT8 regulatory NSL complex subunit 2 1 1
MIRT049804 FAM203A family with sequence similarity 203, member A 1 1
MIRT049805 SAFB scaffold attachment factor B 1 1
MIRT049806 KPTN kaptin (actin binding protein) 1 1
MIRT049807 TFG TRK-fused gene 1 1
MIRT049808 BFAR bifunctional apoptosis regulator 1 1
MIRT049809 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT049810 WASL Wiskott-Aldrich syndrome-like 1 4
MIRT049811 THUMPD1 THUMP domain containing 1 1 1
MIRT049812 RARS arginyl-tRNA synthetase 1 1
MIRT049813 SUGP1 SURP and G patch domain containing 1 1 1
MIRT049814 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT049815 MCM7 minichromosome maintenance complex component 7 1 1
MIRT049816 PRELID1 PRELI domain containing 1 1 1
MIRT049817 SLC2A6 solute carrier family 2 (facilitated glucose transporter), member 6 1 1
MIRT049818 OPTN optineurin 1 1
MIRT049819 ATP5J ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 1 1
MIRT049820 CCT7 chaperonin containing TCP1, subunit 7 (eta) 2 1
MIRT049821 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT049822 SUCLG2 succinate-CoA ligase, GDP-forming, beta subunit 1 1
MIRT049823 E4F1 E4F transcription factor 1 1 1
MIRT049824 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 1
MIRT049825 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT049826 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT049827 SERTAD3 SERTA domain containing 3 1 4
MIRT049828 CAPRIN1 cell cycle associated protein 1 2 1
MIRT049829 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT049830 EMD emerin 1 1
MIRT049831 CXCL16 chemokine (C-X-C motif) ligand 16 1 1
MIRT049832 RSPRY1 ring finger and SPRY domain containing 1 1 1
MIRT049833 F8A3 coagulation factor VIII-associated 3 1 1
MIRT049834 ZWINT ZW10 interactor 1 1
MIRT049835 ANXA11 annexin A11 1 1
MIRT049836 RPS8 ribosomal protein S8 1 1
MIRT049837 TMUB1 transmembrane and ubiquitin-like domain containing 1 1 1
MIRT049838 GOLM1 golgi membrane protein 1 1 1
MIRT049839 CCND1 cyclin D1 1 1
MIRT049840 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT049841 UPF2 UPF2 regulator of nonsense transcripts homolog (yeast) 1 1
MIRT049842 PTPLAD2 protein tyrosine phosphatase-like A domain containing 2 1 1
MIRT049843 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT049844 ZNF687 zinc finger protein 687 1 1
MIRT049845 RBM27 RNA binding motif protein 27 1 2
MIRT049846 EZR ezrin 1 1
MIRT049847 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT049848 HMGXB3 HMG box domain containing 3 1 1
MIRT049849 NKX3-1 NK3 homeobox 1 1 1
MIRT052644 C10orf114 chromosome 10 open reading frame 114 1 1
MIRT052970 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 1 1
MIRT052984 TP53 tumor protein p53 2 1
MIRT052985 Qrsl1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 2 1
MIRT054133 NR1H4 nuclear receptor subfamily 1, group H, member 4 3 1
MIRT054327 PTEN phosphatase and tensin homolog 4 2
MIRT054643 SOCS5 suppressor of cytokine signaling 5 3 1
MIRT055311 DUSP5 dual specificity phosphatase 5 1 5
MIRT055787 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 6
MIRT057111 DDIT4 DNA-damage-inducible transcript 4 1 2
MIRT059660 GATAD2B GATA zinc finger domain containing 2B 1 2
MIRT059921 ZDHHC5 zinc finger, DHHC-type containing 5 1 2
MIRT061604 BTG2 BTG family, member 2 1 3
MIRT061740 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT066475 HMGA2 high mobility group AT-hook 2 1 1
MIRT068738 COG3 component of oligomeric golgi complex 3 1 1
MIRT069386 ZFYVE21 zinc finger, FYVE domain containing 21 1 1
MIRT069970 GEMIN2 gem (nuclear organelle) associated protein 2 1 1
MIRT072529 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT074762 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 2
MIRT075702 GAN gigaxonin 1 1
MIRT076197 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT077387 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT077510 UBE2Z ubiquitin-conjugating enzyme E2Z 1 2
MIRT077900 TOB1 transducer of ERBB2, 1 1 4
MIRT079203 GAA glucosidase, alpha; acid 1 1
MIRT082248 MED29 mediator complex subunit 29 1 2
MIRT082432 CIC capicua homolog (Drosophila) 1 4
MIRT082470 PPP1R37 protein phosphatase 1, regulatory subunit 37 1 1
MIRT082776 ZNF264 zinc finger protein 264 1 1
MIRT085307 UBXN4 UBX domain protein 4 1 5
MIRT086358 SSFA2 sperm specific antigen 2 1 5
MIRT087453 NF2 neurofibromin 2 (merlin) 1 1
MIRT088863 FOXN2 forkhead box N2 1 7
MIRT092182 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 4
MIRT092324 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 4
MIRT092387 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT093531 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 1 3
MIRT095655 TRIO trio Rho guanine nucleotide exchange factor 1 1
MIRT096932 PAPD7 PAP associated domain containing 7 1 5
MIRT097148 FCHO2 FCH domain only 2 1 1
MIRT099903 SOX4 SRY (sex determining region Y)-box 4 1 7
MIRT102287 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 6
MIRT102502 KLHDC10 kelch domain containing 10 1 2
MIRT103433 SNX10 sorting nexin 10 1 1
MIRT104745 FZD6 frizzled family receptor 6 1 1
MIRT106269 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT109182 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 3
MIRT109926 CDK16 cyclin-dependent kinase 16 1 1
MIRT126382 EDRF1 chromosome 10 open reading frame 137 1 1
MIRT127283 VDAC2 voltage-dependent anion channel 2 1 1
MIRT128078 KIF1B kinesin family member 1B 1 1
MIRT129544 FAR1 fatty acyl CoA reductase 1 1 1
MIRT129984 CPTP glycolipid transfer protein domain containing 1 1 1
MIRT130343 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT130477 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT131816 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT134135 KLHL42 kelch domain containing 5 1 1
MIRT135560 SPRYD4 SPRY domain containing 4 1 2
MIRT136292 NECAP1 NECAP endocytosis associated 1 1 1
MIRT140797 SMAD6 SMAD family member 6 1 1
MIRT142657 KIAA0556 KIAA0556 1 1
MIRT142704 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT143316 PAPD5 PAP associated domain containing 5 1 1
MIRT143569 RBL2 retinoblastoma-like 2 (p130) 1 1
MIRT144949 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT150798 ZNF430 zinc finger protein 430 1 1
MIRT150917 ZNF492 zinc finger protein 492 1 1
MIRT154076 ARFGEF2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) 1 1
MIRT155523 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT156699 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT161123 SLC25A36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 1 4
MIRT161324 SELT selenoprotein T 1 1
MIRT161819 MFN1 mitofusin 1 1 1
MIRT161894 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT162439 GOLGA4 golgin A4 1 1
MIRT162569 KLHL18 kelch-like 18 (Drosophila) 1 1
MIRT163738 SETD5 SET domain containing 5 1 1
MIRT163988 KIAA1109 KIAA1109 1 3
MIRT164687 RNF4 ring finger protein 4 1 2
MIRT165176 GRAMD3 GRAM domain containing 3 1 1
MIRT167704 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 5
MIRT168055 E2F3 E2F transcription factor 3 1 1
MIRT168334 WRNIP1 Werner helicase interacting protein 1 1 1
MIRT171350 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT171645 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT171773 CASD1 CAS1 domain containing 1 1 1
MIRT172278 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT172852 TACC1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT173869 DAB2IP DAB2 interacting protein 1 1
MIRT176120 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT178955 USP28 ubiquitin specific peptidase 28 1 1
MIRT185713 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT186261 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT186534 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 2
MIRT186624 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 4
MIRT190972 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT197011 EIF1 eukaryotic translation initiation factor 1 1 5
MIRT206435 YIPF4 Yip1 domain family, member 4 1 1
MIRT214527 C5ORF24 chromosome 5 open reading frame 24 1 1
MIRT215682 PTGER4 prostaglandin E receptor 4 (subtype EP4) 1 1
MIRT216031 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 5
MIRT218082 TULP4 tubby like protein 4 1 2
MIRT242416 CCDC113 coiled-coil domain containing 113 1 2
MIRT243160 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT245507 KIF1BP KIAA1279 1 1
MIRT246117 QSER1 glutamine and serine rich 1 1 1
MIRT247150 OTUD3 OTU domain containing 3 1 1
MIRT250941 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 2
MIRT253347 ZNF417 zinc finger protein 417 1 1
MIRT273212 ZNF695 zinc finger protein 695 1 2
MIRT282775 SNN stannin 1 1
MIRT296112 SLC12A5 solute carrier family 12 (potassium/chloride transporter), member 5 1 1
MIRT301709 TEF thyrotrophic embryonic factor 1 1
MIRT322172 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 2
MIRT341536 CNIH1 cornichon homolog (Drosophila) 1 4
MIRT356060 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT437574 SMAD7 SMAD family member 7 3 1
MIRT437943 RGS5 regulator of G-protein signaling 5 3 1
MIRT437964 MAPK8 mitogen-activated protein kinase 8 3 1
MIRT437965 MAP2K4 mitogen-activated protein kinase kinase 4 4 2
MIRT438170 DUSP10 dual specificity phosphatase 10 4 2
MIRT438289 CCL8 chemokine (C-C motif) ligand 8 3 1
MIRT438805 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT439087 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT443578 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT451493 FOPNL FGFR1OP N-terminal like 1 1
MIRT453166 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT454587 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 2
MIRT455793 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 2
MIRT456009 CYP2C19 cytochrome P450, family 2, subfamily C, polypeptide 19 1 1
MIRT456043 KIAA1586 KIAA1586 1 1
MIRT456762 TMEM239 transmembrane protein 239 1 2
MIRT458067 NLRP9 NLR family, pyrin domain containing 9 1 1
MIRT459229 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT459533 MFF mitochondrial fission factor 1 3
MIRT459758 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT460235 TNFRSF13C tumor necrosis factor receptor superfamily, member 13C 1 1
MIRT461103 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT462923 ZNRF3 zinc and ring finger 3 1 1
MIRT463475 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463515 ZBTB8B zinc finger and BTB domain containing 8B 1 2
MIRT465502 TOR1B torsin family 1, member B (torsin B) 1 1
MIRT469522 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 4
MIRT470078 PTGES2 prostaglandin E synthase 2 1 1
MIRT471580 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT475878 H3F3C H3 histone, family 3C 1 5
MIRT475917 H3F3B H3 histone, family 3B (H3.3B) 1 4
MIRT476196 GOLGA8A golgin A8 family, member A 1 5
MIRT476317 GM2A GM2 ganglioside activator 1 1
MIRT476674 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 5
MIRT478372 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT479544 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT481023 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT491008 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT494347 CASKIN1 CASK interacting protein 1 1 1
MIRT499086 ZDHHC21 zinc finger, DHHC-type containing 21 1 3
MIRT500028 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 4
MIRT501299 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 3
MIRT503125 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 4
MIRT503300 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 3
MIRT504327 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504470 EID2B EP300 interacting inhibitor of differentiation 2B 1 2
MIRT504654 RPL9 ribosomal protein L9 1 3
MIRT505824 RSBN1 round spermatid basic protein 1 1 4
MIRT506008 PURG purine-rich element binding protein G 1 4
MIRT507120 GOLGA8B golgin A8 family, member B 1 4
MIRT507352 FAM129A family with sequence similarity 129, member A 1 4
MIRT507590 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT507675 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 2
MIRT507702 CNOT2 CCR4-NOT transcription complex, subunit 2 1 4
MIRT508011 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 2
MIRT510438 ZIC5 Zic family member 5 1 3
MIRT510542 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 2
MIRT510599 TPPP tubulin polymerization promoting protein 1 3
MIRT511064 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 3
MIRT511856 GOLGA8J golgin A8 family, member J 1 3
MIRT511864 GOLGA8I golgin A8 family, member I 1 3
MIRT512569 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 1
MIRT512707 ZNF134 zinc finger protein 134 1 3
MIRT513176 MOAP1 modulator of apoptosis 1 1 3
MIRT513785 PAWR PRKC, apoptosis, WT1, regulator 1 3
MIRT515480 INCENP inner centromere protein antigens 135/155kDa 1 2
MIRT517415 BMP8A bone morphogenetic protein 8a 1 1
MIRT518753 C1orf35 chromosome 1 open reading frame 35 1 1
MIRT519779 ZNF354B zinc finger protein 354B 1 2
MIRT519864 ZFP62 zinc finger protein 62 homolog (mouse) 1 3
MIRT520509 TRAM2 translocation associated membrane protein 2 1 4
MIRT521070 SLC25A32 solute carrier family 25 (mitochondrial folate carrier) , member 32 1 3
MIRT526911 ZNF772 zinc finger protein 772 1 3
MIRT527133 GULP1 GULP, engulfment adaptor PTB domain containing 1 1 1
MIRT527866 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT528403 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT532955 ZNF24 zinc finger protein 24 1 2
MIRT533018 ZFC3H1 zinc finger, C3H1-type containing 1 3
MIRT534192 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 2
MIRT534962 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 2
MIRT536397 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT537049 GRAMD4 GRAM domain containing 4 1 1
MIRT537181 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 2
MIRT538633 CCSER2 family with sequence similarity 190, member B 1 2
MIRT539229 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 4
MIRT540098 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT540996 ZNF460 zinc finger protein 460 1 2
MIRT541473 AURKA aurora kinase A 1 2
MIRT542679 SESN3 sestrin 3 1 1
MIRT542756 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT542862 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT542926 HOXC8 homeobox C8 1 1
MIRT543746 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT544403 ZSCAN12 zinc finger and SCAN domain containing 12 1 1
MIRT544582 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544661 MED19 mediator complex subunit 19 1 1
MIRT545250 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT545260 TRIM36 tripartite motif containing 36 1 2
MIRT545743 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT546000 WDR81 WD repeat domain 81 1 1
MIRT546039 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT547169 PDZD8 PDZ domain containing 8 1 1
MIRT547277 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT547726 KIF5B kinesin family member 5B 1 2
MIRT548126 GATA6 GATA binding protein 6 1 1
MIRT548757 CNNM4 cyclin M4 1 1
MIRT549640 ZNF75A zinc finger protein 75a 1 1
MIRT549683 ZNF598 zinc finger protein 598 1 1
MIRT550196 MRO maestro 1 1
MIRT550339 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT550535 MYZAP myocardial zonula adherens protein 1 1
MIRT550974 TOR4A torsin family 4, member A 1 1
MIRT551220 CIDEC cell death-inducing DFFA-like effector c 1 1
MIRT551354 AGBL5 ATP/GTP binding protein-like 5 1 1
MIRT551570 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT552276 RAB3D RAB3D, member RAS oncogene family 1 1
MIRT552660 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT553080 UCK2 uridine-cytidine kinase 2 1 1
MIRT553754 TBC1D8 TBC1 domain family, member 8 (with GRAM domain) 1 1
MIRT554029 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT554098 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT554154 SLX4 SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) 1 1
MIRT554814 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT555523 PMEPA1 prostate transmembrane protein, androgen induced 1 1 1
MIRT555600 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase, type I, gamma 1 2
MIRT555634 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 3
MIRT555682 PGAM4 phosphoglycerate mutase family member 4 1 2
MIRT555826 PAX9 paired box 9 1 1
MIRT555867 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT555940 NUP43 nucleoporin 43kDa 1 2
MIRT555997 NFYB nuclear transcription factor Y, beta 1 1
MIRT556435 LONRF3 LON peptidase N-terminal domain and ring finger 3 1 1
MIRT556584 LHFPL2 lipoma HMGIC fusion partner-like 2 1 3
MIRT556800 KIAA1958 KIAA1958 1 1
MIRT558048 EXOC5 exocyst complex component 5 1 2
MIRT558696 CLTA clathrin, light chain A 1 1
MIRT559190 BMPR1A bone morphogenetic protein receptor, type IA 1 2
MIRT559644 AKAP10 A kinase (PRKA) anchor protein 10 1 1
MIRT559706 AEN apoptosis enhancing nuclease 1 1
MIRT560672 SRFBP1 serum response factor binding protein 1 1 1
MIRT560989 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT562169 HOXA13 homeobox A13 1 1
MIRT562279 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT563623 ZNF277 zinc finger protein 277 1 1
MIRT563814 FMN1 formin 1 1 1
MIRT564095 TLR3 toll-like receptor 3 1 1
MIRT565319 TMEM41A transmembrane protein 41A 1 1
MIRT565987 RNF44 ring finger protein 44 1 1
MIRT566046 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 2
MIRT568235 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT572375 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT574820 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 2
MIRT609211 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT629088 FASLG Fas ligand (TNF superfamily, member 6) 1 1
MIRT632123 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT632575 POLQ polymerase (DNA directed), theta 1 1
MIRT634801 ENTHD1 ENTH domain containing 1 1 1
MIRT636552 ESRP1 epithelial splicing regulatory protein 1 1 1
MIRT640976 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT653874 SH2B3 SH2B adaptor protein 3 1 1
MIRT655597 OTUD7B OTU domain containing 7B 1 1
MIRT659763 CCDC171 coiled-coil domain containing 171 1 1
MIRT660743 ALG14 asparagine-linked glycosylation 14 homolog (S. cerevisiae) 1 1
MIRT681036 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 1
MIRT682304 RBM28 RNA binding motif protein 28 1 1
MIRT682572 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT686216 ZNF267 zinc finger protein 267 1 1
MIRT687208 PLXNA3 plexin A3 1 1
MIRT690629 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT692418 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT694436 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 1
MIRT700724 PNO1 partner of NOB1 homolog (S. cerevisiae) 1 1
MIRT701548 NARF nuclear prelamin A recognition factor 1 1
MIRT704378 DAND5 DAN domain family, member 5 1 1
MIRT707940 PPP1R3D protein phosphatase 1, regulatory subunit 3D 1 2
MIRT709938 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT711370 MED7 mediator complex subunit 7 1 1
MIRT712322 PER2 period homolog 2 (Drosophila) 1 2
MIRT714514 SHE Src homology 2 domain containing E 1 1
MIRT715519 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT724293 OSMR oncostatin M receptor 1 1
MIRT725357 MUC21 mucin 21, cell surface associated 1 1
MIRT726003 ZNF98 zinc finger protein 98 1 1
MIRT726017 ZNF721 zinc finger protein 721 1 1
MIRT726044 ZNF224 zinc finger protein 224 1 1
MIRT726053 ZNF17 zinc finger protein 17 1 1
MIRT726092 XRN1 5'-3' exoribonuclease 1