Accession ID: MIRT004284 [miRNA, hsa-miR-124 :: CCL2, target gene]
miRNA Infomation
miRNA namehsa-miR-124
miRNA-target interaction network
Gene Information
Gene Symbol CCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GDCF-2, HC11, HSMCR30, MCAF, MCP-1, MCP1, MGC9434, SCYA2, SMC-CF
Description chemokine (C-C motif) ligand 2
Transcript NM_002982   LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
KEGG Pathway hsa04060    Cytokine-cytokine receptor interaction - Homo sapiens (human)
hsa04062    Chemokine signaling pathway - Homo sapiens (human)
hsa04621    NOD-like receptor signaling pathway - Homo sapiens (human)
hsa05142    Chagas disease - Homo sapiens (human)
Putative miRNA Targets on CCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CCL2
(miRNA target sites are highlighted)		 
>CCL2|NM_002982|3'UTR
   1 TGAACACTCACTCCACAACCCAAGAATCTGCAGCTAACTTATTTTCCCCTAGCTTTCCCCAGACACCCTGTTTTATTTTA
  81 TTATAATGAATTTTGTTTGTTGATGTGAAACATTATGCCTTAAGTAATGTTAATTCTTATTTAAGTTATTGATGTTTTAA
 161 GTTTATCTTTCATGGTACTAGTGTTTTTTAGATACAGAGACTTGGGGAAATTGCTTTTCCTCTTGAACCACAGTTCTACC
 241 CCTGGGATGTTTTGAGGGTCTTTGCAAGAATCATTAATACAAAGAATTTTTTTTAACATTCCAATGCATTGCTAAAATAT
 321 TATTGTGGAAATGAATATTTTGTAACTATTACACCAAATAAATATATTTTTGTACAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-124 :: CCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions E11
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Subsequent luciferase assays revealed that miR-124a specifically suppressed the luciferase activity driven by the 3 -UTR of MCP-1 mRNA (Figure 5B) ...

- Nakamachi, Y. Kawano, S. Takenokuchi, M. et al., 2009, Arthritis Rheum.
Article - Nakamachi, Y. Kawano, S. Takenokuchi, M. et al.
- Arthritis Rheum, 2009
OBJECTIVE: To elucidate the role of microRNA (miRNA) in the pathogenesis of rheumatoid arthritis (RA), we analyzed synoviocytes from RA patients for their miRNA expression. METHODS: Synoviocytes derived from surgical specimens obtained from RA patients were compared with those obtained from osteoarthritis (OA) patients for their expression of a panel of 156 miRNA with quantitative stem-loop reverse transcription-polymerase chain reaction. The miRNA whose expression decreased or increased in RA synoviocytes as compared with OA synoviocytes were identified, and their target genes were predicted by computer analysis. We used an in vitro system of enhancing the expression of specific miRNA by transfection of precursors into synoviocytes, and then we performed proliferation, cell cycle, and apoptosis assays, as well as enzyme-linked immunosorbent assays for cytokine production. The effects of transfection on predicted target protein and messenger RNA (mRNA) were then examined by Western blot analysis and luciferase reporter assay. RESULTS: We found that miR-124a levels significantly decreased in RA synoviocytes as compared with OA synoviocytes. Transfection of precursor miR-124a into RA synoviocytes significantly suppressed their proliferation and arrested the cell cycle at the G1 phase. We identified a putative consensus site for miR-124a binding in the 3'-untranslated region of cyclin-dependent kinase 2 (CDK-2) and monocyte chemoattractant protein 1 (MCP-1) mRNA. Induction of miR-124a in RA synoviocytes significantly suppressed the production of the CDK-2 and MCP-1 proteins. Luciferase reporter assay demonstrated that miR-124a specifically suppressed the reporter activity driven by the 3'-untranslated regions of CDK-2 and MCP-1 mRNA. CONCLUSION: The results of this study suggest that miR-124a is a key miRNA in the posttranscriptional regulatory mechanisms of RA synoviocytes.
LinkOut: [PMID: 19404929]