Accession ID: MIRT004293 [miRNA, hsa-miR-92b-3p :: CDKN1C, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-92bLinkOut: [miRBase ]
Synonyms MIRN92B, hsa-mir-92b, MIR92B
Description Homo sapiens miR-92b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-92b-3p
Mature Sequence 61| UAUUGCACUCGUCCCGGCCUCC |82
Evidence Experimental
Experiments Microarray
Putative hsa-miR-92b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-92b-3p :: CDKN1C    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Conditions IMR90
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... This miR-92b-mediated inhibition was eliminated when the seven-nucleotide miR-92b seed binding sequence was deleted (Fig. 3B). These results together suggest that p57 is one of the direct targets of miR-92b ...

- Sengupta, S. Nie, J. Wagner, R. J. Yang, C. et al., 2009, Stem Cells.

Article - Sengupta, S. Nie, J. Wagner, R. J. Yang, C. et al.
- Stem Cells, 2009
Human embryonic stem (ES) cells exhibit a shorter G(1) cell cycle phase than most somatic cells. Here, we examine the role of an abundant, human ES cell-enriched microRNA, miR-92b, in cell cycle distribution. Inhibition of miR-92b in human ES cells results in a greater number of cells in the G(1) phase and a lower number in the S phase. Conversely, overexpression of miR-92b in differentiated cells results in a decreased number of cells in G1 phase and an increased number in S-phase. p57, a gene whose product inhibits G(1) to S-phase progression, is one of the predicted targets of miR-92b. Inhibition of miR-92b in human ES cells increases p57 protein levels, and miR-92b overexpression in differentiated cells decreases p57 protein levels. Furthermore, miR-92b inhibits a luciferase reporter construct that includes part of the 3' untranslated region of the p57 gene containing the predicted target of the miR-92b seed sequence. Thus, we show that the miRNA miR-92b directly downregulates protein levels of the G(1)/S checkpoint gene p57. STEM CELLS 2009;27:1524-1528.
LinkOut: [PMID: 19544458]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
635 hsa-miR-92b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001173 CORO1A coronin, actin binding protein, 1A 1 1
MIRT004048 SLC15A1 solute carrier family 15 (oligopeptide transporter), member 1 4 1
MIRT004293 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 3 1
MIRT004351 PRMT5 protein arginine methyltransferase 5 2 1
MIRT035518 NLK nemo-like kinase 1 1
MIRT040525 EFNB1 ephrin-B1 1 1
MIRT040526 GSTM3 glutathione S-transferase mu 3 (brain) 1 1
MIRT040527 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT040528 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT040529 AMIGO1 adhesion molecule with Ig-like domain 1 1 1
MIRT040530 FBXO31 F-box protein 31 1 1
MIRT040531 OR6V1 olfactory receptor, family 6, subfamily V, member 1 1 1
MIRT040532 RBBP5 retinoblastoma binding protein 5 1 1
MIRT040533 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT040534 NCL nucleolin 1 1
MIRT040535 NIPA2 non imprinted in Prader-Willi/Angelman syndrome 2 1 1
MIRT040536 MRPL39 mitochondrial ribosomal protein L39 1 1
MIRT040537 ANKRD52 ankyrin repeat domain 52 1 1
MIRT040538 PLXND1 plexin D1 1 1
MIRT040539 CTC1 CTS telomere maintenance complex component 1 1 1
MIRT040540 ZNF282 zinc finger protein 282 1 1
MIRT040541 HPS6 Hermansky-Pudlak syndrome 6 1 1
MIRT040542 WARS tryptophanyl-tRNA synthetase 1 1
MIRT040543 PRRC2B proline-rich coiled-coil 2B 1 3
MIRT040544 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 3
MIRT040545 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT040546 GPR55 G protein-coupled receptor 55 1 1
MIRT040547 FBXO21 F-box protein 21 1 1
MIRT040548 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT040549 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT040550 UROD uroporphyrinogen decarboxylase 1 1
MIRT040551 DNAJC30 DnaJ (Hsp40) homolog, subfamily C, member 30 1 2
MIRT040552 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT040553 SMAP2 small ArfGAP2 1 1
MIRT040554 IK IK cytokine, down-regulator of HLA II 1 1
MIRT040555 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT040556 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT040557 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT040558 MRPL53 mitochondrial ribosomal protein L53 1 1
MIRT040559 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 1 1
MIRT040560 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT040561 FOXN3 forkhead box N3 1 1
MIRT040562 HIST2H4B histone cluster 2, H4b 1 1
MIRT040563 ARL6IP4 ADP-ribosylation-like factor 6 interacting protein 4 1 1
MIRT040564 FLNA filamin A, alpha 1 1
MIRT040565 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT040566 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT040567 SFXN1 sideroflexin 1 1 1
MIRT040568 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT040569 ADCK4 aarF domain containing kinase 4 1 1
MIRT040570 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT040571 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT040572 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT040573 PIN4 protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) 1 1
MIRT040574 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT040575 DEXI Dexi homolog (mouse) 1 1
MIRT040576 RPS3A ribosomal protein S3A 1 1
MIRT040577 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT040578 PFN1 profilin 1 1 1
MIRT040579 TAF12 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa 1 1
MIRT040580 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 2
MIRT040581 MEX3B mex-3 homolog B (C. elegans) 1 1
MIRT040582 HEATR2 HEAT repeat containing 2 1 1
MIRT040583 RTKN2 rhotekin 2 1 1
MIRT040584 SIN3A SIN3 transcription regulator homolog A (yeast) 1 1
MIRT040585 PHF23 PHD finger protein 23 1 1
MIRT040586 FLNB filamin B, beta 1 1
MIRT040587 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT040588 XPO7 exportin 7 1 1
MIRT040589 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT040590 RAN RAN, member RAS oncogene family 1 1
MIRT040591 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT040592 GSS glutathione synthetase 1 1
MIRT040593 ZBTB48 zinc finger and BTB domain containing 48 1 1
MIRT040594 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT040595 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 2
MIRT040596 METRN meteorin, glial cell differentiation regulator 1 1
MIRT040597 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT040598 RERE arginine-glutamic acid dipeptide (RE) repeats 1 1
MIRT040599 USF1 upstream transcription factor 1 1 1
MIRT040600 CEP152 centrosomal protein 152kDa 1 1
MIRT040601 ADAT1 adenosine deaminase, tRNA-specific 1 1 1
MIRT040602 NONO non-POU domain containing, octamer-binding 1 1
MIRT040603 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT040604 NABP2 nucleic acid binding protein 2 1 1
MIRT040605 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT040606 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT040607 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT040608 DOCK11 dedicator of cytokinesis 11 1 1
MIRT040609 OGFR opioid growth factor receptor 1 1
MIRT040610 LARS leucyl-tRNA synthetase 1 1
MIRT040611 SRP68 signal recognition particle 68kDa 1 1
MIRT040612 UNC5B unc-5 homolog B (C. elegans) 1 1
MIRT040613 SOGA1 suppressor of glucose, autophagy associated 1 1 1
MIRT040614 LYST lysosomal trafficking regulator 1 1
MIRT040615 SPC24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT040616 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT040617 RPL8 ribosomal protein L8 1 1
MIRT040618 ARID1B AT rich interactive domain 1B (SWI1-like) 1 4
MIRT040619 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT040620 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT040621 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT040622 TMEM115 transmembrane protein 115 1 1
MIRT040623 GATA6 GATA binding protein 6 1 2
MIRT040624 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT040625 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT040626 RPS28 ribosomal protein S28 1 1
MIRT040627 SYNGAP1 synaptic Ras GTPase activating protein 1 1 1
MIRT040628 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT040629 RPLP0 ribosomal protein, large, P0 1 1
MIRT040630 EDF1 endothelial differentiation-related factor 1 1 1
MIRT040631 RPS4X ribosomal protein S4, X-linked 1 1
MIRT040632 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT040633 GPX1 glutathione peroxidase 1 1 1
MIRT040634 ACTN4 actinin, alpha 4 1 1
MIRT040635 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT040636 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT040637 PARVG parvin, gamma 1 1
MIRT040638 TLN1 talin 1 1 1
MIRT040639 PHF19 PHD finger protein 19 1 1
MIRT040640 SLCO4A1 solute carrier organic anion transporter family, member 4A1 1 1
MIRT040641 COPA coatomer protein complex, subunit alpha 1 1
MIRT040642 FJX1 four jointed box 1 (Drosophila) 1 1
MIRT040643 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT040644 ATP13A1 ATPase type 13A1 1 1
MIRT040645 BAG6 BCL2-associated athanogene 6 1 1
MIRT040646 RBM10 RNA binding motif protein 10 1 1
MIRT040647 HIST1H2BF histone cluster 1, H2bf 1 1
MIRT040648 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT040649 KEAP1 kelch-like ECH-associated protein 1 1 1
MIRT040650 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT040651 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT040652 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT040653 IGSF8 immunoglobulin superfamily, member 8 1 1
MIRT040654 AKAP8 A kinase (PRKA) anchor protein 8 1 1
MIRT040655 RBM14 RNA binding motif protein 14 1 1
MIRT040656 PYCR2 pyrroline-5-carboxylate reductase family, member 2 1 1
MIRT040657 FASN fatty acid synthase 1 1
MIRT040658 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT040659 HIST1H2AM histone cluster 1, H2am 1 1
MIRT040660 FBN2 fibrillin 2 1 1
MIRT040661 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT040662 ORC1 origin recognition complex, subunit 1 1 1
MIRT040663 CISD1 CDGSH iron sulfur domain 1 1 1
MIRT040664 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT040665 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT040666 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT040667 RRP1 ribosomal RNA processing 1 homolog (S. cerevisiae) 1 1
MIRT040668 TNPO2 transportin 2 1 1
MIRT040669 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT040670 IARS isoleucyl-tRNA synthetase 1 1
MIRT040671 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT040672 G6PD glucose-6-phosphate dehydrogenase 1 1
MIRT040673 COX1 cytochrome c oxidase subunit I 1 1
MIRT040674 FAM58A family with sequence similarity 58, member A 1 1
MIRT040675 MPHOSPH10 M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) 1 1
MIRT040676 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT040677 DENND4A DENN/MADD domain containing 4A 1 1
MIRT040678 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT040679 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT040680 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT040681 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT040682 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 5
MIRT040683 CAPRIN1 cell cycle associated protein 1 1 1
MIRT040684 RPL3 ribosomal protein L3 1 1
MIRT040685 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT040686 PHRF1 PHD and ring finger domains 1 1 1
MIRT040687 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT040688 WDR82 WD repeat domain 82 1 1
MIRT040689 PSMB3 proteasome (prosome, macropain) subunit, beta type, 3 1 1
MIRT040690 GRB2 growth factor receptor-bound protein 2 1 1
MIRT040691 BRD8 bromodomain containing 8 1 1
MIRT040692 TSPYL1 TSPY-like 1 1 1
MIRT040693 CCDC22 coiled-coil domain containing 22 1 1
MIRT040694 XPO5 exportin 5 1 1
MIRT040695 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT040696 THAP10 THAP domain containing 10 1 1
MIRT040697 GRHPR glyoxylate reductase/hydroxypyruvate reductase 1 1
MIRT040698 PWP1 PWP1 homolog (S. cerevisiae) 1 1
MIRT040699 SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 1 1
MIRT040700 BBX bobby sox homolog (Drosophila) 1 1
MIRT040701 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT040702 ABR active BCR-related 1 1
MIRT040703 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT040704 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT040705 FAM3C family with sequence similarity 3, member C 1 1
MIRT040706 PSMA7 proteasome (prosome, macropain) subunit, alpha type, 7 1 1
MIRT040707 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT040708 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT040709 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT040710 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT040711 ERICH1 glutamate-rich 1 1 1
MIRT040712 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT040713 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT040714 PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 1 1
MIRT040715 LDLR low density lipoprotein receptor 1 1
MIRT040716 RBM8A RNA binding motif protein 8A 1 1
MIRT040717 PARK7 parkinson protein 7 1 1
MIRT040718 POM121 POM121 transmembrane nucleoporin 1 1
MIRT040719 RPS14 ribosomal protein S14 1 1
MIRT040720 TUBB6 tubulin, beta 6 class V 1 1
MIRT040721 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT040722 GLOD4 glyoxalase domain containing 4 1 1
MIRT040723 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT040724 SSRP1 structure specific recognition protein 1 1 1
MIRT040725 SYMPK symplekin 1 1
MIRT040726 PRR5 proline rich 5 (renal) 1 1
MIRT040727 ORAOV1 oral cancer overexpressed 1 1 1
MIRT040728 TCP11L1 t-complex 11, testis-specific-like 1 1 1
MIRT040729 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT040730 MDK midkine (neurite growth-promoting factor 2) 1 1
MIRT040731 LTBP3 latent transforming growth factor beta binding protein 3 1 1
MIRT040732 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT040733 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT040734 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT040735 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT040736 SURF6 surfeit 6 1 1
MIRT040737 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 1
MIRT040738 RNF181 ring finger protein 181 1 1
MIRT040739 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT055316 DUSP5 dual specificity phosphatase 5 1 5
MIRT055793 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 6
MIRT057115 DDIT4 DNA-damage-inducible transcript 4 1 2
MIRT059667 GATAD2B GATA zinc finger domain containing 2B 1 2
MIRT059927 ZDHHC5 zinc finger, DHHC-type containing 5 1 2
MIRT061613 BTG2 BTG family, member 2 1 3
MIRT061743 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT066481 HMGA2 high mobility group AT-hook 2 1 1
MIRT068743 COG3 component of oligomeric golgi complex 3 1 1
MIRT069314 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT069390 ZFYVE21 zinc finger, FYVE domain containing 21 1 1
MIRT069975 GEMIN2 gem (nuclear organelle) associated protein 2 1 1
MIRT072532 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT074765 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 2
MIRT075713 GAN gigaxonin 1 1
MIRT076202 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT077390 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT077513 UBE2Z ubiquitin-conjugating enzyme E2Z 1 2
MIRT077904 TOB1 transducer of ERBB2, 1 1 4
MIRT079207 GAA glucosidase, alpha; acid 1 1
MIRT082251 MED29 mediator complex subunit 29 1 2
MIRT082435 CIC capicua homolog (Drosophila) 1 4
MIRT082477 PPP1R37 protein phosphatase 1, regulatory subunit 37 1 1
MIRT082779 ZNF264 zinc finger protein 264 1 1
MIRT084534 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 5
MIRT085310 UBXN4 UBX domain protein 4 1 5
MIRT086367 SSFA2 sperm specific antigen 2 1 5
MIRT087456 NF2 neurofibromin 2 (merlin) 1 1
MIRT088866 FOXN2 forkhead box N2 1 7
MIRT091083 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT092186 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 4
MIRT092327 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 4
MIRT092391 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT093534 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 1 3
MIRT095658 TRIO trio Rho guanine nucleotide exchange factor 1 1
MIRT096936 PAPD7 PAP associated domain containing 7 1 5
MIRT097027 MAP1B microtubule-associated protein 1B 1 2
MIRT097115 TNPO1 transportin 1 1 1
MIRT097151 FCHO2 FCH domain only 2 1 1
MIRT097276 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 1 1
MIRT099140 MYLIP myosin regulatory light chain interacting protein 1 4
MIRT099907 SOX4 SRY (sex determining region Y)-box 4 1 7
MIRT101286 FAM135A family with sequence similarity 135, member A 1 1
MIRT102291 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 6
MIRT102509 KLHDC10 kelch domain containing 10 1 2
MIRT102894 INSIG1 insulin induced gene 1 1 2
MIRT103438 SNX10 sorting nexin 10 1 1
MIRT104749 FZD6 frizzled family receptor 6 1 1
MIRT106278 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT107664 TESK1 testis-specific kinase 1 1 1
MIRT109190 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 3
MIRT109929 CDK16 cyclin-dependent kinase 16 1 1
MIRT126396 EDRF1 chromosome 10 open reading frame 137 1 1
MIRT127293 VDAC2 voltage-dependent anion channel 2 1 1
MIRT128091 KIF1B kinesin family member 1B 1 1
MIRT129552 FAR1 fatty acyl CoA reductase 1 1 1
MIRT129995 CPTP glycolipid transfer protein domain containing 1 1 1
MIRT130353 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT130487 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT131664 UVRAG UV radiation resistance associated gene 1 1
MIRT131821 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT134141 KLHL42 kelch domain containing 5 1 1
MIRT135571 SPRYD4 SPRY domain containing 4 1 2
MIRT136301 NECAP1 NECAP endocytosis associated 1 1 1
MIRT140807 SMAD6 SMAD family member 6 1 1
MIRT142666 KIAA0556 KIAA0556 1 1
MIRT143326 PAPD5 PAP associated domain containing 5 1 1
MIRT143605 RBL2 retinoblastoma-like 2 (p130) 1 1
MIRT144952 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT150805 ZNF430 zinc finger protein 430 1 1
MIRT150925 ZNF492 zinc finger protein 492 1 1
MIRT154087 ARFGEF2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) 1 1
MIRT155532 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT156709 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT157000 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT161153 SLC25A36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 1 4
MIRT161328 SELT selenoprotein T 1 1
MIRT161829 MFN1 mitofusin 1 1 1
MIRT161900 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT162309 KAT2B K(lysine) acetyltransferase 2B 1 1
MIRT162448 GOLGA4 golgin A4 1 1
MIRT162574 KLHL18 kelch-like 18 (Drosophila) 1 1
MIRT163749 SETD5 SET domain containing 5 1 1
MIRT164002 KIAA1109 KIAA1109 1 3
MIRT164356 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164691 RNF4 ring finger protein 4 1 2
MIRT165187 GRAMD3 GRAM domain containing 3 1 1
MIRT167707 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 5
MIRT168061 E2F3 E2F transcription factor 3 1 1
MIRT168347 WRNIP1 Werner helicase interacting protein 1 1 1
MIRT169293 CD2AP CD2-associated protein 1 1
MIRT171361 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT171661 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT171785 CASD1 CAS1 domain containing 1 1 1
MIRT172288 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT172859 TACC1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT173873 DAB2IP DAB2 interacting protein 1 1
MIRT176126 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT178957 USP28 ubiquitin specific peptidase 28 1 1
MIRT185719 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT186265 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT186538 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 2
MIRT186631 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 4
MIRT189374 TXLNA taxilin alpha 1 2
MIRT190975 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT197014 EIF1 eukaryotic translation initiation factor 1 1 5
MIRT206438 YIPF4 Yip1 domain family, member 4 1 1
MIRT211230 FGF2 fibroblast growth factor 2 (basic) 1 5
MIRT214530 C5ORF24 chromosome 5 open reading frame 24 1 1
MIRT215685 PTGER4 prostaglandin E receptor 4 (subtype EP4) 1 1
MIRT216035 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 5
MIRT218085 TULP4 tubby like protein 4 1 2
MIRT242420 CCDC113 coiled-coil domain containing 113 1 2
MIRT243163 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT245512 KIF1BP KIAA1279 1 1
MIRT246120 QSER1 glutamine and serine rich 1 1 1
MIRT247154 OTUD3 OTU domain containing 3 1 1
MIRT250944 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 2
MIRT253351 ZNF417 zinc finger protein 417 1 1
MIRT271969 ARF1 ADP-ribosylation factor 1 1 1
MIRT273218 ZNF695 zinc finger protein 695 1 2
MIRT282778 SNN stannin 1 1
MIRT296116 SLC12A5 solute carrier family 12 (potassium/chloride transporter), member 5 1 1
MIRT301712 TEF thyrotrophic embryonic factor 1 1
MIRT322175 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 2
MIRT341540 CNIH1 cornichon homolog (Drosophila) 1 4
MIRT356063 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT438225 DKK3 dickkopf 3 homolog (Xenopus laevis) 2 1
MIRT438261 PTEN phosphatase and tensin homolog 2 2
MIRT438481 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT438641 SMAD3 SMAD family member 3 3 1
MIRT439088 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT443577 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT448829 FKBP1A FK506 binding protein 1A, 12kDa 1 2
MIRT451492 FOPNL FGFR1OP N-terminal like 1 1
MIRT452693 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT453165 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT454586 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 2
MIRT455792 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 2
MIRT456008 CYP2C19 cytochrome P450, family 2, subfamily C, polypeptide 19 1 1
MIRT456042 KIAA1586 KIAA1586 1 1
MIRT456761 TMEM239 transmembrane protein 239 1 2
MIRT458066 NLRP9 NLR family, pyrin domain containing 9 1 1
MIRT459228 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT459532 MFF mitochondrial fission factor 1 3
MIRT459757 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT460234 TNFRSF13C tumor necrosis factor receptor superfamily, member 13C 1 1
MIRT461102 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT462922 ZNRF3 zinc and ring finger 3 1 1
MIRT463474 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463514 ZBTB8B zinc finger and BTB domain containing 8B 1 2
MIRT465501 TOR1B torsin family 1, member B (torsin B) 1 1
MIRT469523 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 4
MIRT470077 PTGES2 prostaglandin E synthase 2 1 1
MIRT471579 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT473452 MCOLN2 mucolipin 2 1 4
MIRT475879 H3F3C H3 histone, family 3C 1 5
MIRT475916 H3F3B H3 histone, family 3B (H3.3B) 1 4
MIRT476197 GOLGA8A golgin A8 family, member A 1 5
MIRT476316 GM2A GM2 ganglioside activator 1 1
MIRT476677 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 5
MIRT478373 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT479543 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT481022 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT491007 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT493167 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT494346 CASKIN1 CASK interacting protein 1 1 1
MIRT499085 ZDHHC21 zinc finger, DHHC-type containing 21 1 3
MIRT500027 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 4
MIRT501294 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 3
MIRT503126 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 4
MIRT503299 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 3
MIRT504326 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504469 EID2B EP300 interacting inhibitor of differentiation 2B 1 2
MIRT504653 RPL9 ribosomal protein L9 1 3
MIRT505329 TMF1 TATA element modulatory factor 1 1 5
MIRT505729 SERTAD3 SERTA domain containing 3 1 3
MIRT505823 RSBN1 round spermatid basic protein 1 1 4
MIRT506003 PURG purine-rich element binding protein G 1 4
MIRT506807 KLHL15 kelch-like 15 (Drosophila) 1 4
MIRT507121 GOLGA8B golgin A8 family, member B 1 4
MIRT507351 FAM129A family with sequence similarity 129, member A 1 4
MIRT507676 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 2
MIRT507701 CNOT2 CCR4-NOT transcription complex, subunit 2 1 4
MIRT508010 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 2
MIRT510437 ZIC5 Zic family member 5 1 3
MIRT510541 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 2
MIRT510598 TPPP tubulin polymerization promoting protein 1 3
MIRT511059 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 3
MIRT511854 GOLGA8J golgin A8 family, member J 1 3
MIRT511863 GOLGA8I golgin A8 family, member I 1 3
MIRT512568 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 1
MIRT512706 ZNF134 zinc finger protein 134 1 3
MIRT513175 MOAP1 modulator of apoptosis 1 1 3
MIRT513788 PAWR PRKC, apoptosis, WT1, regulator 1 3
MIRT515098 IRGQ immunity-related GTPase family, Q 1 1
MIRT515479 INCENP inner centromere protein antigens 135/155kDa 1 2
MIRT517414 BMP8A bone morphogenetic protein 8a 1 1
MIRT518752 C1orf35 chromosome 1 open reading frame 35 1 1
MIRT519778 ZNF354B zinc finger protein 354B 1 2
MIRT519863 ZFP62 zinc finger protein 62 homolog (mouse) 1 3
MIRT520511 TRAM2 translocation associated membrane protein 2 1 4
MIRT521069 SLC25A32 solute carrier family 25 (mitochondrial folate carrier) , member 32 1 3
MIRT526910 ZNF772 zinc finger protein 772 1 3
MIRT527132 GULP1 GULP, engulfment adaptor PTB domain containing 1 1 1
MIRT527865 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT528402 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT532954 ZNF24 zinc finger protein 24 1 2
MIRT533020 ZFC3H1 zinc finger, C3H1-type containing 1 3
MIRT533193 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT534194 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 2
MIRT534963 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 2
MIRT536398 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT537050 GRAMD4 GRAM domain containing 4 1 1
MIRT537126 GOLGA3 golgin A3 1 3
MIRT537182 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 2
MIRT537653 ERGIC2 ERGIC and golgi 2 1 2
MIRT538634 CCSER2 family with sequence similarity 190, member B 1 2
MIRT539228 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 4
MIRT540097 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT540995 ZNF460 zinc finger protein 460 1 2
MIRT541470 AURKA aurora kinase A 1 2
MIRT542677 SESN3 sestrin 3 1 1
MIRT542755 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT542861 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT542929 HOXC8 homeobox C8 1 1
MIRT543745 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT544402 ZSCAN12 zinc finger and SCAN domain containing 12 1 1
MIRT544581 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544660 MED19 mediator complex subunit 19 1 1
MIRT545249 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT545259 TRIM36 tripartite motif containing 36 1 2
MIRT545742 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT546001 WDR81 WD repeat domain 81 1 1
MIRT546042 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT547168 PDZD8 PDZ domain containing 8 1 1
MIRT547275 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT547730 KIF5B kinesin family member 5B 1 2
MIRT548202 FNIP1 folliculin interacting protein 1 1 1
MIRT548754 CNNM4 cyclin M4 1 1
MIRT549639 ZNF75A zinc finger protein 75a 1 1
MIRT549682 ZNF598 zinc finger protein 598 1 1
MIRT550195 MRO maestro 1 1
MIRT550338 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT550534 MYZAP myocardial zonula adherens protein 1 1
MIRT550973 TOR4A torsin family 4, member A 1 1
MIRT551219 CIDEC cell death-inducing DFFA-like effector c 1 1
MIRT551353 AGBL5 ATP/GTP binding protein-like 5 1 1
MIRT551569 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT552275 RAB3D RAB3D, member RAS oncogene family 1 1
MIRT552659 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT553079 UCK2 uridine-cytidine kinase 2 1 1
MIRT553755 TBC1D8 TBC1 domain family, member 8 (with GRAM domain) 1 1
MIRT554028 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT554097 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT554158 SLX4 SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) 1 1
MIRT554813 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT555524 PMEPA1 prostate transmembrane protein, androgen induced 1 1 1
MIRT555596 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase, type I, gamma 1 2
MIRT555633 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 3
MIRT555684 PGAM4 phosphoglycerate mutase family member 4 1 2
MIRT555831 PAX9 paired box 9 1 1
MIRT555872 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT555943 NUP43 nucleoporin 43kDa 1 2
MIRT555998 NFYB nuclear transcription factor Y, beta 1 1
MIRT556341 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT556431 LONRF3 LON peptidase N-terminal domain and ring finger 3 1 1
MIRT556583 LHFPL2 lipoma HMGIC fusion partner-like 2 1 3
MIRT556799 KIAA1958 KIAA1958 1 1
MIRT558049 EXOC5 exocyst complex component 5 1 2
MIRT558695 CLTA clathrin, light chain A 1 1
MIRT559189 BMPR1A bone morphogenetic protein receptor, type IA 1 2
MIRT559643 AKAP10 A kinase (PRKA) anchor protein 10 1 1
MIRT559705 AEN apoptosis enhancing nuclease 1 1
MIRT560671 SRFBP1 serum response factor binding protein 1 1 1
MIRT560988 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT562168 HOXA13 homeobox A13 1 1
MIRT562276 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT563622 ZNF277 zinc finger protein 277 1 1
MIRT563813 FMN1 formin 1 1 1
MIRT564094 TLR3 toll-like receptor 3 1 1
MIRT565318 TMEM41A transmembrane protein 41A 1 1
MIRT565983 RNF44 ring finger protein 44 1 1
MIRT566049 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 2
MIRT568234 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT568311 BAK1 BCL2-antagonist/killer 1 1 1
MIRT572374 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT574819 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 2
MIRT609210 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT616216 RBM27 RNA binding motif protein 27 1 1
MIRT629086 FASLG Fas ligand (TNF superfamily, member 6) 1 1
MIRT632122 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT632574 POLQ polymerase (DNA directed), theta 1 1
MIRT634802 ENTHD1 ENTH domain containing 1 1 1
MIRT636551 ESRP1 epithelial splicing regulatory protein 1 1 1
MIRT640975 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT653873 SH2B3 SH2B adaptor protein 3 1 1
MIRT655596 OTUD7B OTU domain containing 7B 1 1
MIRT659762 CCDC171 coiled-coil domain containing 171 1 1
MIRT660742 ALG14 asparagine-linked glycosylation 14 homolog (S. cerevisiae) 1 1
MIRT681035 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 1
MIRT682303 RBM28 RNA binding motif protein 28 1 1
MIRT682571 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT686215 ZNF267 zinc finger protein 267 1 1
MIRT687207 PLXNA3 plexin A3 1 1
MIRT690628 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT692417 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT694435 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 1
MIRT700723 PNO1 partner of NOB1 homolog (S. cerevisiae) 1 1
MIRT701547 NARF nuclear prelamin A recognition factor 1 1
MIRT704377 DAND5 DAN domain family, member 5 1 1
MIRT707938 PPP1R3D protein phosphatase 1, regulatory subunit 3D 1 2
MIRT709937 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT711369 MED7 mediator complex subunit 7 1 1
MIRT712326 PER2 period homolog 2 (Drosophila) 1 2
MIRT714513 SHE Src homology 2 domain containing E 1 1
MIRT715518 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT724292 OSMR oncostatin M receptor 1 1
MIRT725355 MUC21 mucin 21, cell surface associated 1 1
MIRT726002 ZNF98 zinc finger protein 98 1 1
MIRT726018 ZNF721 zinc finger protein 721 1 1
MIRT726042 ZNF224 zinc finger protein 224 1 1
MIRT726052 ZNF17 zinc finger protein 17 1 1
MIRT726090 XRN1 5'-3' exoribonuclease 1 1 1
MIRT726117 VPS54 vacuolar protein sorting 54 homolog (S. cerevisiae) 1 1
MIRT726227 TSC1 tuberous sclerosis 1 1 1
MIRT726252 TOB2 transducer of ERBB2, 2 1 1
MIRT726296 TMEM194A transmembrane protein 194A 1 1
MIRT726299 TMEM184B transmembrane protein 184B 1 1
MIRT726405 SYNJ1 synaptojanin 1 1 1
MIRT726406 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT726452 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT726464 SPOCK2 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 1 1
MIRT726492 SMAD7 SMAD family member 7 1 1
MIRT726502 SLC9A1 solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 1 1
MIRT726512 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT726527 SLC39A6 solute carrier family 39 (zinc transporter), member 6 1 1
MIRT726540 SLC37A3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1 1
MIRT726549 SLC25A16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 1 1
MIRT726562 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT726576 SIK1 salt-inducible kinase 1 1 1
MIRT726584 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT726597 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT726603 PEAK1 NKF3 kinase family member 1 1
MIRT726614 SCAF11 SR-related CTD-associated factor 11 1 1
MIRT726624 SERTAD2 SERTA domain containing 2 1 1
MIRT726704 RP2 retinitis pigmentosa 2 (X-linked recessive) 1 1
MIRT726739 RNF103 ring finger protein 103 1 1
MIRT726759 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT726796 RAD21 RAD21 homolog (S. pombe) 1 1
MIRT726800 RABL5 RAB, member RAS oncogene family-like 5 1 1
MIRT726806 RAB7B RAB7B, member RAS oncogene family 1 1
MIRT726846 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT726848 PSMD5 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 1 1
MIRT726890 PPP1R12C protein phosphatase 1, regulatory subunit 12C 1 1
MIRT726897 PPCS phosphopantothenoylcysteine synthetase 1 1
MIRT726931 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT726941 PIK3AP1 phosphoinositide-3-kinase adaptor protein 1 1 1
MIRT727005 PBLD phenazine biosynthesis-like protein domain containing 1 1
MIRT727070 NPTN neuroplastin 1 1
MIRT727073 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT727119 MYO5A myosin VA (heavy chain 12, myoxin) 1 1
MIRT727121 MYO1D myosin ID 1 1
MIRT727139 MTMR1 myotubularin related protein 1 1 1
MIRT727144 MTF1 metal-regulatory transcription factor 1 1 1
MIRT727148 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT727155 MRPL19 mitochondrial ribosomal protein L19 1 1
MIRT727163 MPP1 membrane protein, palmitoylated 1, 55kDa 1 1
MIRT727199 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT727214 MEF2D myocyte enhancer factor 2D 1 1
MIRT727231 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT727240 MBD2 methyl-CpG binding domain protein 2 1 1
MIRT727243 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT727259 MAN2A1 mannosidase, alpha, class 2A, member 1 1 1
MIRT727323 LAMP2 lysosomal-associated membrane protein 2 1 1
MIRT727339 KLHL14 kelch-like 14 (Drosophila) 1 1
MIRT727388 JOSD1 Josephin domain containing 1 1 1
MIRT727462 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT727474 ICAM1 intercellular adhesion molecule 1 1 1
MIRT727479 IBTK inhibitor of Bruton agammaglobulinemia tyrosine kinase 1 1
MIRT727511 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 1 1
MIRT727527 GRAMD1B GRAM domain containing 1B 1 1
MIRT727564 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT727581 GIT2 G protein-coupled receptor kinase interacting ArfGAP 2 1 1
MIRT727621 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT727630 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT727656 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT727709 FAM46A family with sequence similarity 46, member A 1 1
MIRT727715 FAM126B family with sequence similarity 126, member B 1 1
MIRT727739 EVI5 ecotropic viral integration site 5 1 1
MIRT727762 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT727816 EARS2 glutamyl-tRNA synthetase 2, mitochondrial 1 1
MIRT727826 DYNLT3 dynein, light chain, Tctex-type 3 1 1
MIRT727844 DUSP10 dual specificity phosphatase 10 1 1
MIRT727846 DUS2L dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) 1 1
MIRT727850 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT727861 DOCK9 dedicator of cytokinesis 9 1 1
MIRT727871 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT727875 DNAJB12 DnaJ (Hsp40) homolog, subfamily B, member 12 1 1
MIRT727884 DENND4B DENN/MADD domain containing 4B 1 1
MIRT727904 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT727939 CREB3L2 cAMP responsive element binding protein 3-like 2 1 1
MIRT728008 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT728015 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT728021 CD69 CD69 molecule 1 1
MIRT728085 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT728112 C21orf91 chromosome 21 open reading frame 91 1 1
MIRT728114 C20orf112 chromosome 20 open reading frame 112 1 1
MIRT728169 C10orf118 chromosome 10 open reading frame 118 1 1
MIRT728204 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT728217 BCAT2 branched chain amino-acid transaminase 2, mitochondrial 1 1
MIRT728247 ATXN1 ataxin 1 1 1
MIRT728261 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT728388 ADAM10 ADAM metallopeptidase domain 10 1 1
MIRT728411 ACAA1 acetyl-CoA acyltransferase 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*