Accession ID: MIRT004293 [miRNA, hsa-miR-92b-3p :: CDKN1C, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-92bLinkOut: [miRBase ]
Synonyms MIRN92B, hsa-mir-92b, MIR92B
Description Homo sapiens miR-92b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-92b-3p
Mature Sequence 61| UAUUGCACUCGUCCCGGCCUCC |82
Evidence Experimental
Experiments Microarray
Putative hsa-miR-92b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1C LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BWCR, BWS, KIP2, WBS, p57
Description cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Transcript NM_0000    LinkOut: [ RefSeq ]
Other Transcripts NM_0011226 , NM_0011226   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1C LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1C
(miRNA target sites are highlighted)
>CDKN1C|NM_0000|3'UTR
   1 TGAGCCAATTTAGAGCCCAAAGAGCCCCGAGGGAACCTGCCGGGGCAGCGGACGTTGGAAGGGCGCTGGGCCTCGGCTGG
  81 GACCGTTCATGTAGCAGCAACCGGCGGCGGCTGCCGCAGAGCAGCGTTCGGTTTTGTTTTTAAATTTTGAAAACTGTGCA
 161 ATGTATTAATAACGTCTTTTTATATCTAAATGTATTCTGCACGAGAAGGTACACTGGTCCCAAGGTGTAAAGCTTTAAGA
 241 GTCATTTATATAAAATGTTTAATCTCTGCTGAAACTCAGTGCAAAAAAAAGAAAAAAGAAAAAAAAAAGGAAAAAATAAA
 321 AAAACCATGTATATTTGTACAAAAAGTTTTTAAAGTTATACTAACTTATATTTTCTATTTATGTCCAGGCGTGGACCGCT
 401 CTGCCACGCACTAGCTCGGTTATTGGTTATGCCAAAGGCACTCTCCATCTCCCACATCTGGTTATTGACAAGTGTAACTT
 481 TATTTTCATCGCGGACTCTGGGGAAGGGGGTCACTCACAAGCTGTAGCTGCCATACATGCCCATCTAGCTTGCAGTCTCT
 561 TCGCGCTTTCGCTGTCTCTCTTATTATGACTGTGTTTATCTGAAACTTGAAGACAAGTCTGTTAAAATGGTTCCTGAGCC
 641 GTCTGTACCACTGCCCCGGCCCCTCGTCCGCCGGGTTCTAAATAAAGAGGCCGAAAAATGCTGCAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccuccggcccugcuCACGUUAu 5'
                        ||||||| 
Target 5' aaattttgaaaactGTGCAATg 3'
142 - 163 140.00 -8.10
2
miRNA  3' ccucCGGCCCUG-CUCACGUUau 5'
              ||:|  ||  |||||||  
Target 5' ctctGCTGAAACTCAGTGCAAaa 3'
264 - 286 134.00 -10.70
3
miRNA  3' ccuccggccCUGCUCACGUUau 5'
                   ||| ||||:||  
Target 5' ctggttattGACAAGTGTAAct 3'
458 - 479 121.00 -10.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-92b-3p :: CDKN1C    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Conditions IMR90
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... This miR-92b-mediated inhibition was eliminated when the seven-nucleotide miR-92b seed binding sequence was deleted (Fig. 3B). These results together suggest that p57 is one of the direct targets of miR-92b ...

- Sengupta, S. Nie, J. Wagner, R. J. Yang, C. et al., 2009, Stem Cells.

Article - Sengupta, S. Nie, J. Wagner, R. J. Yang, C. et al.
- Stem Cells, 2009
Human embryonic stem (ES) cells exhibit a shorter G(1) cell cycle phase than most somatic cells. Here, we examine the role of an abundant, human ES cell-enriched microRNA, miR-92b, in cell cycle distribution. Inhibition of miR-92b in human ES cells results in a greater number of cells in the G(1) phase and a lower number in the S phase. Conversely, overexpression of miR-92b in differentiated cells results in a decreased number of cells in G1 phase and an increased number in S-phase. p57, a gene whose product inhibits G(1) to S-phase progression, is one of the predicted targets of miR-92b. Inhibition of miR-92b in human ES cells increases p57 protein levels, and miR-92b overexpression in differentiated cells decreases p57 protein levels. Furthermore, miR-92b inhibits a luciferase reporter construct that includes part of the 3' untranslated region of the p57 gene containing the predicted target of the miR-92b seed sequence. Thus, we show that the miRNA miR-92b directly downregulates protein levels of the G(1)/S checkpoint gene p57. STEM CELLS 2009;27:1524-1528.
LinkOut: [PMID: 19544458]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
220 hsa-miR-92b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001173 CORO1A coronin, actin binding protein, 1A 1 1
MIRT004048 SLC15A1 solute carrier family 15 (oligopeptide transporter), member 1 4 1
MIRT004293 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 3 1
MIRT004351 PRMT5 protein arginine methyltransferase 5 2 1
MIRT035518 NLK nemo-like kinase 1 1
MIRT040525 EFNB1 ephrin-B1 1 1
MIRT040526 GSTM3 glutathione S-transferase mu 3 (brain) 1 1
MIRT040527 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT040528 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT040529 AMIGO1 adhesion molecule with Ig-like domain 1 1 1
MIRT040530 FBXO31 F-box protein 31 1 1
MIRT040531 OR6V1 olfactory receptor, family 6, subfamily V, member 1 1 1
MIRT040532 RBBP5 retinoblastoma binding protein 5 1 1
MIRT040533 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT040534 NCL nucleolin 1 1
MIRT040535 NIPA2 non imprinted in Prader-Willi/Angelman syndrome 2 1 1
MIRT040536 MRPL39 mitochondrial ribosomal protein L39 1 1
MIRT040537 ANKRD52 ankyrin repeat domain 52 1 1
MIRT040538 PLXND1 plexin D1 1 1
MIRT040539 CTC1 chromosome 17 open reading frame 68 1 1
MIRT040540 ZNF282 zinc finger protein 282 1 1
MIRT040541 HPS6 Hermansky-Pudlak syndrome 6 1 1
MIRT040542 WARS tryptophanyl-tRNA synthetase 1 1
MIRT040543 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT040544 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT040545 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT040546 GPR55 G protein-coupled receptor 55 1 1
MIRT040547 FBXO21 F-box protein 21 1 1
MIRT040548 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT040549 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT040550 UROD uroporphyrinogen decarboxylase 1 1
MIRT040551 DNAJC30 DnaJ (Hsp40) homolog, subfamily C, member 30 1 1
MIRT040552 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT040553 SMAP2 small ArfGAP2 1 1
MIRT040554 IK IK cytokine, down-regulator of HLA II 1 1
MIRT040555 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT040556 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT040557 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT040558 MRPL53 mitochondrial ribosomal protein L53 1 1
MIRT040559 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 1 1
MIRT040560 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT040561 FOXN3 forkhead box N3 1 1
MIRT040562 HIST2H4B histone cluster 2, H4b 1 1
MIRT040563 ARL6IP4 ADP-ribosylation-like factor 6 interacting protein 4 1 1
MIRT040564 FLNA filamin A, alpha 1 1
MIRT040565 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT040566 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT040567 SFXN1 sideroflexin 1 1 1
MIRT040568 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT040569 ADCK4 aarF domain containing kinase 4 1 1
MIRT040570 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT040571 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT040572 RNF168 ring finger protein 168 1 1
MIRT040573 PIN4 protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) 1 1
MIRT040574 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT040575 DEXI Dexi homolog (mouse) 1 1
MIRT040576 RPS3A ribosomal protein S3A 1 1
MIRT040577 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT040578 PFN1 profilin 1 1 1
MIRT040579 TAF12 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa 1 1
MIRT040580 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT040581 MEX3B mex-3 homolog B (C. elegans) 1 1
MIRT040582 HEATR2 HEAT repeat containing 2 1 1
MIRT040583 RTKN2 rhotekin 2 1 1
MIRT040584 SIN3A SIN3 homolog A, transcription regulator (yeast) 1 1
MIRT040585 PHF23 PHD finger protein 23 1 1
MIRT040586 FLNB filamin B, beta 1 1
MIRT040587 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT040588 XPO7 exportin 7 1 1
MIRT040589 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT040590 RAN RAN, member RAS oncogene family 1 1
MIRT040591 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT040592 GSS glutathione synthetase 1 1
MIRT040593 ZBTB48 zinc finger and BTB domain containing 48 1 1
MIRT040594 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT040595 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT040596 METRN meteorin, glial cell differentiation regulator 1 1
MIRT040597 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT040598 RERE arginine-glutamic acid dipeptide (RE) repeats 1 1
MIRT040599 USF1 upstream transcription factor 1 1 1
MIRT040600 CEP152 centrosomal protein 152kDa 1 1
MIRT040601 ADAT1 adenosine deaminase, tRNA-specific 1 1 1
MIRT040602 NONO non-POU domain containing, octamer-binding 1 1
MIRT040603 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT040604 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT040605 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT040606 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT040607 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT040608 DOCK11 dedicator of cytokinesis 11 1 1
MIRT040609 OGFR opioid growth factor receptor 1 1
MIRT040610 LARS leucyl-tRNA synthetase 1 1
MIRT040611 SRP68 signal recognition particle 68kDa 1 1
MIRT040612 UNC5B unc-5 homolog B (C. elegans) 1 1
MIRT040613 SOGA1 chromosome 20 open reading frame 117 1 1
MIRT040614 LYST lysosomal trafficking regulator 1 1
MIRT040615 SPC24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT040616 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT040617 RPL8 ribosomal protein L8 1 1
MIRT040618 ARID1B AT rich interactive domain 1B (SWI1-like) 1 1
MIRT040619 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT040620 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT040621 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT040622 TMEM115 transmembrane protein 115 1 1
MIRT040623 GATA6 GATA binding protein 6 1 1
MIRT040624 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT040625 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT040626 RPS28 ribosomal protein S28 1 1
MIRT040627 SYNGAP1 synaptic Ras GTPase activating protein 1 homolog (rat) 1 1
MIRT040628 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT040629 RPLP0 ribosomal protein, large, P0 1 1
MIRT040630 EDF1 endothelial differentiation-related factor 1 1 1
MIRT040631 RPS4X ribosomal protein S4, X-linked 1 1
MIRT040632 MBNL1 muscleblind-like (Drosophila) 1 1
MIRT040633 GPX1 glutathione peroxidase 1 1 1
MIRT040634 ACTN4 actinin, alpha 4 1 1
MIRT040635 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT040636 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT040637 PARVG parvin, gamma 1 1
MIRT040638 TLN1 talin 1 1 1
MIRT040639 PHF19 PHD finger protein 19 1 1
MIRT040640 SLCO4A1 solute carrier organic anion transporter family, member 4A1 1 1
MIRT040641 COPA coatomer protein complex, subunit alpha 1 1
MIRT040642 FJX1 four jointed box 1 (Drosophila) 1 1
MIRT040643 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT040644 ATP13A1 ATPase type 13A1 1 1
MIRT040645 BAG6 HLA-B associated transcript 3 1 1
MIRT040646 RBM10 RNA binding motif protein 10 1 1
MIRT040647 HIST1H2BF histone cluster 1, H2bf 1 1
MIRT040648 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT040649 KEAP1 kelch-like ECH-associated protein 1 1 1
MIRT040650 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT040651 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT040652 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT040653 IGSF8 immunoglobulin superfamily, member 8 1 1
MIRT040654 AKAP8 A kinase (PRKA) anchor protein 8 1 1
MIRT040655 RBM14 RNA binding motif protein 14 1 1
MIRT040656 PYCR2 pyrroline-5-carboxylate reductase family, member 2 1 1
MIRT040657 FASN fatty acid synthase 1 1
MIRT040658 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT040659 HIST1H2AM histone cluster 1, H2am 1 1
MIRT040660 FBN2 fibrillin 2 1 1
MIRT040661 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT040662 ORC1 origin recognition complex, subunit 1-like (yeast) 1 1
MIRT040663 CISD1 CDGSH iron sulfur domain 1 1 1
MIRT040664 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT040665 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT040666 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT040667 RRP1 ribosomal RNA processing 1 homolog (S. cerevisiae) 1 1
MIRT040668 TNPO2 transportin 2 1 1
MIRT040669 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT040670 IARS isoleucyl-tRNA synthetase 1 1
MIRT040671 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT040672 G6PD glucose-6-phosphate dehydrogenase 1 1
MIRT040673 COX1 cytochrome c oxidase subunit I 1 1
MIRT040674 FAM58A family with sequence similarity 58, member A 1 1
MIRT040675 MPHOSPH10 M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) 1 1
MIRT040676 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT040677 DENND4A DENN/MADD domain containing 4A 1 1
MIRT040678 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT040679 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT040680 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT040681 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT040682 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT040683 CAPRIN1 cell cycle associated protein 1 1 1
MIRT040684 RPL3 ribosomal protein L3 1 1
MIRT040685 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT040686 PHRF1 PHD and ring finger domains 1 1 1
MIRT040687 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT040688 WDR82 WD repeat domain 82 1 1
MIRT040689 PSMB3 proteasome (prosome, macropain) subunit, beta type, 3 1 1
MIRT040690 GRB2 growth factor receptor-bound protein 2 1 1
MIRT040691 BRD8 bromodomain containing 8 1 1
MIRT040692 TSPYL1 TSPY-like 1 1 1
MIRT040693 CCDC22 coiled-coil domain containing 22 1 1
MIRT040694 XPO5 exportin 5 1 1
MIRT040695 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT040696 THAP10 THAP domain containing 10 1 1
MIRT040697 GRHPR glyoxylate reductase/hydroxypyruvate reductase 1 1
MIRT040698 PWP1 PWP1 homolog (S. cerevisiae) 1 1
MIRT040699 SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 1 1
MIRT040700 BBX bobby sox homolog (Drosophila) 1 1
MIRT040701 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT040702 ABR active BCR-related gene 1 1
MIRT040703 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT040704 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT040705 FAM3C family with sequence similarity 3, member C 1 1
MIRT040706 PSMA7 proteasome (prosome, macropain) subunit, alpha type, 7 1 1
MIRT040707 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT040708 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT040709 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT040710 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT040711 ERICH1 glutamate-rich 1 1 1
MIRT040712 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT040713 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT040714 PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 1 1
MIRT040715 LDLR low density lipoprotein receptor 1 1
MIRT040716 RBM8A RNA binding motif protein 8A 1 1
MIRT040717 PARK7 Parkinson disease (autosomal recessive, early onset) 7 1 1
MIRT040718 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT040719 RPS14 ribosomal protein S14 1 1
MIRT040720 TUBB6 tubulin, beta 6 1 1
MIRT040721 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT040722 GLOD4 glyoxalase domain containing 4 1 1
MIRT040723 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT040724 SSRP1 structure specific recognition protein 1 1 1
MIRT040725 SYMPK symplekin 1 1
MIRT040726 PRR5 proline rich 5 (renal) 1 1
MIRT040727 ORAOV1 oral cancer overexpressed 1 1 1
MIRT040728 TCP11L1 t-complex 11 (mouse)-like 1 1 1
MIRT040729 PRRC2A HLA-B associated transcript 2 1 1
MIRT040730 MDK midkine (neurite growth-promoting factor 2) 1 1
MIRT040731 LTBP3 latent transforming growth factor beta binding protein 3 1 1
MIRT040732 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT040733 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT040734 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT040735 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT040736 SURF6 surfeit 6 1 1
MIRT040737 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 1
MIRT040738 RNF181 ring finger protein 181 1 1
MIRT040739 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1