Accession ID: MIRT004297 [miRNA, hsa-miR-101-3p :: PTGS2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-101-1LinkOut: [miRBase ]
Description Homo sapiens miR-101-1 stem-loop
Comment Reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-101-3p
Mature Sequence 47| UACAGUACUGUGAUAACUGAA |67
Evidence Experimental
Experiments Cloned
Putative hsa-miR-101-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PTGS2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms COX-2, COX2, GRIPGHS, PGG/HS, PGHS-2, PHS-2, hCox-2
Description prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Transcript NM_0009    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PTGS2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PTGS2
(miRNA target sites are highlighted)
>PTGS2|NM_0009|3'UTR
   1 TAGAAGTCTAATGATCATATTTATTTATTTATATGAACCATGTCTATTAATTTAATTATTTAATAATATTTATATTAAAC
  81 TCCTTATGTTACTTAACATCTTCTGTAACAGAAGTCAGTACTCCTGTTGCGGAGAAAGGAGTCATACTTGTGAAGACTTT
 161 TATGTCACTACTCTAAAGATTTTGCTGTTGCTGTTAAGTTTGGAAAACAGTTTTTATTCTGTTTTATAAACCAGAGAGAA
 241 ATGAGTTTTGACGTCTTTTTACTTGAATTTCAACTTATATTATAAGAACGAAAGTAAAGATGTTTGAATACTTAAACACT
 321 GTCACAAGATGGCAAAATGCTGAAAGTTTTTACACTGTCGATGTTTCCAATGCATCTTCCATGATGCATTAGAAGTAACT
 401 AATGTTTGAAATTTTAAAGTACTTTTGGTTATTTTTCTGTCATCAAACAAAAACAGGTATCAGTGCATTATTAAATGAAT
 481 ATTTAAATTAGACATTACCAGTAATTTCATGTCTACTTTTTAAAATCAGCAATGAAACAATAATTTGAAATTTCTAAATT
 561 CATAGGGTAGAATCACCTGTAAAAGCTTGTTTGATTTCTTAAAGTTATTAAACTTGTACATATACCAAAAAGAAGCTGTC
 641 TTGGATTTAAATCTGTAAAATCAGTAGAAATTTTACTACAATTGCTTGTTAAAATATTTTATAAGTGATGTTCCTTTTTC
 721 ACCAAGAGTATAAACCTTTTTAGTGTGACTGTTAAAACTTCCTTTTAAATCAAAATGCCAAATTTATTAAGGTGGTGGAG
 801 CCACTGCAGTGTTATCTTAAAATAAGAATATTTTGTTGAGATATTCCAGAATTTGTTTATATGGCTGGTAACATGTAAAA
 881 TCTATATCAGCAAAAGGGTCTACCTTTAAAATAAGCAATAACAAAGAAGAAAACCAAATTATTGTTCAAATTTAGGTTTA
 961 AACTTTTGAAGCAAACTTTTTTTTATCCTTGTGCACTGCAGGCCTGGTACTCAGATTTTGCTATGAGGTTAATGAAGTAC
1041 CAAGCTGTGCTTGAATAATGATATGTTTTCTCAGATTTTCTGTTGTACAGTTTAATTTAGCAGTCCATATCACATTGCAA
1121 AAGTAGCAATGACCTCATAAAATACCTCTTCAAAATGCTTAAATTCATTTCACACATTAATTTTATCTCAGTCTTGAAGC
1201 CAATTCAGTAGGTGCATTGGAATCAAGCCTGGCTACCTGCATGCTGTTCCTTTTCTTTTCTTCTTTTAGCCATTTTGCTA
1281 AGAGACACAGTCTTCTCATCACTTCGTTTCTCCTATTTTGTTTTACTAGTTTTAAGATCAGAGTTCACTTTCTTTGGACT
1361 CTGCCTATATTTTCTTACCTGAACTTTTGCAAGTTTTCAGGTAAACCTCAGCTCAGGACTGCTATTTAGCTCCTCTTAAG
1441 AAGATTAAAAGAGAAAAAAAAAGGCCCTTTTAAAAATAGTATACACTTATTTTAAGTGAAAAGCAGAGAATTTTATTTAT
1521 AGCTAATTTTAGCTATCTGTAACCAAGATGGATGCAAAGAGGCTAGTGCCTCAGAGAGAACTGTACGGGGTTTGTGACTG
1601 GAAAAAGTTACGTTCCCATTCTAATTAATGCCCTTTCTTATTTAAAAACAAAACCAAATGATATCTAAGTAGTTCTCAGC
1681 AATAATAATAATGACGATAATACTTCTTTTCCACATCTCATTGTCACTGACATTTAATGGTACTGTATATTACTTAATTT
1761 ATTGAAGATTATTATTTATGTCTTATTAGGACACTATGGTTATAAACTGTGTTTAAGCCTACAATCATTGATTTTTTTTT
1841 GTTATGTCACAATCAGTATATCTTCTTTGGGGTTACCTCTCTGAATATTATGTAAACAATCCAAAGAAATGATTGTATTA
1921 AGATTTGTGAATAAATTTTTAGAAATCTGATTGGCATATTGAGATATTTAAGGTTGAATGTTTGTCCTTAGGATAGGCCT
2001 ATGTGCTAGCCCACAAAGAATATTGTCTCATTAGCCTGAATGTGCCATAAGACTGACCTTTTAAAATGTTTTGAGGGATC
2081 TGTGGATGCTTCGTTAATTTGTTCAGCCACAATTTATTGAGAAAATATTCTGTGTCAAGCACTGTGGGTTTTAATATTTT
2161 TAAATCAAACGCTGATTACAGATAATAGTATTTATATAAATAATTGAAAAAAATTTTCTTTTGGGAAGAGGGAGAAAATG
2241 AAATAAATATCATTAAAGATAACTCAGGAGAATCTTCTTTACAATTTTACGTTTAGAATGTTTAAGGTTAAGAAAGAAAT
2321 AGTCAATATGCTTGTATAAAACACTGTTCACTGTTTTTTTTAAAAAAAAAACTTGATTTGTTATTAACATTGATCTGCTG
2401 ACAAAACCTGGGAATTTGGGTTGTGTATGCGAATGTTTCAGTGCCTCAGACAAATGTGTATTTAACTTATGTAAAAGATA
2481 AGTCTGGAAATAAATGTCTGTTTATTTTTGTACTATTTAAAAATTGACAGATCTTTTCTGAAGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-101-3p :: PTGS2    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot , Other
Conditions LS-174T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... luciferase activity significantly decreases after the cotransfection with both pGL3-seed and miR-101 ...

- Strillacci, A. Griffoni, C. Sansone, P. et al., 2009, Exp Cell Res.

Article - Strillacci, A. Griffoni, C. Sansone, P. et al.
- Exp Cell Res, 2009
Overexpressed cyclooxygenase-2 (COX-2) strongly contributes to the growth and invasiveness of tumoral cells in patients affected by colorectal cancer (CRC). It has been demonstrated that COX-2 overexpression depends on different cellular pathways involving both transcriptional and post-transcriptional regulations. We assumed that COX-2 expression could be regulated also by microRNAs (miRNAs) since these short RNA molecules participate to the fine regulation of several genes implicated in cell growth and differentiation. In this paper, we report the inverse correlation between COX-2 and miR-101 expression in colon cancer cell lines and we demonstrated in vitro the direct inhibition of COX-2 mRNA translation mediated by miR-101. Moreover, this correlation was supported by data collected ex vivo, in which colon cancer tissues and liver metastases derived from CRC patients were analyzed. These findings provide a novel molecular insight in the modulation of COX-2 at post-transcriptional level by miR-101 and strengthen the observation that miRNAs are highly implicated in the control of gene expression. An impairment of miR-101 levels could represent one of the leading causes of COX-2 overexpression in colon cancer cells.
LinkOut: [PMID: 19133256]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-101-3p :: PTGS2    [ Functional MTI ]
Validation Method qRT-PCR
Conditions BGC-823 , MKN-45 , SGC-7901
Disease Gastric cancer
Original Description (Extracted from the article) ... miR-101 inhibits expression of EZH2, Cox-2, Mcl-1 and Fos.//In this study, we report that the expression of microRNA-101 (miR-101) is down-regulated in gastric cancer tissues and cells, and ectopic expression of miR-101 significantly inhibits cellular proliferation, migration and invasion of gastric cancer cells by targeting EZH2, Cox-2, Mcl-1 and Fos.//As shown in Fig. 5, although infection of adenovirus up-regulated the expression of EZH2, Cox-2, Mcl-1 and Fos in different degree in gastric cancer cells, the ectopic expression of miR-101 still showed an inhibition effect on the expression of these four genes. The mRNA levels of EZH2, Cox-2, Mcl-1 and Fos in Ad-miR-101-infected BGC-823, SGC-7901, MKN-45 and AGS cells were much lower than the mRNA level of all the Ad-EGFP-infected cells, except the Cox-2 in SGC-7901 cells. ...

- Wang, H. J. Ruan, H. J. He, X. J. Ma, Y. Y. et al., 2010, Eur J Cancer.

Article - Wang, H. J. Ruan, H. J. He, X. J. Ma, Y. Y. et al.
- Eur J Cancer, 2010
MicroRNAs (miRNAs) are short non-coding RNA molecules playing regulatory roles by repressing translation or cleaving RNA transcripts. Dysregulated expression of miRNAs is associated with several diseases, including cancer. In this study, we report that the expression of microRNA-101 (miR-101) is down-regulated in gastric cancer tissues and cells, and ectopic expression of miR-101 significantly inhibits cellular proliferation, migration and invasion of gastric cancer cells by targeting EZH2, Cox-2, Mcl-1 and Fos. Our animal study also indicates that miR-101 could potentially suppress tumour growth in vivo. Collectively, these results suggest that miR-101 may function as a tumour suppressor in gastric cancer, as it has an inhibitory role not only in cellular proliferation, migration and invasion in vitro, but also in tumour growth in vivo.
LinkOut: [PMID: 20712078]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-101-3p :: PTGS2    [ Functional MTI ]
Validation Method qRT-PCR , Western blot
Conditions SGC-7901 , BCG-823
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... miR-101 interacts directly with the 3 ′ -UTR of COX-2 mRNA, ...

- He, X. P. Shao, Y. Li, X. L. Xu, W. Chen, et al., 2012, FEBS J.

Article - He, X. P. Shao, Y. Li, X. L. Xu, W. Chen, et al.
- FEBS J, 2012
Cyclooxygenase-2 (COX-2) plays an important role in the carcinogenesis and progression of gastric cancer. It has been demonstrated that COX-2 overexpression depends on different cellular pathways, involving both transcriptional and post-transcriptional regulation. MicroRNAs (miRNAs) are small, noncoding RNAs that function as post-transcriptional regulators. Here, we characterize miR-101 expression and its role in the regulation of COX-2 expression, which in turn, will provide us with additional insights into the potential therapeutic benefits of exogenous miR-101 for treatment of gastric cancer. Our results showed that miR-101 levels in gastric cancer tissues were significantly lower than those in the matched normal tissue (P < 0.01). Furthermore, lower levels of miR-101 were associated with increased tumor invasion and lymph node metastasis (P < 0.05). We also found an inverse correlation between miR-101 and COX-2 expression in both gastric cancer specimens and cell lines. Significant decreases in COX-2 mRNA and COX-2 levels were observed in the pre-miR-101-infected gastric cancer cells. One possible mechanism of interaction is that miR-101 inhibited COX-2 expression by directly binding to the 3'-UTR of COX-2 mRNA. Overexpression of miR-101 in gastric cancer cell lines also inhibited cell proliferation and induced apoptosis in vitro, as well as inhibiting tumor growth in vivo. These results collectively indicate that miR-101 may function as a tumor suppressor in gastric cancer, with COX-2 as a direct target.
LinkOut: [PMID: 23013439]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
174 hsa-miR-101-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000378 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 3 4
MIRT000379 ATXN1 ataxin 1 5 2
MIRT000381 EZH2 enhancer of zeste homolog 2 (Drosophila) 5 10
MIRT000430 APP amyloid beta (A4) precursor protein 4 2
MIRT001219 FOS FBJ murine osteosarcoma viral oncogene homolog 4 5
MIRT002436 ICOS inducible T-cell co-stimulator 1 1
MIRT003921 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 4 4
MIRT003965 COX2 cytochrome c oxidase subunit II 2 1
MIRT004012 FBN2 fibrillin 2 2 1
MIRT004027 ARID1A AT rich interactive domain 1A (SWI-like) 3 2
MIRT004084 SUZ12 suppressor of zeste 12 homolog (Drosophila) 2 1
MIRT004086 EED embryonic ectoderm development 2 1
MIRT004297 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 4 3
MIRT005560 ATM ataxia telangiectasia mutated 3 1
MIRT005602 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 4 1
MIRT005876 DUSP1 dual specificity phosphatase 1 3 1
MIRT006149 STMN1 stathmin 1 4 2
MIRT006150 RAB5A RAB5A, member RAS oncogene family 5 2
MIRT006151 ATG4D ATG4 autophagy related 4 homolog D (S. cerevisiae) 4 1
MIRT007091 SOX9 SRY (sex determining region Y)-box 9 3 1
MIRT007188 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 3 1
MIRT007375 FMR1 fragile X mental retardation 1 1 1
MIRT027240 PPP4R1 protein phosphatase 4, regulatory subunit 1 1 1
MIRT027241 CERK ceramide kinase 1 1
MIRT027242 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT027243 GMEB2 glucocorticoid modulatory element binding protein 2 1 1
MIRT027244 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT027245 MRPL44 mitochondrial ribosomal protein L44 1 1
MIRT027246 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT027247 UBE2B ubiquitin-conjugating enzyme E2B (RAD6 homolog) 1 1
MIRT027248 VEGFA vascular endothelial growth factor A 1 1
MIRT027249 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT027250 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT027251 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 1 1
MIRT027252 ZNF567 zinc finger protein 567 1 1
MIRT027253 TMEM192 transmembrane protein 192 1 1
MIRT027254 PRPF38B PRP38 pre-mRNA processing factor 38 (yeast) domain containing B 1 1
MIRT027255 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT027256 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT027257 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT027258 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT027259 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT027260 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT027261 SLC38A2 solute carrier family 38, member 2 1 1
MIRT027262 REEP5 receptor accessory protein 5 1 1
MIRT027263 ZNF792 zinc finger protein 792 1 1
MIRT027264 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT027265 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT027266 TMEM168 transmembrane protein 168 1 1
MIRT027267 DIMT1 DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 1 1
MIRT027268 INA internexin neuronal intermediate filament protein, alpha 1 1
MIRT027269 XIAP X-linked inhibitor of apoptosis 1 1
MIRT027270 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT027271 KCNG3 potassium voltage-gated channel, subfamily G, member 3 1 1
MIRT027272 CCDC125 coiled-coil domain containing 125 1 1
MIRT027273 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT027274 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT027275 CHAMP1 zinc finger protein 828 1 1
MIRT027276 MNX1 motor neuron and pancreas homeobox 1 1 1
MIRT027277 FRMD6 FERM domain containing 6 1 1
MIRT027278 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT027279 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT027280 MPPE1 metallophosphoesterase 1 1 1
MIRT027281 MRPL42 mitochondrial ribosomal protein L42 1 1
MIRT027282 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 1 1
MIRT027283 SREK1IP1 SFRS12-interacting protein 1 1 1
MIRT027284 OTUD4 OTU domain containing 4 1 1
MIRT027285 C10orf88 chromosome 10 open reading frame 88 1 1
MIRT027286 KIAA1462 KIAA1462 1 1
MIRT027287 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT027288 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT027289 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT027290 AP1S3 adaptor-related protein complex 1, sigma 3 subunit 1 1
MIRT027291 STAMBP STAM binding protein 1 1
MIRT027292 UBE2D3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 1 1
MIRT027293 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 1
MIRT027294 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT027295 NUPL2 nucleoporin like 2 1 1
MIRT027296 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT027297 MBNL2 muscleblind-like 2 (Drosophila) 1 1
MIRT027298 RANBP9 RAN binding protein 9 1 1
MIRT027299 ICK intestinal cell (MAK-like) kinase 1 1
MIRT027300 MTSS1L metastasis suppressor 1-like 1 1
MIRT027301 ZBTB21 zinc finger protein 295 1 1
MIRT027302 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT027303 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT027304 MRGBP chromosome 20 open reading frame 20 1 1
MIRT027305 MOB4 MOB1, Mps One Binder kinase activator-like 3 (yeast) 1 1
MIRT027306 INO80D INO80 complex subunit D 1 1
MIRT027307 MEIS1 Meis homeobox 1 1 1
MIRT027308 DCTD dCMP deaminase 1 1
MIRT027309 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT027310 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT027311 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT027312 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT027313 ACVR2B activin A receptor, type IIB 1 1
MIRT027314 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT027315 MBTD1 mbt domain containing 1 1 1
MIRT027316 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT027317 KIF2C kinesin family member 2C 1 1
MIRT027318 JUN jun oncogene 1 1
MIRT027319 USP25 ubiquitin specific peptidase 25 1 1
MIRT027320 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT027321 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT027322 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT027323 LTN1 ring finger protein 160 1 1
MIRT027324 FZD6 frizzled homolog 6 (Drosophila) 1 1
MIRT027325 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT027326 XPO7 exportin 7 1 1
MIRT027327 BTG2 BTG family, member 2 1 1
MIRT027328 MMS22L chromosome 6 open reading frame 167 1 1
MIRT027329 FOXP4 forkhead box P4 1 1
MIRT027330 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT027331 SPATA2 spermatogenesis associated 2 1 1
MIRT027332 FBXO11 F-box protein 11 1 1
MIRT027333 RNF44 ring finger protein 44 1 1
MIRT027334 E2F3 E2F transcription factor 3 1 1
MIRT027335 LMNB1 lamin B1 1 1
MIRT027336 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT027337 HOXA9 homeobox A9 1 1
MIRT027338 FAR1 fatty acyl CoA reductase 1 1 1
MIRT027339 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT027340 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT027341 RTN4 reticulon 4 1 1
MIRT027342 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT027343 CTR9 Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT027344 CERS2 LAG1 homolog, ceramide synthase 2 1 1
MIRT027345 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT027346 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT027347 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT027348 RIOK2 RIO kinase 2 (yeast) 1 1
MIRT027349 CBX4 chromobox homolog 4 (Pc class homolog, Drosophila) 1 1
MIRT027350 SEPT11 septin 11 1 1
MIRT027351 QSER1 glutamine and serine rich 1 1 1
MIRT027352 MYO9A myosin IXA 1 1
MIRT027353 CAPN2 calpain 2, (m/II) large subunit 1 1
MIRT027354 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 1
MIRT027355 SSFA2 sperm specific antigen 2 1 1
MIRT027356 TBC1D12 TBC1 domain family, member 12 1 1
MIRT027357 SPAG1 sperm associated antigen 1 1 1
MIRT027358 ZNF800 zinc finger protein 800 1 1
MIRT027359 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT027360 BLOC1S6 pallidin homolog (mouse) 1 1
MIRT027361 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT027362 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT027363 TMEM170B transmembrane protein 170B 1 1
MIRT027364 AFF4 AF4/FMR2 family, member 4 1 1
MIRT027365 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT027366 LBR lamin B receptor 1 1
MIRT027367 ZFX zinc finger protein, X-linked 1 1
MIRT027368 KLF12 Kruppel-like factor 12 1 1
MIRT027369 PHF3 PHD finger protein 3 1 1
MIRT027370 C1orf52 chromosome 1 open reading frame 52 1 1
MIRT027371 TSPAN12 tetraspanin 12 1 1
MIRT027372 FAM217B chromosome 20 open reading frame 177 1 1
MIRT027373 SUB1 SUB1 homolog (S. cerevisiae) 1 1
MIRT027374 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT027375 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT027376 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT027377 TRERF1 transcriptional regulating factor 1 1 1
MIRT027378 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT027379 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase, type I, gamma 1 1
MIRT027380 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT027381 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT027382 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT027383 LRCH2 leucine-rich repeats and calponin homology (CH) domain containing 2 1 1
MIRT027384 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT027385 FBXW7 F-box and WD repeat domain containing 7 1 1
MIRT027386 POU2F1 POU class 2 homeobox 1 1 1
MIRT027387 CBFA2T2 core-binding factor, runt domain, alpha subunit 2; translocated to, 2 1 1
MIRT027388 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT027389 AEBP2 AE binding protein 2 1 1
MIRT027390 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT027391 MFSD6 major facilitator superfamily domain containing 6 1 1